ID: 1173499087

View in Genome Browser
Species Human (GRCh38)
Location 20:43539405-43539427
Sequence GCCTCCCCCTTGGTGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173499087_1173499095 26 Left 1173499087 20:43539405-43539427 CCAGGCCCCACCAAGGGGGAGGC 0: 1
1: 0
2: 3
3: 39
4: 264
Right 1173499095 20:43539454-43539476 TCAGTACAGCTGCTTGAGGTAGG 0: 1
1: 0
2: 0
3: 20
4: 183
1173499087_1173499096 29 Left 1173499087 20:43539405-43539427 CCAGGCCCCACCAAGGGGGAGGC 0: 1
1: 0
2: 3
3: 39
4: 264
Right 1173499096 20:43539457-43539479 GTACAGCTGCTTGAGGTAGGAGG 0: 1
1: 0
2: 3
3: 12
4: 144
1173499087_1173499094 22 Left 1173499087 20:43539405-43539427 CCAGGCCCCACCAAGGGGGAGGC 0: 1
1: 0
2: 3
3: 39
4: 264
Right 1173499094 20:43539450-43539472 CAGCTCAGTACAGCTGCTTGAGG 0: 1
1: 0
2: 1
3: 19
4: 164
1173499087_1173499092 -5 Left 1173499087 20:43539405-43539427 CCAGGCCCCACCAAGGGGGAGGC 0: 1
1: 0
2: 3
3: 39
4: 264
Right 1173499092 20:43539423-43539445 GAGGCCAAGCTGAGCAGCATCGG 0: 1
1: 0
2: 6
3: 73
4: 772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173499087 Original CRISPR GCCTCCCCCTTGGTGGGGCC TGG (reversed) Intronic
900158073 1:1211532-1211554 GCGTCCACCTTGGTGGGCCCAGG + Exonic
900496504 1:2978384-2978406 CCCTCCCCTCTGGTGGGGCCTGG - Intergenic
900938279 1:5780848-5780870 GCTGCCCCCTTGGTGAGGGCAGG + Intergenic
901034625 1:6328930-6328952 CCCTCCCCCTTGGCCTGGCCAGG + Intronic
901793093 1:11664572-11664594 GCCTCCGCCTGGGTGGCCCCGGG - Intronic
902199824 1:14825036-14825058 GCATCCCCCTTGCTGAAGCCGGG + Intronic
902230361 1:15023612-15023634 CGCTCCCCCTTGATGGGGACAGG + Intronic
903128010 1:21260863-21260885 GCTTCCTCCTTGGAGGGGCTAGG + Intronic
903193749 1:21670150-21670172 GGCTCCCCCTTGGTGGGGAGTGG - Intergenic
903287245 1:22284980-22285002 GCCTCACCCTGGGCTGGGCCTGG + Intergenic
903732292 1:25505463-25505485 GCCTCCATCCTGCTGGGGCCTGG + Intergenic
903855679 1:26336558-26336580 GCCTCCCCGGTGGCGGGACCTGG - Intronic
904333785 1:29784307-29784329 GCCTCCCCAGTGGAGGGACCGGG - Intergenic
904500253 1:30908905-30908927 GGCTCCCTCTGGGTGGGGGCGGG - Intergenic
905792733 1:40798939-40798961 GCCCCTCCCTTGTTGGGGTCTGG + Intronic
906309997 1:44747010-44747032 GCCTCAGCCTCGGGGGGGCCAGG + Intronic
907010765 1:50960486-50960508 GCCTCCCCCTAGCTGAGGCGGGG + Intergenic
912551738 1:110489491-110489513 ACCTCCCTGCTGGTGGGGCCTGG + Intergenic
912572903 1:110637589-110637611 GTCTGCCCCTGGGTGGGGCCTGG + Intergenic
914845668 1:151282430-151282452 TCCGCCCCCTTGGGGGGGGCGGG + Intronic
915031912 1:152886940-152886962 GCCTTTCCCTTGCTGGGGTCTGG + Intergenic
915324277 1:155072639-155072661 GCCTGCCCCTTGCTGGAACCAGG - Intergenic
917845147 1:179014495-179014517 TCCTCCCAGCTGGTGGGGCCAGG + Intergenic
918044840 1:180935545-180935567 GCCTTCCCCTGGGCGGGGCGCGG - Exonic
