ID: 1173515436

View in Genome Browser
Species Human (GRCh38)
Location 20:43662419-43662441
Sequence CTTTGGGAGGGCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270098
Summary {0: 7, 1: 1361, 2: 26677, 3: 81625, 4: 160428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173515436_1173515445 -5 Left 1173515436 20:43662419-43662441 CCTTCCACCTTGCCCTCCCAAAG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
Right 1173515445 20:43662437-43662459 CAAAGTGCTGGGATTATTACAGG 0: 30
1: 86
2: 177
3: 575
4: 2677
1173515436_1173515446 14 Left 1173515436 20:43662419-43662441 CCTTCCACCTTGCCCTCCCAAAG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
Right 1173515446 20:43662456-43662478 CAGGTATGAGTCACTGCACCTGG 0: 24
1: 969
2: 14809
3: 47755
4: 103298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173515436 Original CRISPR CTTTGGGAGGGCAAGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr