ID: 1173506035

View in Genome Browser
Species Human (GRCh38)
Location 20:43587843-43587865
Sequence TTCCCCGTGATTCCTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173506035 Original CRISPR TTCCCCGTGATTCCTGGGGC AGG (reversed) Intronic
900527370 1:3135818-3135840 TTCCCCGTGGCTCCCTGGGCCGG + Intronic
900796752 1:4712640-4712662 TTCCCCGTTGTTGCTGGGACTGG - Exonic
901456995 1:9368696-9368718 TTCCCCGAGAAGCCGGGGGCAGG + Exonic
901878603 1:12181115-12181137 TGACCTGTGACTCCTGGGGCTGG - Intronic
906934009 1:50195890-50195912 TGCACAGTGATTCCTGGGGGTGG - Intronic
907931062 1:59000572-59000594 TTCACAGTGATTTCTGGGGTGGG - Intergenic
911208025 1:95112185-95112207 TGCCACGTGTCTCCTGGGGCAGG + Intergenic
917438362 1:175044058-175044080 GTCCCCGTGGGTCCTGGGGGAGG + Intergenic
919687031 1:200493377-200493399 TTCCCCCTCACTCCTGGGGAAGG + Intergenic
920908703 1:210194165-210194187 TTCACTGTTATTCATGGGGCTGG - Intergenic
921089894 1:211832108-211832130 TTACACGTGATTCCTGGATCAGG + Intergenic
923783212 1:237043204-237043226 GTCCCCGCGGTTCCCGGGGCTGG + Intronic
1066012335 10:31206415-31206437 TTCCCAGTGGCTTCTGGGGCTGG + Intergenic
1067525379 10:47035408-47035430 AGCCCCCTGATTCCTGGGGTCGG + Intergenic
1069550419 10:69360347-69360369 TTCCCTGTGGATCCTGGGGTCGG + Intronic
1074053869 10:109904471-109904493 TTCCCAGTTATTTCAGGGGCGGG - Intronic
1075566482 10:123508482-123508504 TCCCTTGTGATTCCTGGTGCAGG + Intergenic
1076318062 10:129556869-129556891 TTTCCCTTGAGTTCTGGGGCGGG + Intronic
1076997793 11:307375-307397 GTCCCCGTGTCTCCTGGTGCAGG - Intergenic
1077001722 11:326751-326773 CTCCCCGTGTCTCCTGGTGCAGG + Intronic
1078523995 11:12086719-12086741 ATCCCCGTGTTCCCTGTGGCCGG + Intergenic
1079336080 11:19572034-19572056 TGCCCCCTGCTACCTGGGGCAGG + Intronic
1079711273 11:23685381-23685403 TTGCCAGTGTTTCCTGGGACTGG + Intergenic
1081507634 11:43734644-43734666 TTCACAGTGATTTCTGGGGTGGG - Intronic
1082220717 11:49632348-49632370 TTCCCAGTGATTTTTGGGGGAGG + Intergenic
1083069648 11:59963999-59964021 TTTCCTGTGATACCTTGGGCTGG + Intergenic
1086268349 11:85028758-85028780 TTCCCTGTGCTTTCAGGGGCTGG - Intronic
1086628315 11:88986766-88986788 TTCCCAGTGATTTTTGGGGGAGG - Intronic
1087398274 11:97631608-97631630 TTGCCCTTGATTCCTAGGGGAGG + Intergenic
1087466088 11:98508139-98508161 TTCACTGTGTTTCCTGGGGCTGG + Intergenic
1091705474 12:2690527-2690549 TTCCCTGTGTTGCCTGGGCCTGG + Intronic
1091958388 12:4668478-4668500 TACCCCTTGGTTCCTTGGGCTGG + Exonic
1093024754 12:14235502-14235524 TTCACTGTTATTCATGGGGCTGG - Intergenic
1094551211 12:31453673-31453695 TTCCCCTTGGTGCCTGGGGGTGG - Intronic
1096014131 12:48252199-48252221 TTACCCGTGATGCCAGGTGCAGG + Intergenic
1104376533 12:128268391-128268413 TGCCCCGCGGCTCCTGGGGCTGG - Intronic
1106978632 13:35251911-35251933 TTCACAGTGATTTCTGGGGTGGG - Intronic
1108130872 13:47298958-47298980 TTCTCCTTGCTTCCTGTGGCTGG - Intergenic
1108677522 13:52750050-52750072 TTCACCATTTTTCCTGGGGCTGG - Intergenic
1111389858 13:87578968-87578990 TTCCCCGTGTTCCTAGGGGCTGG - Intergenic
1113764926 13:112875162-112875184 TTCACTGTGCTTCCTGGAGCTGG + Intronic
1115961022 14:38836272-38836294 TTCCCTGTGTGTCCTGAGGCTGG + Intergenic
1120705685 14:87743159-87743181 TTCCCCGTGGTACCTTGGGATGG + Intergenic
1120976897 14:90256798-90256820 TTGCCCGGGGATCCTGGGGCCGG + Intronic
1122394233 14:101411457-101411479 TTCTCGGTGACTCTTGGGGCTGG - Intergenic
1124653526 15:31489496-31489518 TTCCCCCTAAATCCTGGGGCCGG - Intronic
1128886618 15:71293941-71293963 ACCACCGTGAATCCTGGGGCAGG + Intronic
1128923233 15:71631034-71631056 TTCCCAGTGTCTCCTGGGGAGGG + Intronic
1129014248 15:72451552-72451574 TTCACAGTGATTCCTGGGGTAGG - Intergenic
1131248274 15:90814561-90814583 TTCCTGGGGCTTCCTGGGGCTGG + Intronic
1132318834 15:100910220-100910242 TTCCCCCTTATCCCTGTGGCTGG + Intronic
1132625623 16:890163-890185 TTCACTGTGTCTCCTGGGGCAGG - Intronic
1132712621 16:1276306-1276328 TTTCCGGTGAGTCCTGGGCCGGG - Intergenic
1137966145 16:52935715-52935737 TTTCACGTGATTTCTGGGGTGGG - Intergenic
1138614989 16:58158114-58158136 TTCCCCATGCTTTCTGGGTCGGG + Exonic
1139301040 16:65945589-65945611 TGTCCTGGGATTCCTGGGGCTGG - Intergenic
1139659335 16:68410193-68410215 TGCCCCGTGGGTGCTGGGGCTGG + Intronic
1140813619 16:78601036-78601058 TTCCACATAATACCTGGGGCAGG + Intronic
1140934574 16:79658530-79658552 TTCCCCTTGAATGCTGGGGACGG + Intergenic
1141991600 16:87614053-87614075 TTCACTGTGAGACCTGGGGCAGG - Intronic
1143012193 17:3872232-3872254 TTCCCCTTGAGTCCAGGGGCTGG + Intronic
1143416699 17:6755926-6755948 TTCCCCTTGATTCCTGAGGCTGG - Exonic
1143975377 17:10825496-10825518 TTCCCAGTTACTCCTGGGGGTGG + Exonic
1146224054 17:31050730-31050752 TTTCATTTGATTCCTGGGGCAGG + Intergenic
1147805162 17:43126070-43126092 TTGCCCCAGACTCCTGGGGCTGG - Intergenic
1147811171 17:43170908-43170930 TTGCCCGAGACTCGTGGGGCTGG - Exonic
1148670256 17:49404892-49404914 TTCACAGTGATTTCTGGGGTGGG + Exonic
1148736135 17:49865916-49865938 TTCCCCTGCATTCCTGGGGGAGG + Intergenic
1154983810 18:21528522-21528544 TTCCCCGTGATTCATCAAGCTGG - Intergenic
1163824289 19:19514397-19514419 TTCCCCGCGATCCCGGGAGCTGG - Exonic
1165074622 19:33273857-33273879 TTCCCCATGGCCCCTGGGGCAGG - Intergenic
1165144485 19:33722614-33722636 TTCCCCCTCTTCCCTGGGGCTGG + Intronic
1167410771 19:49342421-49342443 CTCCAGGTGATGCCTGGGGCTGG - Exonic
1167465034 19:49646166-49646188 TGCCCCCTGATTCCTGGGAACGG - Exonic
1167524039 19:49972701-49972723 CTCCCCTTGGTCCCTGGGGCAGG - Intergenic
1168452942 19:56479956-56479978 TTCCCATGGGTTCCTGGGGCAGG - Intergenic
926113611 2:10197453-10197475 TTCCCAGTGCTGCCTGGGGCAGG - Intronic
926671322 2:15579497-15579519 TGCCCCTTGATTCCTGGACCTGG - Intergenic
