ID: 1173522404

View in Genome Browser
Species Human (GRCh38)
Location 20:43709784-43709806
Sequence CGGGGGAAACAGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 902
Summary {0: 1, 1: 2, 2: 13, 3: 181, 4: 705}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173522404_1173522420 6 Left 1173522404 20:43709784-43709806 CCCTCTCCCTTCTGTTTCCCCCG 0: 1
1: 2
2: 13
3: 181
4: 705
Right 1173522420 20:43709813-43709835 TGACTTGGACCTGCAGGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 251
1173522404_1173522421 11 Left 1173522404 20:43709784-43709806 CCCTCTCCCTTCTGTTTCCCCCG 0: 1
1: 2
2: 13
3: 181
4: 705
Right 1173522421 20:43709818-43709840 TGGACCTGCAGGGTGGGGAGAGG 0: 1
1: 1
2: 6
3: 86
4: 663
1173522404_1173522424 16 Left 1173522404 20:43709784-43709806 CCCTCTCCCTTCTGTTTCCCCCG 0: 1
1: 2
2: 13
3: 181
4: 705
Right 1173522424 20:43709823-43709845 CTGCAGGGTGGGGAGAGGGATGG 0: 1
1: 2
2: 20
3: 199
4: 1580
1173522404_1173522408 -9 Left 1173522404 20:43709784-43709806 CCCTCTCCCTTCTGTTTCCCCCG 0: 1
1: 2
2: 13
3: 181
4: 705
Right 1173522408 20:43709798-43709820 TTTCCCCCGAGCCCCTGACTTGG 0: 1
1: 0
2: 0
3: 8
4: 152
1173522404_1173522419 5 Left 1173522404 20:43709784-43709806 CCCTCTCCCTTCTGTTTCCCCCG 0: 1
1: 2
2: 13
3: 181
4: 705
Right 1173522419 20:43709812-43709834 CTGACTTGGACCTGCAGGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 148
1173522404_1173522425 17 Left 1173522404 20:43709784-43709806 CCCTCTCCCTTCTGTTTCCCCCG 0: 1
1: 2
2: 13
3: 181
4: 705
Right 1173522425 20:43709824-43709846 TGCAGGGTGGGGAGAGGGATGGG 0: 1
1: 0
2: 9
3: 250
4: 2189
1173522404_1173522418 4 Left 1173522404 20:43709784-43709806 CCCTCTCCCTTCTGTTTCCCCCG 0: 1
1: 2
2: 13
3: 181
4: 705
Right 1173522418 20:43709811-43709833 CCTGACTTGGACCTGCAGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 205
1173522404_1173522413 0 Left 1173522404 20:43709784-43709806 CCCTCTCCCTTCTGTTTCCCCCG 0: 1
1: 2
2: 13
3: 181
4: 705
Right 1173522413 20:43709807-43709829 AGCCCCTGACTTGGACCTGCAGG 0: 1
1: 0
2: 1
3: 17
4: 174
1173522404_1173522422 12 Left 1173522404 20:43709784-43709806 CCCTCTCCCTTCTGTTTCCCCCG 0: 1
1: 2
2: 13
3: 181
4: 705
Right 1173522422 20:43709819-43709841 GGACCTGCAGGGTGGGGAGAGGG 0: 1
1: 0
2: 8
3: 89
4: 809
1173522404_1173522414 1 Left 1173522404 20:43709784-43709806 CCCTCTCCCTTCTGTTTCCCCCG 0: 1
1: 2
2: 13
3: 181
4: 705
Right 1173522414 20:43709808-43709830 GCCCCTGACTTGGACCTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173522404 Original CRISPR CGGGGGAAACAGAAGGGAGA GGG (reversed) Intronic
900298677 1:1965697-1965719 CTGGGGACACCCAAGGGAGAAGG - Intronic
900745400 1:4357266-4357288 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
902782844 1:18715963-18715985 CGGGGGGAACAGGATGGAAAAGG - Intronic
902968414 1:20029169-20029191 TGTGGAAACCAGAAGGGAGATGG + Intronic
902980251 1:20117615-20117637 TGGGAGAAACAGATGGCAGAAGG + Intronic
904464678 1:30700812-30700834 CAGGGGAAACAGGAGCGAGGGGG + Intergenic
904577993 1:31517809-31517831 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904680226 1:32223893-32223915 CTTGGGAAACAGCAGGGAGCTGG - Intronic
905010229 1:34742198-34742220 CGGGGGTGACAGCAGGTAGAAGG - Intronic
905340674 1:37275220-37275242 CGGGAGGCACTGAAGGGAGAAGG + Intergenic
905412396 1:37779579-37779601 TGGAGGACACAGAAGGGACAGGG + Intergenic
905781035 1:40709506-40709528 CGGAGGAAACAAAAGGCAGCAGG - Intronic
905940888 1:41862482-41862504 GGAGGGAAAGAGAGGGGAGAGGG - Intronic
906295712 1:44647839-44647861 CGGGGGAATCATAAGGGACGTGG - Intronic
906701150 1:47859189-47859211 TGGGGGAAACAAAAGGGTCAGGG - Intronic
907158139 1:52352990-52353012 AGGGGGAGACAGCGGGGAGATGG + Exonic
907901516 1:58745913-58745935 CCAGGGAGAGAGAAGGGAGAGGG - Intergenic
908426876 1:64016021-64016043 CTTGGGAAACAGAAGGGAGTTGG - Intronic
909026954 1:70493354-70493376 GGGAGGAAAAAGAAAGGAGAAGG - Intergenic
909742288 1:79045379-79045401 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
910050945 1:82973446-82973468 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
910477201 1:87620062-87620084 TGGGGGAGACAGAAGGGAGATGG - Intergenic
910480124 1:87649608-87649630 AGAGAGAAAAAGAAGGGAGAAGG - Intergenic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911587220 1:99704878-99704900 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
913457604 1:119049290-119049312 TGGGGGAGCCAGAAGGGAGATGG - Intronic
914320874 1:146558412-146558434 TGGGTGAAGCAGAAGTGAGAAGG - Intergenic
915602906 1:156933447-156933469 ACGGGGAAGCAGAAGGGAGCGGG - Intergenic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916284718 1:163093733-163093755 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916506076 1:165429142-165429164 CGAGGGACACAGAGGGGAGAGGG + Intronic
916999494 1:170340824-170340846 AGTGGGAAACTGAAAGGAGATGG + Intergenic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918362363 1:183772072-183772094 TGGGGGAGCCAGAAGGGAGATGG - Intronic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
918813359 1:189149952-189149974 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
919915040 1:202133883-202133905 CGGTGGAAACACACGGGACAGGG + Exonic
920035170 1:203060726-203060748 TGGGGGAAACAAAGGGAAGAGGG + Intronic
920314811 1:205069836-205069858 CGGGAGTACCAGAACGGAGACGG + Exonic
920435768 1:205946062-205946084 CTAGGGAAACAGAAGACAGAAGG + Intergenic
920739813 1:208569867-208569889 CGGGGGAAAAGGTAGGAAGAGGG - Intergenic
920748006 1:208647195-208647217 AGGGGGAAGGGGAAGGGAGAGGG - Intergenic
921092199 1:211854982-211855004 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
921116158 1:212093500-212093522 TGGGGGAGCCAGAAGGGAAATGG + Intronic
921382484 1:214538745-214538767 TGGGGGAGACAGAGGGCAGAAGG + Intronic
921415128 1:214877214-214877236 CAGGGGAGAAAGATGGGAGAAGG + Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922722751 1:227906882-227906904 AGGGAGAAGCAGAAGGGAAAGGG - Intergenic
923383787 1:233447029-233447051 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
923591375 1:235322788-235322810 GGGGTGAGACAGAAGGAAGAGGG + Intronic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924309370 1:242724188-242724210 TGGGGGACAGAGAAGGAAGAAGG - Intergenic
924501506 1:244642824-244642846 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
924697796 1:246418664-246418686 TGGGGGAGCCAGAAGGGAAATGG + Intronic
1063102449 10:2962548-2962570 AGAGAGAAACAGAGGGGAGAAGG - Intergenic
1063233245 10:4086728-4086750 CGGGGGAGGCAGAAGAGGGACGG - Intergenic
1063357747 10:5417052-5417074 TGGGGGAGCCAGAAGGGAAATGG + Intronic
1063878890 10:10510421-10510443 CGGGGGAATGAGAGGAGAGATGG + Intergenic