918305297 1:183240462-183240484 GACTCCCCTTTGCTGGGGCTAGG - Intronic
920348474 1:205321887-205321909 TCCTCCCCCTCGGCGTGGCCGGG + Intergenic
921285827 1:213608283-213608305 GCCTTCCCCCTGCTGGGACCTGG - Intergenic
922583590 1:226717493-226717515 GCCTCACCCAGAGTGGGGCCTGG + Intronic
1065493753 10:26308344-26308366 GTCTCCCACGTGGTGTGGCCGGG + Intergenic
1066628164 10:37431004-37431026 GCCGGCCCCATGGTGGTGCCTGG - Intergenic
1067044456 10:42976427-42976449 CCCTGCCCCTTGGTGGGGACAGG - Intergenic
1069634933 10:69919251-69919273 GCCTCCCCCTCCCTGGGTCCTGG + Intronic
1070798521 10:79231139-79231161 GCTGTCCCCTTGGTGGGGCTGGG - Intronic
1071568991 10:86686240-86686262 GCCACCCCCTTGGTGGCCCAGGG - Intronic
1072232639 10:93426027-93426049 GCCTCCCCCTGGGGGTGGCTGGG + Intronic
1072808932 10:98445040-98445062 GCTCACCCCTTGGTGGGGGCTGG + Intronic
1072916575 10:99540663-99540685 GCCTCTGCCAGGGTGGGGCCGGG + Intergenic
1074943167 10:118254613-118254635 GCCTCTCGCTTGGGGGAGCCAGG + Intergenic
1076221106 10:128733820-128733842 GCCTCCCCATTGTTAGGCCCAGG + Intergenic
1076478411 10:130768193-130768215 GCCTCCCCCTTGGAAGGTCATGG + Intergenic
1076808064 10:132869214-132869236 GTCTCGCCCTTGGTGCGGCCAGG - Intronic
1076912616 10:133399290-133399312 GCCTTCTCCTTGGAGAGGCCAGG - Intronic
1077164534 11:1129159-1129181 GCCTCGGTCCTGGTGGGGCCTGG + Intergenic
1078931180 11:15913038-15913060 GCCTCGCCCTTACTGGGGCCAGG + Intergenic
1080223539 11:29934390-29934412 GCCTCCCCATGGGTAGGGCTCGG + Intergenic
1080751200 11:35152004-35152026 GCCTCACCCGTGGTGGCGACAGG + Intronic
1081738693 11:45423201-45423223 CCCTGGCCCTTGGTGGGGGCTGG + Intergenic
1081842982 11:46216905-46216927 CCCTCCCCTTAAGTGGGGCCTGG + Intergenic
1082810007 11:57474085-57474107 GCCTACCCCCTGGATGGGCCTGG + Intronic
1083173615 11:60936575-60936597 CCCTCCCCCTTGGGCGGGCCAGG - Exonic
1083294639 11:61708716-61708738 GCCTCCCTCTTGGGGTGGCTGGG - Intronic
1083306544 11:61764786-61764808 CCCCTCCCCTTGGTGGGGCCGGG + Intronic
1083538028 11:63490107-63490129 GCCTTCCCCTTGCTGGGTACCGG + Intronic
1083571710 11:63764859-63764881 GCCTCGCACCTGGTGGGGACTGG + Exonic
1084273981 11:68042680-68042702 GCCTCCCCTTTGGCGGGGGCAGG - Exonic
1084308318 11:68300678-68300700 ACCTCGCCCTTGGTGGGGGCCGG + Intergenic
1090279793 11:125445861-125445883 GCCTCCCCCTTGCTGGTGTCAGG - Exonic
1090993003 11:131837762-131837784 GGCTCCCCCAGCGTGGGGCCTGG - Intronic
1091235537 11:134019912-134019934 CCCTTCCCCTTGGTCGGGTCAGG - Intergenic
1091386906 12:101568-101590 CCCTCCCCCTGGCTGGGGACAGG + Intronic
1091654796 12:2337783-2337805 GCCTCCCCAGTGGTGGGTCCTGG - Intronic
1092102861 12:5900691-5900713 CCTTCCCCATGGGTGGGGCCGGG + Intronic
1094493563 12:30976072-30976094 GCCTCACCCTGGGTGGGGTGAGG + Intronic
1095978632 12:47957415-47957437 GACTCCAACTTGGTGGGGGCAGG + Intergenic