929019557 2:37538288-37538310 TTGCCCATGGTTCCTAGGGCTGG + Intergenic
929584436 2:43105009-43105031 TTCTCCCTGATGCTTGGGGCAGG + Intergenic
936608043 2:113977063-113977085 TTCCCCTTGATTACTGAAGCAGG - Intergenic
938473842 2:131589975-131589997 TTCCCCTTGCTTCCTGGCTCAGG + Intergenic
939194266 2:138953287-138953309 TTCCCCGTGATTCTTCGTGATGG + Intergenic
941037431 2:160583792-160583814 TGCCAGTTGATTCCTGGGGCTGG + Intergenic
945955524 2:216082442-216082464 TTCCCCTTGATTCTTGGGTGGGG - Intronic
946371313 2:219283150-219283172 TTCTCCTTCAGTCCTGGGGCTGG + Exonic
946397579 2:219451110-219451132 TACCCCGTTATTCCTGTGTCCGG + Intronic
947489337 2:230580424-230580446 TCACCCATCATTCCTGGGGCAGG - Intergenic
1169124815 20:3119990-3120012 TTGCCAGTGATTTCTAGGGCCGG - Intronic
1169418941 20:5443571-5443593 TTCTCAGTGATTCCTAGAGCTGG + Intergenic
1172123258 20:32610819-32610841 CCCCCCGTGAATCCTGGAGCAGG + Intergenic
1172998146 20:39085951-39085973 TTCCCTCTGCTTCCAGGGGCAGG - Intergenic
1173506035 20:43587843-43587865 TTCCCCGTGATTCCTGGGGCAGG - Intronic
1174124553 20:48293853-48293875 TTCCCAGTGGTCCCTGGAGCTGG - Intergenic
1174276849 20:49410110-49410132 TTCCACGTGATTCCTCTGTCCGG + Intronic
1174513930 20:51076748-51076770 TTCCTCCCAATTCCTGGGGCAGG + Intergenic
1176386688 21:6141513-6141535 CTCCGCCTGTTTCCTGGGGCTGG - Intergenic
1179736785 21:43396739-43396761 CTCCGCCTGTTTCCTGGGGCTGG + Intergenic
1180751802 22:18129863-18129885 TTTCCCATGGTTCCTGGGGTTGG + Intronic
1183136906 22:35897705-35897727 TACCCCTTGTTTCCTTGGGCTGG - Intronic
1183685973 22:39361735-39361757 TGCCCCGAGACTCCTGGGGTAGG - Intronic
949708793 3:6850347-6850369 TTCCCACTGTTGCCTGGGGCTGG - Intronic
954510601 3:51121442-51121464 TTCCCTGGGATTCCTGGGCAAGG - Intronic
954707272 3:52487715-52487737 TGCCCCGAGACTCCTGGTGCGGG - Exonic
956627323 3:71279407-71279429 TTCCCTGTCATGCATGGGGCAGG + Intronic
960336610 3:116425403-116425425 TTCCACGTGTTGCCTGGGCCAGG - Intronic
961627306 3:128272964-128272986 TGCCCCGTGAGTGATGGGGCAGG - Intronic
961823231 3:129585935-129585957 TACCCAGTGAGTCCTGGGGGAGG - Exonic
961823896 3:129588814-129588836 GGCCCCGAGATTCCTGGAGCTGG - Intronic
961870142 3:129981561-129981583 TTCCCCATGCTTCCTGGTTCAGG + Intergenic
967904048 3:194486625-194486647 TCCCCCGCGGTCCCTGGGGCTGG - Intronic
968188326 3:196649174-196649196 TTCCCAGTGCTTCCTGGAGAAGG + Intronic
968261517 3:197328617-197328639 TTCCCCTTGCTACCTGGGGGAGG - Intergenic
968510237 4:992341-992363 TGCCCTGTGGGTCCTGGGGCTGG + Intronic
970819676 4:20197639-20197661 TTCACCGCTATTCATGGGGCTGG - Intergenic
972503065 4:39696065-39696087 CTCCTCTTGGTTCCTGGGGCGGG + Intergenic
976095229 4:81501500-81501522 TTCACCAAGCTTCCTGGGGCTGG - Intronic
980838605 4:138229139-138229161 TTCCCTGTGATCCCTGGGGAAGG - Intronic
981212459 4:142124167-142124189 TCCCCCATGAATCCTGGGACAGG - Intronic