1064122284 10:12630262-12630284 AAGGGGAAACAAAAGAGAGAAGG - Intronic
1064873548 10:19966866-19966888 AGGGGGAAACACTGGGGAGAGGG + Intronic
1065371515 10:24991631-24991653 TGGGAGAGCCAGAAGGGAGATGG - Intronic
1065778297 10:29142975-29142997 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1066212336 10:33252229-33252251 TGGGGGAGCCGGAAGGGAGATGG - Intronic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067766792 10:49092988-49093010 TGGGGGAGGTAGAAGGGAGACGG - Intronic
1068134677 10:52940128-52940150 TGGGGGAGCCGGAAGGGAGATGG - Intergenic
1068258330 10:54543143-54543165 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1068607924 10:59026274-59026296 TGGGGGAGCCAGAAGGTAGATGG - Intergenic
1069209080 10:65733605-65733627 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1069352923 10:67551378-67551400 TGGGGGAGACAGAAAGGAGATGG - Intronic
1069557308 10:69406778-69406800 CTGGGGCAAGAGAAGAGAGAAGG - Intronic
1070068374 10:73060588-73060610 GGGGGGAAAAAGAAGGGCCAAGG + Intronic
1070161381 10:73868686-73868708 TGAGGGAAAGAGAAGGGAGGGGG - Intronic
1070319343 10:75343140-75343162 GGGAGGAAACAGAACTGAGAAGG + Intergenic
1070365629 10:75734030-75734052 CGTGGGAGACACAAGGGAGATGG + Intronic
1071028133 10:81139979-81140001 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071220421 10:83459018-83459040 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1071486850 10:86107872-86107894 TGGGGGAGCAAGAAGGGAGATGG - Intronic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1071948552 10:90676498-90676520 TAATGGAAACAGAAGGGAGAAGG - Intergenic
1072224534 10:93356191-93356213 CGGGGGAAAAAGCAGGCAGGTGG - Intronic
1072536407 10:96367426-96367448 GGGGGGAAACCAAAGGGACAAGG + Exonic
1072673026 10:97445692-97445714 AGGGAAAAACAGAGGGGAGATGG + Intronic
1074073625 10:110099396-110099418 GGAAGGAAACGGAAGGGAGAAGG - Intronic
1074092237 10:110271977-110271999 AGAGGGAAAAAGAAGGGACAGGG - Intronic
1075011464 10:118873973-118873995 TGAGGCAGACAGAAGGGAGAGGG + Intergenic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075173615 10:120139104-120139126 GAGTAGAAACAGAAGGGAGAGGG - Intergenic
1075658617 10:124177789-124177811 AGGGGAAAGCAGAATGGAGAGGG - Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1075911213 10:126127175-126127197 GGGAGGAAGCAGAAGGGAGAAGG + Intronic
1077017459 11:403316-403338 GGGGGGACAGAGGAGGGAGAGGG + Intronic
1077040039 11:516863-516885 AGAGGGAGACCGAAGGGAGAGGG - Intergenic
1077147567 11:1052860-1052882 CCGGGGAAGCAGAAGGGAAAGGG - Intergenic
1077338626 11:2016390-2016412 CGGGGAGAACAGAAGAGAAAAGG - Intergenic
1077471132 11:2761134-2761156 TGGGGGAGCAAGAAGGGAGATGG + Intronic
1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG + Intergenic
1077586705 11:3459388-3459410 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1078113927 11:8426178-8426200 ATGGGGAGCCAGAAGGGAGATGG + Intronic
1078646012 11:13141951-13141973 CGGGGGAAATGGAAGGAAGCCGG + Intergenic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1081061354 11:38481701-38481723 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1081329993 11:41790749-41790771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1081352092 11:42066401-42066423 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1082244444 11:49905219-49905241 GGGGGGAAATAGAAGGGGGAAGG + Intergenic
1082850707 11:57761874-57761896 AGGGGGAAAAAAAAGAGAGAGGG + Exonic
1082874544 11:57974784-57974806 AGGGGAGAAAAGAAGGGAGAGGG - Intergenic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084242702 11:67833420-67833442 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1084830299 11:71763584-71763606 TGGGGGAGTCAGAAGGGAGATGG - Intergenic
1085684076 11:78605830-78605852 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1086263379 11:84968741-84968763 CGTGGGAAAATTAAGGGAGAGGG + Intronic
1086518765 11:87646102-87646124 AGGGGGAAAGGGAAGGGGGAAGG - Intergenic
1086802233 11:91191444-91191466 CGGAGGAATCAGTAGGGAAAAGG - Intergenic
1087328006 11:96746849-96746871 TGGGGGAGCCAGAAGGCAGATGG - Intergenic
1087335526 11:96839605-96839627 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1087461410 11:98453417-98453439 CGGGGGAGCAAGAAGGAAGATGG + Intergenic
1087461946 11:98456760-98456782 TGGCGGAGCCAGAAGGGAGATGG + Intergenic
1087788722 11:102384736-102384758 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1088103234 11:106177224-106177246 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1088238530 11:107750409-107750431 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1088507306 11:110539294-110539316 TGGGGGGGCCAGAAGGGAGATGG + Intergenic
1089165670 11:116474281-116474303 AGGGGGGATCAGGAGGGAGAAGG - Intergenic
1089292157 11:117443910-117443932 CCGGGGCAACAGCAGCGAGAAGG - Exonic
1089935798 11:122362847-122362869 CTGGGGATACAGCAGCGAGATGG - Intergenic
1090910515 11:131114696-131114718 CAAGGGAGACCGAAGGGAGAAGG - Intergenic
1202821610 11_KI270721v1_random:71572-71594 CGGGGAGAACAGAAGAGAAAAGG - Intergenic
1091535383 12:1403200-1403222 AGGGGGAAAAAAAAGGAAGAAGG - Intronic
1091916414 12:4274003-4274025 CGGGGAAAGCAGGAGGGAGAGGG + Exonic
1092412936 12:8268121-8268143 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1092864338 12:12746778-12746800 AGGGGGAAGAAGAAGAGAGAAGG - Intronic
1092950386 12:13498256-13498278 GGGGGGAAGCAGAACTGAGAGGG + Intergenic
1093089390 12:14904508-14904530 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1093509035 12:19904135-19904157 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1094227099 12:28057864-28057886 CCTGGGAAACACAATGGAGAGGG + Intergenic
1094249288 12:28340964-28340986 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095898620 12:47305496-47305518 TGGGGGATCCAGAAGGGAGACGG + Intergenic
1096073925 12:48790073-48790095 TGGTGGAAGCAGAAAGGAGAAGG + Intergenic
1096171667 12:49476346-49476368 TGGGGGAGCCAGAAGGGAGACGG - Intronic
1096182537 12:49558597-49558619 CAGGGGAAACAGGCCGGAGAGGG + Intronic
1096414430 12:51401379-51401401 TAGGGGAGCCAGAAGGGAGATGG + Intronic
1096622326 12:52872553-52872575 CGGGGGAAACACCAGGGCAATGG + Intergenic
1096849449 12:54426398-54426420 GGGGAGAAAAAGGAGGGAGAAGG + Intergenic
1096870813 12:54590933-54590955 CGGAGGAGAGAGGAGGGAGAGGG + Intergenic
1097009336 12:55941124-55941146 GGAGGGAAACAGGAGGGAGGGGG + Intronic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1098377776 12:69836095-69836117 TGGGGGAACCAGAAGGGAGTTGG + Intronic
1098462064 12:70742779-70742801 CGGGGGAAACAGTTGGGAGAAGG + Intronic
1098462523 12:70748001-70748023 TGGGGGAAGGAGAAGGGAAAGGG + Intronic