1096778156 12:53976195-53976217 ACCTCCCCCGTGCTGGGGCCTGG + Exonic
1102044715 12:109822553-109822575 GCCTCCCCCTTTCTGGAGCAAGG - Intronic
1102518978 12:113467535-113467557 GACTCCCCCGAGGCGGGGCCGGG + Intronic
1102586076 12:113923886-113923908 GCCTGCTGCCTGGTGGGGCCTGG + Intronic
1102601811 12:114037182-114037204 GCATCCCCCTCACTGGGGCCAGG + Intergenic
1105967371 13:25397025-25397047 GCGTGCCCCTTGGTGGGGGTGGG + Intronic
1112306567 13:98279987-98280009 ACCTCCCCCTGGGAGGAGCCAGG - Intronic
1112803078 13:103133503-103133525 GCTTCCCCCTTGGTGGTCACTGG + Intergenic
1119420070 14:74503159-74503181 GCATCCCCCTCCCTGGGGCCTGG + Intronic
1119515001 14:75240967-75240989 GCCTCACCCAGGGTGTGGCCTGG - Intronic
1119522200 14:75294449-75294471 GCCTCCGCCTGGGTGGGTCCCGG - Intergenic
1120870339 14:89330906-89330928 GCCTACCCCTTGGTGGGCCCAGG - Intronic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1122598032 14:102907148-102907170 GCCTCCCTCAGGGTGGGACCAGG - Exonic
1122785247 14:104160501-104160523 CTCACCCCCTGGGTGGGGCCTGG + Intronic
1122789593 14:104178723-104178745 GCCTCCCTCGGGGTGGGGCGGGG - Exonic
1122797107 14:104211502-104211524 GCCTCCTCCCTGGTGAGGCCTGG - Intergenic
1122906347 14:104803347-104803369 GCATCCCCCAGGGTGGGGTCTGG + Exonic
1122939485 14:104974864-104974886 GCCCCCCACTTGCTGGGGCTTGG + Intronic
1123970580 15:25504410-25504432 ACCTCCCCCTAGGTGGGCCTGGG - Intergenic
1125350178 15:38758444-38758466 GCCTCGCCCTTTGCGAGGCCTGG + Intergenic
1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG + Intronic
1126787249 15:52187174-52187196 GCCTGGCCCATGGTGGGGCTTGG + Intronic
1127690891 15:61396285-61396307 GCCTGCTCCTTGATGGGGCAGGG + Intergenic
1128063771 15:64751523-64751545 GCCGCCCCCTGGGTAGAGCCTGG - Intronic
1128450278 15:67802094-67802116 GCCTCCACGTGGGAGGGGCCCGG + Intronic
1129454737 15:75670609-75670631 GCCTCCCCCATGGAGGAGCAGGG - Intergenic
1129737914 15:77976092-77976114 GACTTCCCCTTGGTGCTGCCTGG + Intergenic
1129868416 15:78925889-78925911 CCTTCCCCCTTGGAGGGGACAGG - Intronic
1130302323 15:82689336-82689358 GCCTCCCTCCGGGCGGGGCCTGG - Intronic
1130652903 15:85772393-85772415 GCCTCCCCTCTGGCAGGGCCAGG - Intronic
1131554742 15:93387226-93387248 TCCTCTTCCTTGGTGGGGCTAGG + Intergenic
1132050212 15:98601512-98601534 GACTCTGCCTTGGTGGGGCCGGG - Intergenic
1132176117 15:99716664-99716686 GCCTCCCCCTTGTCGGCTCCCGG + Intronic
1132378433 15:101348231-101348253 GCCTCCCCCACGGTGAAGCCTGG - Intronic
1132577687 16:671506-671528 GCCTCCCACGTGCTGGAGCCAGG + Intronic
1132931602 16:2461614-2461636 GGCTCATCCTTGGTGGGGTCGGG + Intronic
1133232955 16:4374928-4374950 GCTTGCCCCTGGGTGGGGACAGG + Intronic
1133813592 16:9179684-9179706 GCGTCTCCCATGGTGGGACCGGG + Intergenic
1134213937 16:12301370-12301392 GCCTGCCCCTAGGAAGGGCCAGG + Intronic
1135526584 16:23217731-23217753 TCCTCCCCAATGGTGGGGACAGG + Intergenic