985039078 4:185870687-185870709 TGCCCGGTGAATCCTGGGACTGG + Intronic
986721269 5:10563316-10563338 CTCCCCGTCAGTCCTGGCGCCGG - Intergenic
990514522 5:56519178-56519200 TTCCCCAGCATTCATGGGGCTGG - Intronic
990983151 5:61619579-61619601 CTCCCCTTGACTCCTGGGCCTGG - Intergenic
995242557 5:109901505-109901527 TTCCACAGGATTCCTGGGGTTGG + Intergenic
996221727 5:120941126-120941148 TTCACCATTATCCCTGGGGCTGG - Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
998734808 5:145124891-145124913 TGACCCGTCATTCCTGGGGCTGG - Intergenic
999384938 5:151147424-151147446 TGCCCAGTGATTCCAGGGGAAGG - Intronic
1000926862 5:167204620-167204642 TTCACTGTGATGCCAGGGGCAGG + Intergenic
1007105839 6:39282358-39282380 TTCCTGGTGATTCCTGTGGAAGG + Intergenic
1007631989 6:43277668-43277690 TTCCCCGGCATTCCTGGGTGTGG + Intronic
1008433271 6:51445612-51445634 ATCCTCCTGAGTCCTGGGGCAGG - Intergenic
1013191372 6:107806727-107806749 TTCACCATGAGTCCTGGGGCTGG - Intronic
1013423743 6:109991382-109991404 TTCTCCGTAATTACTGGGGCAGG + Intergenic
1015440550 6:133241773-133241795 TCCCCCGGGAGCCCTGGGGCGGG - Intronic
1019147974 6:169986928-169986950 TGCCCAGTGCTGCCTGGGGCAGG - Intergenic
1019189514 6:170243436-170243458 TTCCCCGTGACCTCTGGGGATGG - Intergenic
1024039612 7:45542113-45542135 TTCCTGGTGCTTCCTGGAGCAGG - Intergenic
1025605503 7:63037527-63037549 TTCCCTCTGATCCCTGGGGGTGG - Intergenic
1026665720 7:72337960-72337982 TTGCCCTTGAGACCTGGGGCAGG - Intronic
1031536696 7:122942637-122942659 TTCCCCTGGAATCCTGGGACAGG + Intergenic
1032109433 7:129062949-129062971 TGCCCCGTGATTCCAGGAGAGGG + Intergenic
1032265297 7:130366237-130366259 TTCCTCTTGACTCCTGGGGCTGG - Intronic
1035346951 7:158206545-158206567 CTCCCCGAGCTTCCTGGAGCTGG - Intronic
1037261997 8:17019926-17019948 TTTCCTGTGATTTCTGGGCCTGG + Intergenic
1037635893 8:20700851-20700873 TTCCCAGGGAGGCCTGGGGCTGG + Intergenic
1038327212 8:26580131-26580153 TTCGCGGTGATGGCTGGGGCAGG + Intronic
1038859969 8:31376093-31376115 CTCCCAGTGACTCCTGGGGAAGG - Intergenic
1042849592 8:73203306-73203328 AGCCCTGTGATTCCTTGGGCAGG + Intergenic
1047199780 8:122755484-122755506 TACCCCATGAATTCTGGGGCAGG + Intergenic
1047268794 8:123334749-123334771 TTCCCAGTGTTTCCTGTGGAGGG - Intronic
1059613219 9:115921617-115921639 TTCACCGTGATGCCTCGGGAGGG - Intergenic
1062409859 9:136418104-136418126 TTCCTGGTGAGTCCTGGTGCTGG + Exonic
1062428286 9:136516082-136516104 TGCCCAGTGAAGCCTGGGGCCGG + Exonic
1191607359 X:63077427-63077449 TTCCCTGACATTCCTGGGGGTGG - Intergenic
1192872304 X:75195662-75195684 TACCCAGTGACTCCTGGGGAAGG - Intergenic
1194948418 X:100095630-100095652 TTCCCCATGTTGCCTGTGGCTGG - Intergenic
1195289203 X:103414901-103414923 TCCCCAGTGACTCCTGGGGAAGG - Intergenic
1195294946 X:103466774-103466796 ATACCTGTGATTCCTGGAGCTGG - Intergenic
1197019929 X:121674801-121674823 TTACCTGTGAGTCCTGGGGGTGG + Intergenic