1099499135 12:83389514-83389536 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100641291 12:96484416-96484438 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1100665723 12:96750395-96750417 AGGGAGGAACAGAAGGGAGATGG - Intronic
1100718573 12:97330949-97330971 CGGGGATAACAGAGAGGAGAGGG + Intergenic
1100995448 12:100295750-100295772 CGGGGGAGACCGTGGGGAGACGG + Intronic
1101320284 12:103667526-103667548 CCAGGGAAAGAGAAGGAAGAGGG + Intronic
1101425751 12:104586711-104586733 CCAGGGAAACTGCAGGGAGAGGG + Intronic
1101455187 12:104824461-104824483 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101455761 12:104828288-104828310 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1101580490 12:106037714-106037736 CGAGGGAAAGAGAAGGGAAGGGG - Intergenic
1101640561 12:106583399-106583421 GGAGGGAAGGAGAAGGGAGAGGG + Intronic
1101677978 12:106937084-106937106 AAGGGGAAACAGTAGAGAGAAGG - Intergenic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102507684 12:113394051-113394073 TGGGGGAAACAGGAGAGAGATGG + Intronic
1103395336 12:120602666-120602688 GGGAGGAGACTGAAGGGAGAAGG - Intergenic
1103624010 12:122205100-122205122 GAGGGGAGAAAGAAGGGAGACGG - Intronic
1104238305 12:126961237-126961259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1104842604 12:131832053-131832075 CGGGGGGAAGGGAAGGGGGAAGG + Intronic
1104947978 12:132425524-132425546 AGGGAGAGAGAGAAGGGAGATGG + Intergenic
1105387384 13:19943955-19943977 GAGGGGAATGAGAAGGGAGATGG + Intergenic
1105429768 13:20326153-20326175 CGGGGGAGCCAAAAGAGAGATGG - Intergenic
1106169854 13:27279754-27279776 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106182961 13:27383879-27383901 CGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106319457 13:28624353-28624375 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1106540988 13:30690092-30690114 GGGGGGAGCCAGAAAGGAGATGG - Intergenic
1106743957 13:32679844-32679866 GGAGGGAAAAAGAAGGGAGGAGG - Intronic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107410112 13:40150672-40150694 TGGGGGAAACAGAGGAGGGAGGG - Intergenic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1108715402 13:53073363-53073385 CTGGGGAAACAGAAGAGGGCTGG + Intergenic
1108716435 13:53083456-53083478 CGAGGAAAACAGTTGGGAGATGG + Intergenic
1109030820 13:57184992-57185014 CGGGGGAAACTGAGGGTAGCTGG - Intergenic
1109038966 13:57306038-57306060 AAGGGGAAACAGAGGGGAGTAGG - Intergenic
1109075745 13:57832471-57832493 ATGAGGAGACAGAAGGGAGATGG - Intergenic
1109151702 13:58856592-58856614 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1109172876 13:59117960-59117982 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1109735929 13:66484057-66484079 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1109784546 13:67156553-67156575 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1110835176 13:80074674-80074696 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
1110860695 13:80341810-80341832 CGGGGGGAGAAGAAGGGGGAGGG + Intergenic
1111097640 13:83535587-83535609 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
1111217225 13:85159776-85159798 TGGGGGAGCCAGAACGGAGATGG - Intergenic
1111292180 13:86185013-86185035 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111292755 13:86188800-86188822 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1111343934 13:86924524-86924546 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1111406239 13:87810890-87810912 TGGGGCAGCCAGAAGGGAGATGG + Intergenic
1111675249 13:91378896-91378918 AGGGGGAAAGATAAGAGAGAGGG + Intergenic
1111979852 13:95004095-95004117 CGGGGGAAGGAGGGGGGAGAAGG + Intergenic
1112290341 13:98140584-98140606 GGGGGAAAAGAGAGGGGAGAAGG - Intergenic
1112339281 13:98538986-98539008 AGGGGGACACAGAAAGGAAAGGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113257664 13:108524371-108524393 TGGCGAAAACAGAAGAGAGAGGG - Intergenic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114295838 14:21328492-21328514 TGGGGGAGAAAGAAAGGAGAAGG + Exonic
1114464359 14:22910497-22910519 GGGGGGGAAAGGAAGGGAGAAGG + Intronic
1114850958 14:26382056-26382078 TGGGAGGAACAGAGGGGAGAGGG - Intergenic
1115302447 14:31899681-31899703 GGTGGGATATAGAAGGGAGAAGG + Intergenic
1115754687 14:36519388-36519410 AGGAGGAAAAAAAAGGGAGAGGG + Intronic
1115979138 14:39030262-39030284 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1116345374 14:43786453-43786475 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1116682513 14:47991564-47991586 GGGGGGAAATAGAAGGAAAAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117617281 14:57546431-57546453 AGGGGGGACCAGAAGGGAGGAGG + Intergenic
1118019304 14:61695203-61695225 CGGAGGAAAGAGAAAGGAGATGG - Intergenic
1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG + Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118929344 14:70225642-70225664 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1119640003 14:76307841-76307863 CTGGGGAAAAAGAATGGAGCAGG + Intergenic
1119697666 14:76726530-76726552 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1121208399 14:92188158-92188180 GGGAGGAAAGAGAAGAGAGATGG - Intergenic
1121263080 14:92580742-92580764 AGGGGGAAAGAGCATGGAGAAGG + Intronic
1121333541 14:93063067-93063089 CGTGGGAGAGAGATGGGAGATGG - Intronic
1121447450 14:93987972-93987994 AGGGAGAAACAGTAGGGAGGTGG + Intergenic
1121604787 14:95232638-95232660 CGGGTGAGAGGGAAGGGAGAAGG + Intronic
1121703048 14:95970642-95970664 CAAGGCAAACAGAATGGAGAAGG + Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1122017106 14:98805608-98805630 AGGGGCCAACAGAAGAGAGAGGG + Intergenic
1122296040 14:100706227-100706249 CGGGGGCAAGATAAGGAAGAGGG + Intergenic
1122371153 14:101229776-101229798 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1122416811 14:101553892-101553914 TGGTGGAAACAGGAGGGAGGGGG - Intergenic
1122533461 14:102445375-102445397 CGGGGGAAGGAGTAGAGAGATGG + Intronic
1122533474 14:102445422-102445444 CGGGGGAAGGAGTAGAGAGATGG + Intronic
1122764921 14:104061870-104061892 TGGGGGAAAGGGAAGGGAAAAGG - Intergenic
1123164773 14:106315675-106315697 CCTGGGAAGCAGCAGGGAGAGGG - Intergenic
1123809072 15:23905248-23905270 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
1124589430 15:31040349-31040371 GGGGGGAAAGAGAAGGGACCAGG + Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125697676 15:41652368-41652390 CGGGGAAAGGAGAGGGGAGAGGG - Intronic
1125747747 15:42008644-42008666 CTGGAGCAACAGAAGGGATAGGG + Intronic
1125898712 15:43325697-43325719 TGGGGGGAAAAGAAGGGAGGAGG - Exonic
1126097441 15:45099588-45099610 TGGGGGAAACAGTGGGGAGATGG - Intronic
