ID: 1173521754

View in Genome Browser
Species Human (GRCh38)
Location 20:43705151-43705173
Sequence GAGTATCCCTGAGACCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173521754_1173521758 19 Left 1173521754 20:43705151-43705173 CCCCTGAGGTCTCAGGGATACTC 0: 1
1: 1
2: 0
3: 13
4: 221
Right 1173521758 20:43705193-43705215 CTTGTTCCCTCTCTCTTCTTTGG 0: 1
1: 0
2: 4
3: 46
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173521754 Original CRISPR GAGTATCCCTGAGACCTCAG GGG (reversed) Intronic
902272000 1:15311255-15311277 GAGCACCCCGGAGATCTCAGAGG + Intronic
902840487 1:19071024-19071046 GGGCATCTCTGAGACCTGAGTGG + Intergenic
903221129 1:21870242-21870264 GAGGATCCCAGAGCCCCCAGAGG - Intronic
903438470 1:23369630-23369652 GCAGATCCCTGAGACCACAGAGG + Exonic
904419640 1:30383473-30383495 GACTATCACTGACACATCAGGGG + Intergenic
908747480 1:67390043-67390065 TAGCAGCCCTCAGACCTCAGTGG + Exonic
909942233 1:81624109-81624131 CAGTCTCCCAGAGACCTCAAAGG + Intronic
912541767 1:110421549-110421571 CAGTTTCTCTGAGAACTCAGAGG - Intergenic
912760095 1:112359158-112359180 GACTCTCCCTGATGCCTCAGAGG + Intergenic
913528196 1:119713263-119713285 GAGGACCCCTTAGACCGCAGAGG + Intronic
915240473 1:154517510-154517532 GAGAATCCCTTAAACCCCAGGGG - Intronic
917267662 1:173238897-173238919 GATGAGCCCTAAGACCTCAGGGG + Intergenic
917723040 1:177804082-177804104 TAGTCTCCCTAAGAACTCAGAGG - Intergenic
917729259 1:177857976-177857998 GAGTATCCCTGGCACATCACTGG + Intergenic
917804249 1:178599011-178599033 GAGTCTCCCTGAGGCTGCAGTGG + Intergenic
917850772 1:179062094-179062116 GAGGATCGCTGAAACCTGAGAGG - Intronic
918044963 1:180936056-180936078 GGGTGTCCCTGGGACCCCAGTGG + Exonic
918365447 1:183803533-183803555 GAGTAGCTCTGAAACCTGAGTGG + Intronic
921113335 1:212061175-212061197 GAGGATCACTGAGCCCTGAGCGG + Intronic
1063803893 10:9615292-9615314 CAGTATCCCTGAGCCCTAGGGGG + Intergenic
1064436121 10:15312785-15312807 GAGAATCGCTTAGACCTCGGAGG - Intronic
1064648158 10:17481536-17481558 CAGTCTCCCTGAGAACTAAGGGG + Intergenic
1066105056 10:32148981-32149003 GAATATCTCTGAGACCCCAAGGG - Intergenic
1067322955 10:45239702-45239724 GGGCATCCCTGCGACATCAGAGG + Intergenic
1071175701 10:82924237-82924259 GTTTGTCACTGAGACCTCAGAGG + Intronic
1072434908 10:95405998-95406020 GAGTCTCCCCAAGACATCAGAGG + Intronic
1072584859 10:96772549-96772571 CAGTATCCCTGAAGTCTCAGAGG - Intergenic
1072954130 10:99874019-99874041 GAGAATGCCTGAGACCACTGTGG - Intergenic
1075157713 10:119992403-119992425 GAATTTCCCTGGGACCTCAATGG - Intergenic
1077397063 11:2329908-2329930 AAATAACCCCGAGACCTCAGGGG + Intergenic
1077707176 11:4497824-4497846 GAGTATCCCGGGGACACCAGGGG - Intergenic
1079382062 11:19947130-19947152 GAGACTCCCTGGGAGCTCAGTGG - Intronic
1080250384 11:30227140-30227162 CAGTCTCCCTGAAAACTCAGAGG + Intergenic
