ID: 1173516730

View in Genome Browser
Species Human (GRCh38)
Location 20:43669586-43669608
Sequence AAGCAGAGTCCAGTTAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173516730_1173516735 2 Left 1173516730 20:43669586-43669608 CCACCACTAACTGGACTCTGCTT No data
Right 1173516735 20:43669611-43669633 TCAGCTGGGATTAGGATATGAGG 0: 1
1: 0
2: 1
3: 19
4: 176
1173516730_1173516737 18 Left 1173516730 20:43669586-43669608 CCACCACTAACTGGACTCTGCTT No data
Right 1173516737 20:43669627-43669649 TATGAGGACTTGCAGGTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 130
1173516730_1173516738 25 Left 1173516730 20:43669586-43669608 CCACCACTAACTGGACTCTGCTT No data
Right 1173516738 20:43669634-43669656 ACTTGCAGGTGTCTGGAGTTAGG 0: 1
1: 0
2: 3
3: 15
4: 202
1173516730_1173516739 29 Left 1173516730 20:43669586-43669608 CCACCACTAACTGGACTCTGCTT No data
Right 1173516739 20:43669638-43669660 GCAGGTGTCTGGAGTTAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 258
1173516730_1173516736 11 Left 1173516730 20:43669586-43669608 CCACCACTAACTGGACTCTGCTT No data
Right 1173516736 20:43669620-43669642 ATTAGGATATGAGGACTTGCAGG 0: 1
1: 0
2: 1
3: 8
4: 141
1173516730_1173516734 -6 Left 1173516730 20:43669586-43669608 CCACCACTAACTGGACTCTGCTT No data
Right 1173516734 20:43669603-43669625 CTGCTTTTTCAGCTGGGATTAGG 0: 1
1: 0
2: 1
3: 14
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173516730 Original CRISPR AAGCAGAGTCCAGTTAGTGG TGG (reversed) Intronic
No off target data available for this crispr