1126228298 15:46296475-46296497 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1127737476 15:61857656-61857678 GGTGGTAAACAGAAGGGAGGTGG + Intronic
1127784392 15:62343117-62343139 CTGGGGGAGCACAAGGGAGAAGG + Intergenic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1128046062 15:64618608-64618630 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1128668531 15:69556859-69556881 CGGGGGCAGCGGAAGGCAGAAGG - Intergenic
1128690474 15:69720979-69721001 GGTGGGAAAAAGAAGGGAGAAGG + Intergenic
1128698172 15:69784450-69784472 AGGGGGAAAGAGTAGGAAGAGGG - Intergenic
1129156314 15:73720423-73720445 AGGGGGAAGTATAAGGGAGAAGG + Intergenic
1129194256 15:73954780-73954802 AGGGGCAAACGGAAGGGTGAAGG - Intergenic
1129277856 15:74459165-74459187 AGGGGCATACAGAAGGGAGAGGG - Intronic
1129303528 15:74641153-74641175 AGGGGTAAATAGAAGAGAGAAGG - Intronic
1129539925 15:76341108-76341130 CGGGGCAAGCAGAAGGCAGTAGG - Intronic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130682706 15:86010491-86010513 TGGGGGAGCCAGAAGAGAGATGG + Intergenic
1130785984 15:87097263-87097285 GGAGGGAAAAAGAAGGGAAAGGG - Intergenic
1131008284 15:88996390-88996412 CGGGGGCAAGGGAAGGGAGAGGG - Intergenic
1131139838 15:89968142-89968164 GGGGGGAAGGAGAAGGGAAAGGG + Intergenic
1131610204 15:93952846-93952868 AGTAGGAAACAAAAGGGAGAGGG + Intergenic
1132037571 15:98499502-98499524 CTGGGAAAAGAGAAGGGAAAAGG - Intronic
1133153781 16:3857415-3857437 AGTGGTAAACAGAAGGGTGATGG - Intronic
1133184892 16:4088975-4088997 CTGGGGAAACTGAAGGGAAATGG - Intronic
1133354139 16:5123625-5123647 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
1133507476 16:6426296-6426318 AGGGAGAGAGAGAAGGGAGAAGG + Intronic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133605579 16:7384580-7384602 ATGGGGAAATAGGAGGGAGAGGG + Intronic
1133879824 16:9770862-9770884 CAGGGAAAACCGAAGGGAGCGGG - Intronic
1134346652 16:13397930-13397952 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1134770600 16:16806037-16806059 AGGGGGAAGGGGAAGGGAGAAGG - Intergenic
1135495022 16:22943821-22943843 AGGGGGATACAGAAGGATGAGGG + Intergenic
1135504137 16:23021670-23021692 AGGGGGAGAGAGGAGGGAGATGG + Intergenic
1136626236 16:31463934-31463956 GGGGAGAAACGGAAGTGAGAGGG - Intronic
1137853828 16:51773402-51773424 CGGGGGAGCAAGAAGGGAGATGG - Intergenic
1138128333 16:54456984-54457006 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
1138527564 16:57617884-57617906 TTGGGGTACCAGAAGGGAGAAGG - Intronic
1138615023 16:58158354-58158376 CTGGGGAAAGAGACGGGAGGAGG + Intronic
1139170879 16:64628016-64628038 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1139592929 16:67943364-67943386 CTGGGGGGACAGCAGGGAGAGGG - Intronic
1140012660 16:71151695-71151717 TGGGTGAAGCAGAAGTGAGAAGG + Intronic
1140128489 16:72137412-72137434 TGGGGGAAACAGAAGAGCGAAGG + Intronic
1141080565 16:81047992-81048014 TGGGGGAAAAGGAAGGCAGAAGG + Intergenic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141193476 16:81842083-81842105 CGGAGGAAACAGCAAAGAGAAGG + Intronic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141674186 16:85509010-85509032 AGGTGGGAACAGCAGGGAGAGGG + Intergenic
1142028097 16:87825066-87825088 GGTGGGAAACAGAAGGAAGGAGG - Intergenic
1142266617 16:89066905-89066927 CGGGGGTACCAGGAGGGACACGG - Intergenic
1142300954 16:89257507-89257529 TGGGGGAGCCGGAAGGGAGACGG + Intergenic
1142480474 17:215613-215635 CGGGGGCAGGAGAGGGGAGAAGG + Intronic
1142958165 17:3535203-3535225 GGCAGGAGACAGAAGGGAGAAGG - Intronic
1143292360 17:5840961-5840983 TGGGGGAGTCAGAAGGCAGATGG + Intronic
1143836499 17:9696879-9696901 CAGGGGAACCAGAGGGGAAAGGG - Intronic
1144390469 17:14788945-14788967 CAGGGGAGACAGAAGTGAGATGG - Intergenic
1144799176 17:17913238-17913260 CGGGGGAGACCGTGGGGAGACGG + Intronic
1145353934 17:22119148-22119170 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1146853420 17:36242999-36243021 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1146869330 17:36366891-36366913 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147072204 17:37967515-37967537 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147083729 17:38047052-38047074 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147099675 17:38171019-38171041 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147184006 17:38704112-38704134 AGGGGCAAACAGAGAGGAGAAGG - Intergenic
1147241959 17:39096329-39096351 TGGGAAAAACAGAAGTGAGAAGG + Intronic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1147595991 17:41717805-41717827 CCGGGGATACAGAAGGGAGGAGG - Intronic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148282641 17:46361155-46361177 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148304859 17:46579080-46579102 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148336687 17:46846796-46846818 AGGGAGGAACAGAAGTGAGAAGG + Intronic
1148438998 17:47702210-47702232 AGGTGGAAACAGAAGAAAGAGGG - Intronic
1148892972 17:50820974-50820996 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1149547469 17:57514693-57514715 GGGGGAAAAAAGAACGGAGAGGG - Intronic
1150619339 17:66797693-66797715 GTGGGGACACAGAGGGGAGAAGG - Intronic
1151145229 17:72034388-72034410 AGGGGGAAGCAGGAGGGACATGG - Intergenic
1151147277 17:72053093-72053115 TGGCTGAAACAGAAGGGTGATGG - Intergenic
1151210994 17:72543593-72543615 CAGGGGACATGGAAGGGAGAGGG - Intergenic
1151941671 17:77296118-77296140 CGGAGGACACAGCAGGGAGGTGG + Intronic
1151990766 17:77572579-77572601 CTGAGGAAACAGCAGGGAGGAGG - Intergenic
1152184564 17:78846336-78846358 GTGGGGAAACTGAAGGGAGCCGG - Intergenic
1152335237 17:79696870-79696892 TGGCGGAGCCAGAAGGGAGATGG - Intergenic
1152840066 17:82561626-82561648 CGGGGAAAGGAGAAGGGCGAGGG + Intronic
1153990481 18:10394731-10394753 TGGGGGAGACAGAAGGGAGATGG + Intergenic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155703495 18:28778985-28779007 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1155778133 18:29794218-29794240 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1156495017 18:37519964-37519986 CTGGGAAAACGGGAGGGAGAAGG + Intronic
1156551915 18:38027422-38027444 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1156691081 18:39707959-39707981 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
1156827631 18:41450955-41450977 AGGAGGAAAAAGAGGGGAGAAGG - Intergenic
1157410400 18:47458440-47458462 AAGGGGAGACAGAAGAGAGAGGG + Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157534976 18:48451469-48451491 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1157543875 18:48534181-48534203 GGGGGGAAAGAGGAGGGAGAGGG - Intergenic