1135574438 16:23574610-23574632 GTCTGCTCCTTGGTGGGCCCTGG + Intergenic
1136108998 16:28052960-28052982 GTCTCCCTCAAGGTGGGGCCCGG + Intronic
1136291353 16:29274091-29274113 GCCTCCCACTTGGTTGAGGCTGG - Intergenic
1136365208 16:29806464-29806486 GACGCCCCCTGGGTGGGGGCGGG - Intronic
1136523689 16:30814338-30814360 ACCTCTCCCTGGGCGGGGCCGGG + Intergenic
1137719245 16:50618370-50618392 CAATCCCCCTTGGTGTGGCCTGG + Intronic
1138567802 16:57846203-57846225 CCCTCTCCCTGGGTGGGGCTGGG + Intronic
1141170412 16:81687229-81687251 GCATCCCCCATGCTGGGCCCCGG - Intronic
1141621451 16:85238602-85238624 CACTCCCCCTTGGAGGAGCCAGG + Intergenic
1141677182 16:85524032-85524054 GTCTCCCGGGTGGTGGGGCCAGG + Intergenic
1142097227 16:88248010-88248032 GCCTCCCACTTGGTTGAGGCTGG - Intergenic
1142122691 16:88394861-88394883 GCCTGCCCAGTGGTGGGCCCAGG - Intergenic
1142157682 16:88540035-88540057 CCCTCCTCCTTGGAGGTGCCAGG + Intergenic
1142263024 16:89051320-89051342 GCCTCCACCTTGAAGGGGCTAGG - Intergenic
1142284746 16:89167181-89167203 GCCTCAGCCTTGCTGGGGCCTGG + Intergenic
1142534012 17:601059-601081 GCCTCCCTTTTGGTGGTGTCTGG + Intronic
1142799457 17:2336482-2336504 CCCGCCCCCTTGGAGGGGACCGG - Exonic
1143012311 17:3872693-3872715 CCCCCTCCCTTGGTGGGGGCAGG + Intronic
1143026580 17:3944929-3944951 GCCTCTCCCGGGGCGGGGCCAGG - Intronic
1143119197 17:4596757-4596779 GCACCCTCCTTGGTGGTGCCAGG + Intronic
1143148261 17:4790177-4790199 GCCTCCGCCTCGGTGGCTCCGGG - Exonic
1143517113 17:7425458-7425480 GGCTCCTACTTGGTGGAGCCTGG - Intergenic
1144223383 17:13120553-13120575 CCCTCCCCCTGGGTGGTGGCTGG + Intergenic
1144632836 17:16882675-16882697 ACCTCCCACTGGGTGGTGCCTGG + Intergenic
1144638540 17:16925557-16925579 ACCTCCCACTGGGTGGTGCCGGG + Intergenic
1144766896 17:17737978-17738000 GCCTCCCTCCTTCTGGGGCCAGG - Intronic
1144849220 17:18235633-18235655 GCCTGGCCCCTGGTGGGACCAGG + Intronic
1145036818 17:19546853-19546875 GCCTGCCACTGGGTGGGGCCAGG - Intronic
1147315406 17:39617919-39617941 GCCTCCCGCTTGGGGGAGCCGGG + Intergenic
1147925349 17:43942365-43942387 GCCTCCCCCAGGCTGGGGCCTGG - Intronic
1148623163 17:49049720-49049742 TCCACCCTCTTGGTGGGGCCTGG - Exonic
1148807814 17:50273151-50273173 GGGTCCCCCTTGGCCGGGCCAGG + Intronic
1151657484 17:75502642-75502664 GCATCCCCCTCTGTGGGGCCAGG + Exonic
1151978012 17:77493188-77493210 CCCTCCCTCTGGGTGGGGCAAGG - Intronic
1152147160 17:78575267-78575289 GCACCCCCCATGGCGGGGCCGGG - Intronic
1152231446 17:79115865-79115887 GAGCCCCCCTTGGAGGGGCCGGG - Intronic
1152609742 17:81309759-81309781 GCCTCCCCCTTCCTGGGGCTGGG - Intergenic
1152650712 17:81491363-81491385 GACCCTCCCTTGGTGGGGCGTGG - Intergenic
1152744347 17:82032060-82032082 TCCTCCCAGTGGGTGGGGCCAGG + Intronic
1153922525 18:9804241-9804263 GCCCCCTCCTTGGTGGGGACAGG + Intronic
