ID: 1173499087

View in Genome Browser
Species Human (GRCh38)
Location 20:43539405-43539427
Sequence GCCTCCCCCTTGGTGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173499087_1173499094 22 Left 1173499087 20:43539405-43539427 CCAGGCCCCACCAAGGGGGAGGC 0: 1
1: 0
2: 3
3: 39
4: 264
Right 1173499094 20:43539450-43539472 CAGCTCAGTACAGCTGCTTGAGG 0: 1
1: 0
2: 1
3: 19
4: 164
1173499087_1173499096 29 Left 1173499087 20:43539405-43539427 CCAGGCCCCACCAAGGGGGAGGC 0: 1
1: 0
2: 3
3: 39
4: 264
Right 1173499096 20:43539457-43539479 GTACAGCTGCTTGAGGTAGGAGG 0: 1
1: 0
2: 3
3: 12
4: 144
1173499087_1173499095 26 Left 1173499087 20:43539405-43539427 CCAGGCCCCACCAAGGGGGAGGC 0: 1
1: 0
2: 3
3: 39
4: 264
Right 1173499095 20:43539454-43539476 TCAGTACAGCTGCTTGAGGTAGG 0: 1
1: 0
2: 0
3: 20
4: 183
1173499087_1173499092 -5 Left 1173499087 20:43539405-43539427 CCAGGCCCCACCAAGGGGGAGGC 0: 1
1: 0
2: 3
3: 39
4: 264
Right 1173499092 20:43539423-43539445 GAGGCCAAGCTGAGCAGCATCGG 0: 1
1: 0
2: 6
3: 73
4: 772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173499087 Original CRISPR GCCTCCCCCTTGGTGGGGCC TGG (reversed) Intronic