1080431364 11:32202908-32202930 GAGAATCGCTGGGACCTGAGAGG + Intergenic
1080644612 11:34179351-34179373 AAGAGTCCCTGGGACCTCAGGGG + Intronic
1084261633 11:67982900-67982922 TATTATCCCTAATACCTCAGTGG + Intergenic
1084456050 11:69268845-69268867 CAGCTTCCCTGAGACCGCAGAGG + Intergenic
1084792414 11:71482905-71482927 CAGGATCCCCGAGACCTCTGTGG + Exonic
1084811010 11:71611211-71611233 TATTATCCCTAATACCTCAGTGG - Intergenic
1086020000 11:82216239-82216261 GAGTATCACTGAGAAATCAAGGG - Intergenic
1089212352 11:116814093-116814115 TAGTACACCAGAGACCTCAGGGG + Intergenic
1089410154 11:118234349-118234371 GAGTTTCCCTGAGACCTCAGGGG - Intronic
1090252956 11:125263980-125264002 GGGAATCCCAGTGACCTCAGGGG + Intronic
1090500286 11:127254451-127254473 GAGAATCACTTATACCTCAGGGG + Intergenic
1090830770 11:130419421-130419443 GAGTAACACGGAGACCTCGGGGG - Intronic
1091059866 11:132451416-132451438 GTGAATTCCTGAGACCACAGAGG + Intronic
1091408736 12:225202-225224 GAGCATCACTGTGACCTCGGAGG + Intronic
1098264147 12:68701897-68701919 GAGAATCCCTTGAACCTCAGAGG - Intronic
1100425448 12:94481093-94481115 CAGTAGCTCTGAGACCTTAGCGG + Intergenic
1104675611 12:130710039-130710061 GGGTATCCCTGGGAGCTCACGGG + Intronic
1106540077 13:30682554-30682576 GATTGTCCCTGAGACCTTTGAGG + Intergenic
1108409563 13:50133053-50133075 GAATATTCCTGAGTCCTGAGCGG + Intronic
1113072552 13:106435494-106435516 GAGAATCACTGAAACCCCAGAGG + Intergenic
1113408852 13:110065839-110065861 GAGTATCGCTTGAACCTCAGAGG + Intergenic
1113821992 13:113221265-113221287 GAGTATCCCAGAGTCCTCACAGG + Intronic
1114439994 14:22738472-22738494 CAGCCTCCCTGAGAACTCAGAGG - Intergenic
1114661006 14:24344824-24344846 GAGCATCCCTGAGTCGGCAGGGG - Intergenic
1115332897 14:32216865-32216887 GATTAATCCGGAGACCTCAGTGG + Intergenic
1115769972 14:36658091-36658113 GAGTTTCCCTGAAACTGCAGCGG - Intronic
1116118251 14:40685429-40685451 GTGTATCTCTGGGACCTCTGAGG - Intergenic
1117038261 14:51748209-51748231 TATTATCCCTAATACCTCAGTGG - Intergenic
1117836090 14:59807634-59807656 GAGTAACCCTGAGTCATAAGAGG + Intronic
1120722724 14:87905763-87905785 AAGTATCCCTGAGGTCTCTGGGG - Intronic
1122883394 14:104700014-104700036 GAGTGGGCCTGAGACCTCAAGGG + Intronic
1125077649 15:35638300-35638322 GAGTATCTCTGAGAACTAAGAGG + Intergenic
1125402821 15:39322232-39322254 GTCTATGCCTGAGCCCTCAGTGG - Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1125511613 15:40295180-40295202 GAGTATCCTTGAGGTTTCAGTGG - Exonic
1127587654 15:60394105-60394127 AAGTATCCCTGACAGCACAGAGG - Intronic
1129300734 15:74624079-74624101 CAGCCTCCCTGAGGCCTCAGAGG + Intronic
1131587642 15:93713540-93713562 GACTTTCCCTGAAAACTCAGAGG + Intergenic
1131952092 15:97692231-97692253 GCGCATCCCTGAGAGGTCAGTGG + Intergenic
1132069302 15:98761638-98761660 GAGTCTGCCTCAAACCTCAGTGG - Intronic
1132733962 16:1376406-1376428 GAGCATCCCCAAGCCCTCAGAGG - Intronic