1154483128 18:14856031-14856053 GCCTCCCACATGGGGTGGCCGGG + Intergenic
1154483488 18:14857430-14857452 GCCTCCCACATGGGGTGGCCGGG + Intergenic
1154483908 18:14859050-14859072 GCCTCCCACATGGGGTGGCCGGG + Intergenic
1155721642 18:29020722-29020744 GCTTCCCCCTTGGGGGAGTCAGG - Intergenic
1158960427 18:62583685-62583707 CCCTCCCTCTTGGTGGGGTGGGG - Intronic
1160072850 18:75643483-75643505 GGCTCTTCCTTGGTGGTGCCAGG + Intergenic
1160594001 18:79961962-79961984 GGCTCCCTCGTGGTGGGGGCAGG - Intergenic
1160706498 19:532439-532461 ACCTCCTCCTTGGCGGGGGCTGG + Intronic
1160994060 19:1873679-1873701 ACCTCCCACTTGGTATGGCCCGG - Intergenic
1161295970 19:3520316-3520338 GCCTGCCCCCTACTGGGGCCAGG - Intronic
1161355424 19:3816761-3816783 GCCTCCTCCTGCGTGGGGACAGG - Exonic
1161973336 19:7595991-7596013 GCCTCCACCATGGCGGCGCCGGG - Exonic
1162095286 19:8306504-8306526 GCTTCCTCCTGGGTGCGGCCAGG + Intronic
1162823383 19:13236673-13236695 ACCCGCCCCTTGGTGGGCCCGGG - Intronic
1163291356 19:16381373-16381395 GCCACCCCAGTGGTGGGTCCAGG + Intronic
1164915801 19:32051573-32051595 TCCTCCCTCTTGGTGGAGACTGG - Intergenic
1165483950 19:36084056-36084078 TCTTCCCCCTTGGTGGGCGCTGG + Intronic
1165778382 19:38418076-38418098 GCCCCCACCTTTGTGGGGCATGG - Intronic
1167048470 19:47065381-47065403 GGGTCCCCATTGTTGGGGCCTGG + Exonic
1167921461 19:52786340-52786362 GCCTCCCCGGGGCTGGGGCCGGG + Intronic
1168182615 19:54672365-54672387 GCCTCCCTCTTGGTGCAACCAGG + Intronic
1168695214 19:58400409-58400431 GCGTCCCCCTGGGTGGTGTCAGG - Intergenic
926044852 2:9703119-9703141 GCATCCCCGGAGGTGGGGCCAGG + Intergenic
927972180 2:27312705-27312727 GCATCCACTTTGGTGGTGCCAGG + Exonic
928330206 2:30351912-30351934 GCCTCCTCCTTGGAGGGCCGAGG - Intergenic
930728833 2:54708994-54709016 GGAGCCCCCATGGTGGGGCCAGG + Intergenic
931176381 2:59858935-59858957 GCCTCTGCCTTGGTGGTGCCAGG - Intergenic
932635779 2:73386393-73386415 TCCTCCCCCTCGGTGGGTCCTGG + Intronic
934119405 2:88825472-88825494 GCCTGGCCCGTGGTGGGACCAGG - Intergenic
935581347 2:104758443-104758465 GCCTCCTCCCTGCCGGGGCCTGG + Intergenic
936109196 2:109651110-109651132 GCCTCTCCCTTTGTGGGGAGAGG - Intergenic
936162872 2:110097995-110098017 GCCTGGCCCGTGGTGGGACCAGG - Intronic
937934963 2:127235975-127235997 GTCTCCCCCTTTGTTGGGACAGG - Intergenic
939700643 2:145386679-145386701 GCCTCTCCACTGGTAGGGCCTGG - Intergenic
942233605 2:173882869-173882891 ACCTCCCGCTTTGTGGGGCATGG - Intergenic
942501146 2:176592179-176592201 GCCCCCACCATGGTGGGGCTGGG + Intergenic
943770690 2:191713178-191713200 GCTATCCCTTTGGTGGGGCCTGG + Intergenic
946248119 2:218398607-218398629 GGCTCCCCCTCGGCAGGGCCTGG + Intronic
946299078 2:218811524-218811546 GCCTCCTCCTTGGTTAGGCAAGG - Intronic
946402085 2:219473500-219473522 GCCTCCTCCAGGGTTGGGCCTGG - Exonic