1157622319 18:49023770-49023792 AGGAAGGAACAGAAGGGAGAAGG - Intergenic
1157716846 18:49893864-49893886 AGTGGGAAATAGAAGAGAGAAGG + Intronic
1157735484 18:50044896-50044918 GGGGGGAAAAAGGAGGGAGAGGG + Intronic
1157858914 18:51124003-51124025 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1158015220 18:52775527-52775549 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1158145916 18:54312106-54312128 GGGGGGGAATATAAGGGAGAAGG - Intronic
1158323070 18:56284649-56284671 TGGGGGGATCAGAGGGGAGAAGG - Intergenic
1158744495 18:60183643-60183665 CAGAGGAAACAGCAGGGATAGGG + Intergenic
1159029253 18:63214134-63214156 CGGGAGAAATGGAAGGGAGAGGG + Intronic
1159328050 18:66949495-66949517 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1159345771 18:67201207-67201229 TGGGGGAACCAGAGGGGAGATGG + Intergenic
1159721672 18:71899016-71899038 TGGGGGAACCATAAGGGAGATGG + Intergenic
1160535524 18:79589551-79589573 CGGGGGAGGGAGAAGGGAGATGG + Intergenic
1160743566 19:699292-699314 ATGGGGACACAGTAGGGAGAGGG + Intergenic
1160965277 19:1744634-1744656 GGGAGGAAGCAGAGGGGAGATGG - Intergenic
1160970154 19:1764423-1764445 CGGGGAAAGCTGGAGGGAGAGGG + Intronic
1162532849 19:11245804-11245826 CGGGAGAAAAAGAAGGTAGGAGG - Exonic
1162575253 19:11495428-11495450 GGAGGGAAACAGAATGGAGGGGG + Intronic
1163609331 19:18292868-18292890 CGGGGGAGACGGGAGGGAGAAGG - Intergenic
1163617087 19:18335764-18335786 TGGGGGAGCGAGAAGGGAGATGG - Intergenic
1164587067 19:29482614-29482636 CAGGGGGAAAAGAAGGGAGTTGG - Intergenic
1164674118 19:30090587-30090609 CTGGGGAAACCGGTGGGAGAGGG + Intergenic
1164699698 19:30275963-30275985 AGAGGGAAAGTGAAGGGAGAGGG - Intronic
1164856324 19:31527460-31527482 GAAGGGAAACAGAAGGGTGAGGG + Intergenic
1165100537 19:33436115-33436137 CGGGGAGAAAAGAAGGGAGAAGG + Intronic
1165161496 19:33819594-33819616 CCGGGGACACACAAAGGAGAGGG + Intergenic
1165295830 19:34925372-34925394 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166123971 19:40702762-40702784 CGCGGGAGACAGGAGAGAGAGGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166294505 19:41882560-41882582 AGGAAGAGACAGAAGGGAGAAGG + Intergenic
1166593916 19:44027602-44027624 CAGGGGCATCAGCAGGGAGAAGG - Intronic
1166621610 19:44306272-44306294 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
1166672420 19:44718924-44718946 AGGAGGAAAGAGAAGGGAGTAGG + Intergenic
1166818310 19:45560498-45560520 CAGGAGAGAGAGAAGGGAGATGG - Intronic
1167414583 19:49363351-49363373 CGGGAAAACCAGAAGGGACACGG + Intronic
1167648441 19:50717968-50717990 GGGGGAGAACAGAAGGGAGGCGG - Intronic
1167804551 19:51771688-51771710 TAGGGGAAACAGGAGGGAAAGGG - Intronic
1168025557 19:53641094-53641116 CAGAGGAAACAGGAGGGAAAAGG + Intergenic
1168368187 19:55807607-55807629 AGGAAGCAACAGAAGGGAGAAGG - Intronic
1168695403 19:58401245-58401267 CCGGGGCAAGAGGAGGGAGAAGG - Intergenic
925424759 2:3739637-3739659 TGGCGGAGCCAGAAGGGAGACGG - Intronic
925806759 2:7658566-7658588 TGGCGGAGCCAGAAGGGAGATGG + Intergenic
925839810 2:7980506-7980528 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
926139263 2:10358738-10358760 TGGGGGAGCCAGAAGGGAGATGG - Intronic
926240499 2:11081198-11081220 AGGAGGGGACAGAAGGGAGAAGG - Intergenic
926306575 2:11641393-11641415 AGGTGGGAACAGAAGAGAGAAGG + Exonic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926825503 2:16901800-16901822 TGGGGGAGTCAGAAAGGAGATGG - Intergenic
927144819 2:20156297-20156319 TGGTGGAGACAGAAGGGAGCTGG + Intergenic
927538775 2:23887943-23887965 CGAGGGGAAAAGAAGGGAGATGG - Exonic
927578298 2:24219077-24219099 AGGAGGAAACAGAAGTGGGATGG - Intronic
927584014 2:24282372-24282394 TGGGGGAGCCAGAAGGGAGACGG - Intronic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
928537921 2:32258103-32258125 TGGGGTAGCCAGAAGGGAGATGG + Intronic
928693412 2:33824209-33824231 CGGGGGCCAGAGAAGGGACAGGG + Intergenic
928819341 2:35342186-35342208 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
929561395 2:42958718-42958740 TGGGGGAAAGAGAGAGGAGACGG - Intergenic
929628516 2:43434683-43434705 TGGGGGAACCAGAAGGGAGATGG - Intronic
930297943 2:49578887-49578909 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
930454019 2:51581901-51581923 TGGGCGAATCAGAACGGAGATGG - Intergenic
931034746 2:58227440-58227462 TGTGGGAGACAGAAGGGAGACGG + Intronic
931129259 2:59315180-59315202 CGAGGGAAGCAGTAAGGAGATGG + Intergenic
931470164 2:62531652-62531674 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
931565553 2:63612585-63612607 TGGGGGAAACAAAAGGAATAAGG - Intronic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932050753 2:68395657-68395679 CTGGGGAAAGAGAAGGCAAATGG - Intronic
932102509 2:68913528-68913550 GGTGGGAAACAGAGTGGAGATGG + Intergenic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
932427139 2:71645285-71645307 TTGGGGAGCCAGAAGGGAGATGG + Intronic
932972978 2:76568345-76568367 CTGTGGAAACATAAGGGAAAAGG - Intergenic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933398831 2:81765653-81765675 TGGGGGAGCCAGGAGGGAGATGG - Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
934957063 2:98631674-98631696 TGGGGGAGCCAGAAGGGAGATGG - Intronic
935543659 2:104378278-104378300 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
935663998 2:105494506-105494528 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
935882214 2:107575933-107575955 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
935946851 2:108294394-108294416 AGGGGAAAACAGAAGAGAGAGGG - Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937814065 2:126231673-126231695 AGGAGGAAAGAGAAGGAAGAGGG - Intergenic
937820760 2:126308084-126308106 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
937955096 2:127417670-127417692 CCGGGGTGCCAGAAGGGAGAAGG - Intergenic
938030239 2:127986008-127986030 GGGGGAAGCCAGAAGGGAGATGG - Intronic
938705432 2:133920523-133920545 CTGGGGAAAGAAAAGGGATATGG + Intergenic
939008639 2:136819436-136819458 TGAGGGAAAAAGAAGGGGGAGGG - Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939649722 2:144745727-144745749 TGGGGGAGCCAGAAGTGAGATGG - Intergenic
939732980 2:145808359-145808381 CAGCAGAAACAGCAGGGAGAGGG - Intergenic
940360491 2:152791111-152791133 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
940775015 2:157876091-157876113 CGGGGGAAAGAGCCGGGGGAGGG + Intergenic
940987588 2:160063783-160063805 CGGGGGAAACAGGCTGCAGAGGG + Intergenic
941106840 2:161364080-161364102 TGGGGGAGCCAGAAGGGAGATGG + Intronic
941295666 2:163736205-163736227 CGGGAGGACCAGGAGGGAGAGGG + Intergenic
941325498 2:164109337-164109359 TGGGGGAGACAAAAGGGAAATGG - Intergenic