1133861471 16:9599375-9599397 GATCAACCCTGAGATCTCAGTGG + Intergenic
1135989408 16:27208611-27208633 GAGCATCCAAAAGACCTCAGGGG - Intronic
1137952523 16:52797305-52797327 GAGGCTGCCTGAGACCACAGTGG + Intergenic
1138314273 16:56055086-56055108 GAGGTTCCCTCTGACCTCAGCGG - Intergenic
1138813036 16:60172864-60172886 TAGTATCCCTGAGAATTCTGAGG - Intergenic
1140134081 16:72189795-72189817 CAGTCTCCCTGATAACTCAGAGG + Intergenic
1140407986 16:74723673-74723695 GAGAAACCCTGATACCTCTGGGG + Intronic
1142722236 17:1784246-1784268 GAGTATCCCTGAGTCCAAAACGG + Intronic
1143611764 17:8022050-8022072 GAGAACCCCTGTGGCCTCAGCGG - Intergenic
1144256803 17:13476333-13476355 TAGTCTCCCTGAGAACTCAGAGG - Intergenic
1144522810 17:15965466-15965488 GAGCTGCCCTGAGAGCTCAGGGG + Intronic
1147552808 17:41456576-41456598 GAGGATCCCTGATACCTGTGAGG + Intergenic
1148028032 17:44601709-44601731 GAGGATCCCTGACATCGCAGTGG + Intergenic
1148260687 17:46180406-46180428 GAGAATCGCTGAAACCTGAGCGG + Intronic
1149691701 17:58582651-58582673 GAGAATCACTGGGACCCCAGAGG - Intronic
1152382058 17:79947195-79947217 GACTGCCCCAGAGACCTCAGGGG + Intronic
1153493892 18:5677648-5677670 AAGTGACCCTCAGACCTCAGTGG - Intergenic
1153959662 18:10130266-10130288 GAATATCCCAGAGACCACCGAGG + Intergenic
1154000474 18:10478271-10478293 GAGTACCCCTGGCACCACAGAGG + Intronic
1157582037 18:48779278-48779300 AAGTATCCCTTAGACCTTTGTGG + Intronic
1157959227 18:52133958-52133980 TAGCCTCCCTGAGAACTCAGAGG + Intergenic
1159956795 18:74524288-74524310 GAGAAATGCTGAGACCTCAGTGG - Intergenic
1160429450 18:78801398-78801420 TAGCATCTGTGAGACCTCAGTGG - Intergenic
1160543406 18:79637920-79637942 GAGTCCCCCTGAGACCTGGGCGG - Intergenic
1163333081 19:16653803-16653825 GAGAATCGCTTAGACCTAAGAGG + Intronic
1164508398 19:28877968-28877990 CAGTATCTGTGAGATCTCAGGGG + Intergenic
1168319414 19:55500303-55500325 GAGTATCCCTCAGGCCTCCCTGG + Exonic
926617363 2:15010462-15010484 GGATATCCCTGACACCTAAGGGG - Intergenic
926982559 2:18586800-18586822 GAGTCCCCCTGCAACCTCAGTGG - Intronic
927025742 2:19067394-19067416 GAGTATCTCTTAGATCTCTGTGG - Intergenic
928242714 2:29600667-29600689 GGGTGGCCCTGAGAGCTCAGAGG + Intronic
930506863 2:52293716-52293738 CAGTCTTCCTGAGAACTCAGAGG + Intergenic
930509867 2:52330857-52330879 GAGAATCCCTTGAACCTCAGAGG - Intergenic
930995128 2:57707865-57707887 GAGAATCACTGGAACCTCAGAGG - Intergenic
932078676 2:68691105-68691127 GAGCATCACTGAGAGCTCACAGG - Intronic
932281818 2:70499391-70499413 GAGTATCCCAGGGCCCGCAGTGG + Intronic
932574649 2:72956017-72956039 GAGATTCACTGAGACCACAGGGG + Intronic
934751161 2:96795099-96795121 GAGTATCCCTTATTCCTCACTGG - Intronic
935594775 2:104869920-104869942 GAGGCACCCTGAGAACTCAGAGG - Intergenic
936471775 2:112805296-112805318 GTGTATCTCGGAGTCCTCAGAGG + Intergenic