946976595 2:225159723-225159745 GCTTCCCCCTTGCTCGGCCCTGG + Intergenic
947594167 2:231400389-231400411 GCCTCACCCTTGGCAGGGACAGG - Exonic
948115721 2:235493706-235493728 GCCTCCCCCGTGCCGGGGCGCGG + Intergenic
948410685 2:237757798-237757820 GCCTGCCCCGTGGCTGGGCCGGG + Intronic
948420858 2:237859429-237859451 GCCGCCCCCCGGGAGGGGCCTGG + Intronic
948825330 2:240571090-240571112 GCCTCCCCCTTGGGGGGGGCTGG - Intronic
948902766 2:240964663-240964685 CCCTCCCGCCTGGTGGGTCCCGG + Intronic
949078117 2:242074256-242074278 CCTTCCCCCTTGGGTGGGCCTGG - Intergenic
1169022375 20:2339782-2339804 GCCTGCACCTTGGTGAGGGCTGG - Intronic
1170635287 20:18099119-18099141 GCCTCACCCTTGGTGTTGCCTGG + Intergenic
1170802028 20:19598446-19598468 GTCACCCCCTTGGTTGGGTCAGG - Intronic
1173054080 20:39594577-39594599 CCCTTCCCCTTGGTGTGGACGGG - Intergenic
1173499087 20:43539405-43539427 GCCTCCCCCTTGGTGGGGCCTGG - Intronic
1173505750 20:43585806-43585828 GCCTCCCCTTAGCTAGGGCCAGG + Intronic
1173823385 20:46032286-46032308 GCCTCCTCCTTCGCGGGGGCGGG - Intronic
1174280427 20:49435080-49435102 GCTTCCACCCTGGTGGGGACAGG - Intronic
1175266762 20:57708219-57708241 GGCTGCCCCTAGCTGGGGCCCGG - Intronic
1175440789 20:58989767-58989789 GCCTCCACCGTGCTCGGGCCCGG - Intronic
1176976257 21:15326199-15326221 GCCCCCACCTTCGTGTGGCCAGG + Intergenic
1180205330 21:46256112-46256134 GCCTCCCAGTGGGTGGGGACTGG - Intronic
1181568110 22:23751774-23751796 GCCGCCCCCTTGGCCGGGCGCGG + Intergenic
1182288286 22:29260525-29260547 GCCTCAGGCTTGGTGGGGGCAGG + Exonic
1182468794 22:30534240-30534262 GCATGCCCCTTGGTGGGCCTTGG + Intronic
1183350028 22:37329863-37329885 GCCTCCCCCTCACTGGGGCCTGG - Intergenic
1183380989 22:37490466-37490488 GCCTCCCTCTTGGGGGGCCGAGG - Exonic
1183655964 22:39184881-39184903 GCCTCCCCAGTGGTGGTGACAGG - Intergenic
1184276489 22:43411983-43412005 GACTCCTCCTTCGTGGGGCGGGG - Intronic
1184712806 22:46263068-46263090 GCTTCCCCCATGGCGGGACCGGG - Exonic
1184919724 22:47597256-47597278 GCCTGCCCCGTGGAGAGGCCAGG + Intergenic
1185039054 22:48495141-48495163 GCCTCCGCTTTGGAGGGGCCTGG + Intronic
1185284253 22:49993351-49993373 GCACCCCCCTTTCTGGGGCCCGG + Intergenic
950205338 3:11075904-11075926 ACCTCCCCATTGGTGTCGCCTGG + Intergenic
950476860 3:13220224-13220246 GCAGTCCCCTTGGAGGGGCCAGG - Intergenic
950569869 3:13793269-13793291 GCCTCTCCCTGGGGGGGCCCGGG - Intergenic
950669085 3:14514448-14514470 GCCTCCAGCACGGTGGGGCCGGG - Exonic
953032775 3:39188993-39189015 TCCTCCACCTGGCTGGGGCCTGG + Exonic
953439539 3:42906143-42906165 GCCTCCCGGATGCTGGGGCCTGG + Intronic
955356388 3:58236486-58236508 GCCTCCACGCTGGTGGAGCCTGG - Intergenic
963866845 3:150370521-150370543 GCATCCCCAAGGGTGGGGCCTGG - Intergenic
967924128 3:194633205-194633227 GCCTCCCCCATGGCGCGGCTGGG + Exonic
969567284 4:7985955-7985977 TCCTGCCCCTTGCTGGGGCCCGG + Intronic