941591658 2:167427864-167427886 AGAGGGAAAAAGAAGGCAGAAGG - Intergenic
941615885 2:167718809-167718831 CAGGGGAGAAAGGAGGGAGAAGG + Intergenic
941744766 2:169074984-169075006 AGGGGGAAGCAGAATGGACAAGG + Intronic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942243045 2:173981363-173981385 GGGGGGAAAGAGAAGGCACAAGG - Intergenic
942480662 2:176384877-176384899 ATGGGGAAACAGAAGTGATAGGG + Intergenic
942538211 2:176988023-176988045 CAGGGGATGCAGAAGAGAGAAGG - Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
944134730 2:196386274-196386296 TGGGGGAAAGAGAACAGAGAGGG + Intronic
944318979 2:198313594-198313616 AAGGGGAAACAGAGGAGAGAAGG - Intronic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
944728355 2:202495285-202495307 TGGGGGAACCAGAAGGGAGATGG + Intronic
945185760 2:207137843-207137865 CTGGGGAAAGATGAGGGAGAGGG + Intronic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945688791 2:213007160-213007182 AGGAAGAAACAGAAGAGAGAAGG - Exonic
945708595 2:213266943-213266965 TGGGGGGAATAGAAGGGAGTTGG + Intergenic
945986073 2:216354644-216354666 CAGGGGAACCAGAAAGGAAATGG + Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946152421 2:217785504-217785526 CCGGGGACACAGGAGGCAGAGGG - Intergenic
946593977 2:221285521-221285543 CAGGGGAGAGAGAAGGGAGTTGG - Intergenic
947509469 2:230737961-230737983 CGGGTGAAAAAGCAGGCAGAAGG - Intronic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948302665 2:236919758-236919780 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
948430122 2:237913522-237913544 AGGGGGGAACAGAGGAGAGAAGG - Intergenic
948506852 2:238434178-238434200 TGAGGGGAACAGAAAGGAGAAGG - Intronic
948568386 2:238900960-238900982 GGGGGGAAGGAGAAGGGATAGGG - Intronic
948577651 2:238965004-238965026 AGGGGGAAGCAGGAGGGAGGAGG - Intergenic
948815503 2:240508165-240508187 CTGGGCACACAGCAGGGAGAAGG - Intronic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
1169178635 20:3542586-3542608 AGGGGGAAGGGGAAGGGAGAAGG - Intronic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1169801238 20:9514729-9514751 CGGGGGACAGAGAAGGGGGAGGG - Exonic
1169867602 20:10218083-10218105 CGGGGGAAGGAGAAGGGAAGCGG - Intergenic
1170183512 20:13560617-13560639 GGGGGGAAAAAACAGGGAGAAGG + Intronic
1170214975 20:13882243-13882265 GGGGAGATACATAAGGGAGAGGG - Intronic
1170270972 20:14527037-14527059 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1170345961 20:15387489-15387511 GGGGGGAAAAGGAATGGAGAAGG - Intronic
1170821455 20:19758503-19758525 CGTGGGGAACGGAAGGGGGAAGG + Intergenic
1171384211 20:24756762-24756784 TGGGGGAGCCACAAGGGAGACGG + Intergenic
1171517562 20:25750228-25750250 TGGGGGAGGCAGAAAGGAGATGG + Intergenic
1171564190 20:26163273-26163295 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1171801444 20:29623493-29623515 CAGGGCAATCAGAAAGGAGAAGG + Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172873241 20:38148587-38148609 CGGTTGAAACAGAAGAGTGATGG - Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1174741466 20:53018469-53018491 AGGGGCTAACAGAAGGGGGAGGG + Intronic
1174992978 20:55534179-55534201 TGGGGGAAAGAAAAGGAAGAAGG + Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175178443 20:57128014-57128036 CTGGGCAGACAGAAGGGAGCAGG - Intergenic
1175207174 20:57320034-57320056 CGGGGGAGAGAGAAAGGAGAAGG + Intergenic
1175834854 20:61986802-61986824 AGTGGGAAAAATAAGGGAGACGG + Intronic
1175888250 20:62304246-62304268 CGGGGGAGAGAGCAGGGAAAGGG - Intronic
1176071812 20:63230881-63230903 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1177264469 21:18765040-18765062 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1177264483 21:18765115-18765137 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
1177316939 21:19474411-19474433 AGGGGAAAAAAGAATGGAGAGGG - Intergenic
1177339526 21:19782149-19782171 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1177564109 21:22796209-22796231 TGGGGAGACCAGAAGGGAGATGG + Intergenic
1177601295 21:23318254-23318276 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1178195815 21:30344281-30344303 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1178438671 21:32581278-32581300 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1178480670 21:32977144-32977166 AGAGGGAAAAAGAAGGGAGGAGG - Intergenic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1178909657 21:36664308-36664330 GGAGGGGAAGAGAAGGGAGAGGG + Intergenic
1179246558 21:39638491-39638513 TGGGGGAGCCAGGAGGGAGATGG - Intronic
1179342283 21:40523573-40523595 TGGGGGAGCCAGAAGGGAGATGG - Intronic
1179917310 21:44485771-44485793 CGGAGGAGCCACAAGGGAGATGG - Intergenic
1179918056 21:44490720-44490742 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
1180910449 22:19446698-19446720 GGGGGGAAAAAAAAGAGAGAGGG - Intronic
1180930439 22:19586914-19586936 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1180937029 22:19632670-19632692 TGGGGGAACCAGAAGACAGATGG + Intergenic
1180969819 22:19809357-19809379 TGAGGGAGCCAGAAGGGAGATGG - Intronic
1181044000 22:20206067-20206089 TGGGGGAGCCAGAGGGGAGATGG + Intergenic
1181451672 22:23026793-23026815 TGGAGGATCCAGAAGGGAGATGG + Intergenic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1182478467 22:30590242-30590264 CGAGGGATACAGAAGTGTGAGGG - Intronic
1182888063 22:33792878-33792900 CACGGGAAAAAGAAAGGAGAAGG + Intronic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183134363 22:35872543-35872565 TGTGGGAGCCAGAAGGGAGATGG + Intronic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183315612 22:37135454-37135476 TGGGAGAAACAGCAAGGAGAGGG + Intronic
1183697975 22:39433896-39433918 TGGAGGAAACAACAGGGAGACGG - Intronic
1184110698 22:42392454-42392476 AGAGAGAAACAGAAAGGAGAGGG + Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184697783 22:46149829-46149851 CGGGGGAACGAGGAGGGTGAAGG - Intergenic
1184706195 22:46215150-46215172 CTGGGGAAAAAGAGGAGAGACGG - Intronic
1184934172 22:47706934-47706956 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
949243424 3:1897001-1897023 CAGAGGAAACAGAAGGCATAAGG - Intergenic
949444132 3:4115254-4115276 TGGGGAGGACAGAAGGGAGATGG - Intronic
949519105 3:4833624-4833646 AGAGGGAAACAGAAGGAAGCAGG - Intronic
950264502 3:11564151-11564173 CTGGGGAAATATATGGGAGAAGG - Intronic
952256596 3:31701188-31701210 AGGGGGCAAGAGAAGAGAGAGGG - Intronic
952450018 3:33422724-33422746 AGAGGGAGAAAGAAGGGAGAGGG + Intronic
952564209 3:34635413-34635435 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
952580259 3:34824564-34824586 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