940367724 2:152867088-152867110 GATTATCCTTGATACCTGAGTGG - Intergenic
940857830 2:158743444-158743466 GAGTATTCTTGGGGCCTCAGAGG + Intergenic
940957043 2:159739135-159739157 GGGTATCCCTGTGCTCTCAGGGG - Intronic
942898125 2:181083006-181083028 GAGTAGCCCTGAGAACCCACAGG + Intergenic
946393075 2:219428334-219428356 GATAATCCCTGAAATCTCAGAGG - Intergenic
946782349 2:223204932-223204954 GAGAGTCCCTTAGACCTCATGGG + Intergenic
947236368 2:227945524-227945546 CAGTCTCCCTGAGAACTCAGAGG + Intergenic
947710944 2:232315332-232315354 GAGTATATCTCAGACCTCTGTGG - Intronic
948404209 2:237705216-237705238 GAGTATCTCTGTGAGCTGAGGGG - Intronic
1168940639 20:1708195-1708217 GGGTATCCTGGAGACATCAGGGG + Intergenic
1169546497 20:6656191-6656213 GAGAATCACTGAAACCCCAGAGG + Intergenic
1170500435 20:16970314-16970336 GAGAATCGCTGGAACCTCAGAGG - Intergenic
1170876567 20:20255227-20255249 GAGTGGCCCTGTGATCTCAGAGG - Intronic
1171398295 20:24854592-24854614 CAGACTCCCTGAGAACTCAGAGG - Intergenic
1172660653 20:36566122-36566144 GAGAATCGCTGAAACCTGAGAGG - Intergenic
1172834520 20:37864411-37864433 GCGTTTTCCTGAGACCTCAAGGG - Intronic
1173521754 20:43705151-43705173 GAGTATCCCTGAGACCTCAGGGG - Intronic
1173982712 20:47237230-47237252 GAGAATCCCTTGAACCTCAGAGG - Intronic
1179084657 21:38206488-38206510 GAGGATCCCTGGGACCTTGGTGG - Intronic
1180168383 21:46042292-46042314 GAGAATCACTTAAACCTCAGAGG + Intergenic
1180248565 21:46564408-46564430 GGGTCTCCCTGAGAACACAGAGG + Intronic
1181344532 22:22208942-22208964 AAGCAGCCCTGAGAACTCAGAGG - Intergenic
1183186570 22:36294904-36294926 GAGCCTCCCTGAGACCGCAGGGG - Intronic
1183428349 22:37751413-37751435 GAGACCCCCTGAGAGCTCAGAGG - Intronic
1183512482 22:38244177-38244199 GTGTATCCCTGAGAACTCATAGG - Intronic
949355095 3:3171931-3171953 GTGTATCTGTGAGACCTCACGGG + Intronic
952693885 3:36243013-36243035 GAGAATCCCTGTGCCCACAGGGG + Intergenic
953209054 3:40858250-40858272 GTGCATCCCTGTGTCCTCAGGGG - Intergenic
953256559 3:41296575-41296597 AATTATTCCTGAGACATCAGAGG + Intronic
954379115 3:50210297-50210319 GATTATCCCTGGGGGCTCAGGGG - Intronic
954612621 3:51954099-51954121 CAGGATTCCAGAGACCTCAGCGG + Intergenic
954823724 3:53353029-53353051 TAGTCTTCCTGAGAACTCAGAGG + Intergenic
955061754 3:55498621-55498643 GAGTATAGGTGAGTCCTCAGAGG - Intergenic
956011163 3:64833136-64833158 GAATGTGCCTGAGATCTCAGTGG - Intergenic
959350831 3:105260698-105260720 TAGCCTCCCTGAGAACTCAGAGG - Intergenic
961751612 3:129098981-129099003 GAGAATCCCTTGAACCTCAGAGG + Intronic
964626969 3:158768871-158768893 GAGTATCCCTGGCACATCAGTGG + Intronic
964640531 3:158905628-158905650 GAGAATCTCTGTGACCTCACTGG - Intergenic
965470233 3:169081251-169081273 GAGAATCCCTTATACCTGAGAGG + Intergenic
967846514 3:194047365-194047387 GGGTGTCCCTGTGAGCTCAGTGG - Intergenic
968236281 3:197031698-197031720 TAGAATCCCTGAGAACCCAGAGG - Intergenic