969573857 4:8025311-8025333 GACCTCCCCTGGGTGGGGCCAGG - Intronic
971372306 4:26028902-26028924 GCCCCCTCCTGGGTGGCGCCCGG - Intergenic
973268251 4:48232806-48232828 GCCTTCCCCTTGGTGGGACCTGG - Intronic
977313294 4:95413380-95413402 GGCCCACCCATGGTGGGGCCTGG + Intronic
978385404 4:108172194-108172216 GTCTTCCCCTTTGTGTGGCCTGG + Intergenic
985733915 5:1566316-1566338 GCCTCCCCTGAGGTGGGTCCCGG - Intergenic
994041429 5:95263892-95263914 GCCTGCCCCTGGGTGGAGACTGG - Intronic
996587677 5:125109112-125109134 GCCTGCCTATTGATGGGGCCAGG + Intergenic
997400719 5:133599761-133599783 GCCACCCCATTTTTGGGGCCTGG - Intronic
1001038404 5:168314673-168314695 GGTTCCCCCTGGCTGGGGCCAGG - Intronic
1001302753 5:170548728-170548750 TCTTCCCACTTGGTAGGGCCTGG + Intronic
1002186491 5:177457085-177457107 GCCTCACCCTGCTTGGGGCCTGG - Exonic
1002190185 5:177473740-177473762 GCCTCCCCCTGGGCCGGGCCGGG - Intronic
1007234111 6:40378231-40378253 GCTTCTCCCTGGGTGGGGCAGGG + Intergenic
1007295032 6:40815102-40815124 GTCTCCCGCTTGCAGGGGCCAGG + Intergenic
1007704984 6:43785136-43785158 TTGTCCCACTTGGTGGGGCCAGG + Exonic
1007783829 6:44269126-44269148 TCCTTCCCCTTGTTGGGGACAGG - Intergenic
1009709618 6:67300471-67300493 GCCCCCCGCTTGGTGGGGGGAGG - Intergenic
1011419444 6:87155868-87155890 GCCTCCGCCTGGGTGGGAGCGGG + Intronic
1011726363 6:90214339-90214361 CCCTCTCCCTTGGCGGGGCGGGG + Intronic
1012276673 6:97282955-97282977 GCCTCCTCCTTGGAGGGTCGGGG - Intronic
1014898098 6:126928609-126928631 GCCTACCCACTGGTGGTGCCTGG + Intergenic
1019149113 6:169992743-169992765 TCCTCACCCTGGCTGGGGCCTGG - Intergenic
1019217439 6:170452743-170452765 GGCTCTTCCTTGATGGGGCCTGG + Intergenic
1019280618 7:198019-198041 GCCTCCGCCTGGGTGTGTCCTGG + Intronic
1019426114 7:977619-977641 CTCTCCCCCTTGCTGGGCCCTGG + Intergenic
1019505288 7:1387428-1387450 GCCTCCCACCTGTGGGGGCCAGG + Intergenic
1019675856 7:2312180-2312202 GCCCTCCCTTTGGTGTGGCCTGG - Intronic
1020069264 7:5214941-5214963 TCCACCCTCTGGGTGGGGCCGGG - Intronic
1021452844 7:20798259-20798281 GCCTCCCCCTTGGCGGGAGCCGG - Intergenic
1021508571 7:21411137-21411159 GCCTGCCTCTTGGTGGAGGCAGG + Intergenic
1022666473 7:32415999-32416021 CCCTCCACCCTGGTGGAGCCTGG - Intergenic
1023987014 7:45102633-45102655 CCCTGGCCCTTGGTGAGGCCTGG + Intronic
1024604990 7:51015634-51015656 GCTGCCCCCTTGGTCTGGCCAGG + Intergenic
1026804975 7:73423947-73423969 GCCTCCCCCAGGCAGGGGCCGGG + Intergenic
1026848395 7:73710200-73710222 GCCACCCCCATCGTGGGGCAGGG + Intronic
1027228085 7:76257328-76257350 GCCTCCATCTTGGTGGGGGAGGG + Intronic
1029424890 7:100489069-100489091 GCCTTGTCCTTGGGGGGGCCGGG - Exonic
1029494834 7:100891043-100891065 GCCTCCCCATGGGTGAAGCCTGG + Exonic
1032075153 7:128832583-128832605 CCCTCCCCCGTGGCGGTGCCTGG + Intronic
1034503826 7:151469509-151469531 GCCTCCTCCCTGGGAGGGCCGGG - Intronic