953088387 3:39697469-39697491 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
953380975 3:42472894-42472916 GGGGGAAAAGAGAAGGGAGGTGG - Intergenic
953854930 3:46493887-46493909 CGGGGGAGACCGTGGGGAGACGG - Intergenic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954599599 3:51857935-51857957 CGGGGGAGACCGTGGGGAGATGG - Intergenic
954736576 3:52712646-52712668 TGCGGGAACCAGAAGGAAGATGG + Intronic
954922463 3:54203603-54203625 TGGGGAAGCCAGAAGGGAGATGG + Intronic
955354315 3:58217750-58217772 CGTGGGAACCAGCAGGGAGCTGG + Intergenic
955480575 3:59385425-59385447 TGGAGGAGCCAGAAGGGAGATGG - Intergenic
956194113 3:66635087-66635109 TCGGGGAGCCAGAAGGGAGATGG - Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
957058050 3:75459313-75459335 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
957155429 3:76538296-76538318 CGTAGAAAAGAGAAGGGAGAGGG - Intronic
957551933 3:81717566-81717588 CGGGAAAAACAAAATGGAGAGGG + Intronic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958632904 3:96703937-96703959 TGGGGGAGCCTGAAGGGAGATGG - Intergenic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
959049619 3:101512653-101512675 TGAGGGAAAGAGGAGGGAGAGGG + Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959269733 3:104192337-104192359 AGGGGGAGCCAGAAGGGAGATGG + Intergenic
960023949 3:112987816-112987838 TAGGGGAGCCAGAAGGGAGATGG + Intergenic
960062824 3:113340902-113340924 TGGGAGAACCAGAAGGGAGATGG + Intronic
960092058 3:113650818-113650840 CTGGGGAAAGAGAAAGGAGGGGG - Exonic
960121233 3:113950122-113950144 CGGTGGAAACACAGAGGAGAGGG - Intronic
960192120 3:114719194-114719216 GGGGGGAAATAGAAGCAAGAAGG + Intronic
960228472 3:115195670-115195692 CTGATGAAACAGAAGAGAGAAGG + Intergenic
960328112 3:116321565-116321587 CTGGGGAAACTGAATTGAGATGG + Intronic
960415797 3:117383403-117383425 TGAGGGAGCCAGAAGGGAGATGG - Intergenic
960938268 3:122916630-122916652 CGTGGGAAGCAGAAGTGTGAGGG - Intronic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961106318 3:124245138-124245160 CGCTGGGAAGAGAAGGGAGAAGG - Intronic
961295403 3:125880402-125880424 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
961620414 3:128219496-128219518 ATGGGGAAACAGCAAGGAGAAGG - Intronic
961890500 3:130126774-130126796 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
962095098 3:132285166-132285188 TGGGGGAGCCAGAAGGGAGATGG + Intronic
962203108 3:133415990-133416012 CGGGGTGAATAGAAGGGAGAGGG - Intronic
962203303 3:133416796-133416818 AGGGGTGAATAGAAGGGAGAGGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962384100 3:134919291-134919313 TGGGGGAGACACATGGGAGATGG + Intronic
963758619 3:149261660-149261682 AGAGAGAAACAGAAGGGAAAAGG + Intergenic
963996999 3:151721375-151721397 TGGGGGAGCCGGAAGGGAGATGG + Intergenic
964308026 3:155361691-155361713 TGGGGGAGCTAGAAGGGAGACGG + Intergenic
964684173 3:159376691-159376713 AGAGGTAAAAAGAAGGGAGAAGG - Intronic
965321020 3:167251168-167251190 TGGGGGAGCCAGAAGGGAGATGG - Intronic
965871288 3:173268161-173268183 TGGGAGAAACAGTAGGGAGTGGG + Intergenic
965946662 3:174250629-174250651 AGAGGAAAAAAGAAGGGAGAAGG + Intronic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
966799320 3:183748209-183748231 AAGGGGAAAGGGAAGGGAGAAGG - Intronic
966908162 3:184542676-184542698 AGAGAGAAACAGATGGGAGAAGG + Intronic
967102548 3:186228289-186228311 AGGGGGAGAGAGAAGGAAGAGGG - Intronic
968086385 3:195875795-195875817 CGGGGGCAGCAGGAGGTAGAAGG - Intronic
968406278 4:342084-342106 CAGGGGAAACAGAAAGGAAATGG + Intronic
969001885 4:3989189-3989211 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
969752119 4:9119346-9119368 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
969780150 4:9395026-9395048 GGGGGGAGGCAGAAGGGAAAAGG + Intergenic
969812034 4:9655622-9655644 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
969872963 4:10116281-10116303 CGGCGGGGACAGAAGGGAGAAGG + Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970054648 4:11957219-11957241 TGGGGGAGACAGAAGGGAGATGG + Intergenic
970234437 4:13944477-13944499 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
970234486 4:13944768-13944790 TGGGGGAGTCAGAAGGAAGATGG + Intergenic
970433168 4:16007686-16007708 AGGGGGAAAAGGAAGGGAGATGG + Intronic
970652890 4:18197954-18197976 CTGGGAAAAGAGAATGGAGAGGG - Intergenic
970697560 4:18696215-18696237 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
971201689 4:24515031-24515053 CGGGGGAAAGAAAATAGAGATGG + Intergenic
971626206 4:28923250-28923272 AGGGAGAAAGAGAGGGGAGATGG - Intergenic
971986915 4:33837988-33838010 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
972350217 4:38229929-38229951 CGGGGGAGGAAGAAGAGAGACGG + Intergenic
973057446 4:45678812-45678834 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
973808432 4:54547626-54547648 AGGTGGAAGCAGAAGGCAGAAGG - Intergenic
974012277 4:56617832-56617854 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974250097 4:59374902-59374924 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
974669705 4:65014149-65014171 TGGGGGAGCCAGAAAGGAGATGG + Intergenic
974752064 4:66154332-66154354 TGGGGGAGCCAGAAAGGAGACGG - Intergenic
976070635 4:81236081-81236103 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
976751436 4:88454568-88454590 TGGGGGAGCCAGAAGGGAGTTGG - Intergenic
976848147 4:89513565-89513587 AGGGGGAGACAGAAGAAAGATGG - Intergenic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
977246498 4:94637656-94637678 GTGGGGAAACAGAAAGGATAAGG + Intronic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
978721179 4:111911457-111911479 CTGCGGAGAGAGAAGGGAGATGG + Intergenic
980485439 4:133451134-133451156 TGGGGGAACCAGAAAGGAAATGG - Intergenic
981317210 4:143351297-143351319 TGGGGGAGCCAGAAGGCAGATGG + Intronic
981550688 4:145938026-145938048 AGGGGGCAAGAGAAGGGAGGAGG - Intronic
981716633 4:147758595-147758617 CAGGGGACAAAGAATGGAGAAGG - Intronic
981874370 4:149522613-149522635 AGGGGGAAAAAGTGGGGAGAAGG + Intergenic
982315111 4:154023985-154024007 TGGGGGAGCCAGAAGAGAGATGG - Intergenic
982504431 4:156198903-156198925 TGGGGCAGTCAGAAGGGAGATGG - Intergenic
982751221 4:159164340-159164362 CGGGAGAGACAGGAAGGAGAAGG + Intronic
982947779 4:161648041-161648063 TGGGGGAGCCAGTAGGGAGATGG - Intronic
983046002 4:162986567-162986589 CGGGGAAACAAGAAGAGAGAGGG + Intergenic
983145961 4:164215215-164215237 TGGGGGAGCCAGAAGAGAGATGG + Intronic
983500935 4:168499229-168499251 CGGGGAAGAAGGAAGGGAGAAGG + Intronic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984271896 4:177557716-177557738 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
984846183 4:184109987-184110009 TGGGGGAGATGGAAGGGAGAAGG + Intronic