968600291 4:1505458-1505480 GAGTATCCTTGTGACCACTGTGG + Intergenic
969733698 4:8972638-8972660 TATTATCCCTAATACCTCAGTGG - Intergenic
969793289 4:9506697-9506719 TATTATCCCTAATACCTCAGTGG - Intergenic
973073983 4:45900046-45900068 TAGTCTCCCTAAGAACTCAGAGG + Intergenic
975919378 4:79366115-79366137 CAATATCCATGAAACCTCAGTGG + Intergenic
988680203 5:33477319-33477341 CAGTCTCCTTGAGAACTCAGAGG - Intergenic
988961712 5:36377695-36377717 GGGTAACCCTGAGACCACACTGG - Intergenic
991247210 5:64520847-64520869 GAGTGTCCCTGTCACCCCAGGGG - Intronic
992017896 5:72594485-72594507 GAGTGTCCCTCAGCCCACAGGGG + Intergenic
992342880 5:75844263-75844285 GAGAACCCTTGAAACCTCAGAGG + Intergenic
992519893 5:77539851-77539873 GAATATTCCTGACAGCTCAGTGG + Intronic
993569170 5:89514784-89514806 AAAAATCCCTGTGACCTCAGTGG - Intergenic
997510065 5:134447967-134447989 GAGAAGCTCTGAGACCTCAGGGG - Intergenic
997827711 5:137122561-137122583 CTCTATCCCTGAGACCTTAGAGG + Intronic
999456131 5:151717697-151717719 GAGCCTCCCTGAGACCACAGGGG + Intergenic
1001975753 5:175997058-175997080 CACTATCCCTGAGATTTCAGGGG + Intronic
1002241673 5:177846714-177846736 CACTATCCCTGAGATTTCAGGGG - Intergenic
1002997126 6:2297383-2297405 GAGTTTTCCTGAGACTTCACTGG + Intergenic
1004855616 6:19746613-19746635 GAGAATCCCTCAAACCTGAGAGG - Intergenic
1005133557 6:22540132-22540154 CATTTTCCCTGAGTCCTCAGAGG + Intergenic
1005802964 6:29445640-29445662 GTGAATCCCAGAGAGCTCAGTGG - Intronic
1006518200 6:34556128-34556150 ACGCAGCCCTGAGACCTCAGAGG - Exonic
1007336959 6:41161163-41161185 CAGGATCCCTGAGAGCCCAGTGG + Intronic
1007708646 6:43806922-43806944 GGGTATGTCTTAGACCTCAGAGG + Intergenic
1010397630 6:75409968-75409990 CAGTCTCCCTGAGAATTCAGGGG - Intronic
1012542394 6:100376428-100376450 GACTATTTCTGAGACCTGAGAGG - Intergenic
1013085381 6:106852412-106852434 CAGTCTCTCTGAGAACTCAGAGG - Intergenic
1014451321 6:121585293-121585315 AAGCTTCCCTGAGACCACAGTGG + Intergenic
1015268078 6:131308828-131308850 GGGGATTCCTGAGACCTCTGAGG + Intergenic
1016575887 6:145569432-145569454 GAAAATTCATGAGACCTCAGTGG + Intronic
1016729843 6:147417528-147417550 CAGCTTCCCGGAGACCTCAGAGG - Intergenic
1017450636 6:154551703-154551725 GTGTCTCCCTGAAACCTCACAGG - Intergenic
1017817662 6:158027302-158027324 GCGGATCCTTCAGACCTCAGCGG + Intronic
1017984702 6:159433806-159433828 CAGTCTCCCTGAGAATTCAGAGG + Intergenic
1019924471 7:4182993-4183015 CAGTCTCCCTGAGGGCTCAGAGG + Intronic
1020307571 7:6846804-6846826 TATTATCCCTAATACCTCAGTGG + Intergenic
1022033386 7:26512706-26512728 AAGTATCCCTGTGACAACAGAGG + Intergenic
1023096846 7:36670038-36670060 AAGGATACCTGAGAACTCAGGGG - Intronic
1024009180 7:45253171-45253193 CAGTGTCCCTCAGACCTCAAGGG - Intergenic
1024535125 7:50424062-50424084 GAGTCTCCCAGAGGCCTCTGGGG - Intergenic
1024647516 7:51382649-51382671 GAGGAGCCCTGGGCCCTCAGGGG + Intergenic