1034526252 7:151664811-151664833 GCCTTCACCTGGGTGAGGCCAGG - Intronic
1036296779 8:7543699-7543721 GCCTGCCCCTGGGTGAGTCCTGG - Intergenic
1036325788 8:7777320-7777342 GCCTGCCCCTGGGTGAGTCCTGG + Intergenic
1036503860 8:9337378-9337400 GCCTTTCCATTGCTGGGGCCCGG - Intergenic
1037362093 8:18084376-18084398 CCCGCCCCGTAGGTGGGGCCGGG + Intronic
1037938204 8:22929261-22929283 GCCTGCCCCATGTTGGGCCCTGG + Intronic
1040065600 8:43141304-43141326 GCCGCCGCCTGGGAGGGGCCGGG + Intronic
1042155839 8:65842617-65842639 GCCAGTCCCTCGGTGGGGCCAGG + Intergenic
1042270242 8:66948029-66948051 GGCTCTCCCCTGGTGGGGGCTGG - Exonic
1042821212 8:72932100-72932122 GCCTCACCCTTGGTTTGGTCCGG - Intronic
1048767729 8:137862880-137862902 GCATCCCACTTGGTGGGGAGAGG - Intergenic
1052817099 9:33110149-33110171 GCCTCCTCCTTGGTGGCCCTGGG - Intronic
1053239860 9:36487203-36487225 TCCTCCCCGTCGGCGGGGCCGGG + Intronic
1056239631 9:84631466-84631488 CCCTGCCGCTTGGAGGGGCCTGG - Intergenic
1057211302 9:93202485-93202507 TCCTCTCCCCTGGTAGGGCCGGG - Intronic
1057293881 9:93824404-93824426 GCTGTCCCCTTGCTGGGGCCGGG - Intergenic
1057509926 9:95669653-95669675 GCCTCCCCCTTGTAGGTGTCGGG - Intergenic
1057612431 9:96557268-96557290 GCCTCACACTAGCTGGGGCCTGG + Intronic
1060549259 9:124477414-124477436 ACCTGCCCCTGGGAGGGGCCTGG - Intronic
1060788015 9:126465655-126465677 GCCTCCAGATTGGTGGGGGCGGG + Intronic
1060994288 9:127867497-127867519 GCCTGGCCCTTGCCGGGGCCTGG - Exonic
1061264581 9:129497603-129497625 TCCTGCCTCTTGGTGGAGCCAGG + Intergenic
1061893774 9:133636402-133636424 GCCTCCCGCATGCTGGGGCCGGG - Exonic
1061944739 9:133902314-133902336 GGCTCTGCCTTCGTGGGGCCAGG - Intronic
1062044357 9:134418201-134418223 GCCACCCCCTCAGTGGGGCCTGG - Intronic
1062119207 9:134824975-134824997 GCCTCCCCATCTGTGGGGCCGGG + Intronic
1062185475 9:135216017-135216039 CTCTCCACCTTGGTGGGTCCTGG + Intergenic
1062429775 9:136521789-136521811 GCTTCCCCTTTGCAGGGGCCAGG + Intronic
1062540776 9:137040803-137040825 GCCTCGCCCTTGGTAGGTCTTGG - Exonic
1062634925 9:137485767-137485789 GCGGGCCCCTTGGTGGGCCCTGG - Intronic
1186497715 X:10024978-10025000 GCCTCCCCCATGCTGGGGACAGG - Intronic
1186883068 X:13885688-13885710 GCCTGGCCCTTGGTGGGGCGGGG - Intronic
1187952906 X:24488214-24488236 GCCTTCCCTATGGTGGGACCAGG - Intronic
1190023863 X:46904084-46904106 GCCTGCCACTTGATGGGGCTCGG - Intergenic
1190318292 X:49164990-49165012 GCCTCACCTTAGGTGGGGGCCGG + Exonic
1191027847 X:55934814-55934836 TTCTCCCCCTTGGTGGGGAATGG + Intergenic
1191979724 X:66912510-66912532 GCCTCCCCCTTGCCCGGGGCAGG - Intergenic
1192338290 X:70239990-70240012 CCCTCTTCTTTGGTGGGGCCAGG - Intronic
1200115418 X:153767773-153767795 GCCTTCCCCATGGTGGAGCTGGG + Exonic
1201564650 Y:15353540-15353562 ACCTTCCCCATGGTGGGGTCAGG - Intergenic