1027682966 7:81243147-81243169 GTGTACCCATGAAACCTCAGGGG - Intergenic
1028653052 7:93171896-93171918 AAGCCTCCCTGAGAACTCAGAGG + Intergenic
1028687821 7:93612204-93612226 GATTATCTCTGACACATCAGTGG + Intronic
1029078689 7:97955748-97955770 TATTATCCCTAATACCTCAGTGG + Intergenic
1032357695 7:131225695-131225717 GAGTAGCCCAGTGACGTCAGAGG - Intronic
1033668007 7:143461961-143461983 CAGCCTCCCTGAGAACTCAGAGG + Intergenic
1035181742 7:157094300-157094322 CAGCCTCCCTGAGAACTCAGAGG - Intergenic
1036123515 8:6043243-6043265 GAGTGTCCCAGAGAACCCAGTGG + Intergenic
1036696430 8:10978109-10978131 GAGTGTCACTAGGACCTCAGTGG - Intronic
1037365225 8:18115077-18115099 GAATATGACTGAGACCTCATGGG - Intergenic
1038522341 8:28244164-28244186 TTCTATCCCTGAGACCTCGGTGG + Intergenic
1039322248 8:36445284-36445306 CAGTCTTCCTGAGAACTCAGAGG + Intergenic
1040318290 8:46276391-46276413 GAGAAGACCTGAGACCTTAGTGG - Intergenic
1040432910 8:47361690-47361712 GAGAGTCACTGAGATCTCAGAGG + Intronic
1042643185 8:70956871-70956893 TAGCATCCCTGAGCTCTCAGGGG - Intergenic
1045242576 8:100415623-100415645 GAGTTTACCAGGGACCTCAGTGG + Intergenic
1046288414 8:112126263-112126285 GAGTATCCCAGTTAACTCAGTGG + Intergenic
1047994567 8:130321538-130321560 AAGTATCCCTTAGAAGTCAGGGG + Intronic
1050983164 9:12046468-12046490 CAGCCTCCCTGAGAACTCAGAGG - Intergenic
1052799664 9:32956016-32956038 AAGGATCCCGGAGACCTCTGGGG + Intergenic
1053361605 9:37491299-37491321 GAATCTGCCTGATACCTCAGAGG + Intronic
1054764227 9:69029810-69029832 CAGTTTCTCTGAGAACTCAGAGG + Intergenic
1057710625 9:97439617-97439639 GTGCACCCCTGAGACTTCAGAGG + Intronic
1059124848 9:111674678-111674700 GAAAAGCCCTGAAACCTCAGTGG - Intergenic
1060011994 9:120051839-120051861 GAGAAGTCCTGAGACCTCAGTGG - Intergenic
1060892609 9:127198341-127198363 GACTGTCTCTCAGACCTCAGAGG - Intronic
1061767779 9:132892824-132892846 AAGGATCTCTGAGACCACAGAGG - Exonic
1062253846 9:135611679-135611701 GGCTCTTCCTGAGACCTCAGTGG - Intergenic
1188039411 X:25354501-25354523 GAGAATCACTCAAACCTCAGAGG + Intergenic
1189196547 X:39158410-39158432 CAGCATCCCTGACACTTCAGAGG - Intergenic
1190445469 X:50519684-50519706 GAGTATCCTAGCCACCTCAGTGG + Intergenic
1191245787 X:58227215-58227237 TAGAATGCCTGAGATCTCAGAGG - Intergenic
1196934929 X:120720060-120720082 GAGTATCCCTGACACCTTGGTGG + Intergenic
1197774899 X:130112184-130112206 GAGTATCCAGGAGGTCTCAGGGG - Intergenic
1200696597 Y:6366502-6366524 GATCATACCTGAGACCCCAGAGG + Intergenic
1200916808 Y:8578467-8578489 AATTATACCTGAGACCTCAGAGG - Intergenic
1200922946 Y:8629236-8629258 AATTATACCTGAGACCCCAGAGG - Intergenic
1200935289 Y:8733060-8733082 AATTATACCTGAGACCCCAGAGG + Intergenic
1201037516 Y:9798197-9798219 GATCATACCTGAGACCCCAGAGG - Intergenic
1201038286 Y:9804677-9804699 AATTATACCTGAGACCCCAGAGG - Intergenic