985855240 5:2419214-2419236 CTGGGGAAAGGGGAGGGAGAAGG + Intergenic
986484018 5:8217288-8217310 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987772212 5:22319940-22319962 CGGGAGCAGGAGAAGGGAGATGG + Intronic
988038103 5:25853472-25853494 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
988773188 5:34452048-34452070 GTGGGGAAATAGAAGGGTGAAGG - Intergenic
989204502 5:38797734-38797756 TGGGGGAGCCAGAAGGGAGCTGG + Intergenic
990024426 5:51167997-51168019 TGGGGGAAAAAAAAGGAAGAAGG - Intergenic
990560627 5:56980054-56980076 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
990698236 5:58446574-58446596 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
990792351 5:59496099-59496121 TGGGGGAGCCAGAAGGGAGATGG + Intronic
990807124 5:59676925-59676947 GGCTGGAAACAGTAGGGAGAAGG - Intronic
991215831 5:64156602-64156624 CTGGGGAAATAGTAAGGAGAAGG + Intergenic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
992644276 5:78797637-78797659 CGGGGGCAGCAGAAAGGTGATGG - Intronic
992849712 5:80794643-80794665 GGTGGGTAGCAGAAGGGAGAAGG + Intronic
994301918 5:98157476-98157498 TGGGGGAGTCAGAGGGGAGATGG + Intergenic
995063422 5:107835708-107835730 GGGTGGAAAGAGAGGGGAGAAGG + Intergenic
995238801 5:109861757-109861779 CATGGGAACAAGAAGGGAGAGGG + Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
996012687 5:118498762-118498784 CAGGGCAATCAGACGGGAGAAGG - Intergenic
996267543 5:121560282-121560304 CGCGTGGAACAGAAGTGAGATGG + Intergenic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
996530829 5:124525156-124525178 GGGTGGAAACATGAGGGAGAAGG - Intergenic
996684936 5:126269687-126269709 TGGGAGGAACAGATGGGAGAAGG - Intergenic
997565467 5:134882825-134882847 CCGTGGAAAGAGGAGGGAGAGGG + Intronic
998005333 5:138653202-138653224 CTGGGGCAAGAGAAGGGTGAAGG - Intronic
998158955 5:139802288-139802310 CTGGGCAGACAGAAGGGAGGAGG + Intronic
999000241 5:147912920-147912942 GAGGGGAAAGAGAAGAGAGAAGG + Intergenic
999710284 5:154312345-154312367 GGGGGGATAGAGAGGGGAGAGGG - Intronic
999793388 5:154964736-154964758 TGGGGGAGATAGAAGGGAAATGG + Intronic
1000167923 5:158673260-158673282 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1000821935 5:165995487-165995509 CCGGAGACACAGAGGGGAGAAGG + Intergenic
1000908573 5:166993586-166993608 TGGGGAAAACAGGAGAGAGAGGG + Intergenic
1001181151 5:169521886-169521908 TAGGGGAGCCAGAAGGGAGATGG - Intergenic
1001940118 5:175734337-175734359 TGGGGGAGACAGAAGGGAGATGG - Intergenic
1002038409 5:176491571-176491593 CCAGGAAAACAGAAAGGAGAAGG + Intronic
1002271346 5:178074533-178074555 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002401157 5:178992194-178992216 CCTGGGACACAGATGGGAGATGG + Intronic
1002795706 6:469687-469709 AGGGGGAGAGAGGAGGGAGACGG - Intergenic
1002842772 6:920794-920816 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1002843354 6:924546-924568 TGGGGCAGCCAGAAGGGAGATGG - Intergenic
1002962230 6:1926084-1926106 TGGGGGAACCAGAAGAGAGATGG - Intronic
1003123640 6:3338084-3338106 TGGGGGAAACTGATGGAAGACGG - Intronic
1003131221 6:3396794-3396816 TGCGGGAGCCAGAAGGGAGATGG - Intronic
1003162923 6:3651326-3651348 CGGGGGAAAAGGGAGGGAGGAGG + Intergenic
1003285943 6:4734138-4734160 GAGGGGAAACAGCAGAGAGAGGG - Intronic
1003499783 6:6694838-6694860 TGGGGGAGCCAGAAGGGAGACGG + Intergenic
1003533388 6:6955960-6955982 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1004027307 6:11831705-11831727 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1004417249 6:15436295-15436317 TGGGAGAGCCAGAAGGGAGATGG + Intronic
1004544998 6:16589057-16589079 TGGGGGGAACAGAAGAGAGAAGG - Intronic
1004631669 6:17427235-17427257 CTGGGAAAAGATAAGGGAGAGGG + Intronic
1004953621 6:20702502-20702524 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1005149089 6:22727726-22727748 TGGTGGTAAGAGAAGGGAGAAGG - Intergenic
1005794758 6:29347960-29347982 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006165420 6:32061776-32061798 CGTGGGGAAAAGGAGGGAGAAGG + Intronic
1006186475 6:32184256-32184278 CGGAGGCCACAGCAGGGAGAGGG - Exonic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006208931 6:32376045-32376067 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006574904 6:35037905-35037927 TGGTGGTAAGAGAAGGGAGAGGG + Intronic
1006755360 6:36410513-36410535 AGAGAGAAAGAGAAGGGAGAAGG + Intronic
1006793247 6:36717063-36717085 CGGGGGTTCGAGAAGGGAGAGGG + Intronic
1006813992 6:36838860-36838882 AGGAGGGCACAGAAGGGAGAGGG + Intronic
1007005038 6:38353415-38353437 CGGGGGAGAAAAAAGGGAGGGGG + Intronic
1007183941 6:39951451-39951473 CAGGAGAAACAGCAGGGATATGG - Intergenic
1007376826 6:41462719-41462741 TGAGGGAAAGAGAAGGTAGAGGG + Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007937027 6:45741578-45741600 GGGCAGAAACAGGAGGGAGAGGG - Intergenic
1008547495 6:52596048-52596070 AGGGGGAAAGAGAGGAGAGAGGG + Intergenic
1008548014 6:52600410-52600432 TGGGGGAAAGAGACTGGAGAGGG + Intergenic
1008730865 6:54481193-54481215 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010503986 6:76633749-76633771 TGGAGGAGCCAGAAGGGAGATGG + Intergenic
1010525845 6:76899468-76899490 AGTGGGAAATAGAAGGGAAAGGG + Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010815863 6:80357346-80357368 CTGTTGAAACAGAATGGAGAGGG + Intergenic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1011639594 6:89406587-89406609 TAGGGGAGCCAGAAGGGAGACGG - Intronic
1011801603 6:91022171-91022193 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1012072434 6:94639908-94639930 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1012179591 6:96135643-96135665 CGGGGGAGAAAGAAGTGGGAGGG + Intronic
1012440198 6:99255180-99255202 TGGGGGAGGCAGAAGGGAGACGG - Intergenic
1013516728 6:110894264-110894286 TGGGGGAGACACCAGGGAGAGGG - Exonic
1013561427 6:111309309-111309331 TGGTGGAATCAGCAGGGAGATGG + Intronic
1014247246 6:119081682-119081704 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1014717968 6:124887793-124887815 TGGGGGATCCACAAGGGAGATGG - Intergenic
1015181242 6:130365312-130365334 CGGGGGAAATGGAAGACAGAGGG - Intronic
1016109587 6:140206077-140206099 TGGGGGAGCCAGAAAGGAGATGG - Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016515781 6:144891896-144891918 AGGGGGAAACAGAGGGCAAAGGG + Intergenic
1016784306 6:147993271-147993293 GGGAGTAAAGAGAAGGGAGAGGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018843043 6:167532196-167532218 TGGGGGAGCTAGAAGGGAGATGG - Intergenic
1019136560 6:169912166-169912188 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
1019283248 7:211115-211137 CGGGGGAGGAGGAAGGGAGAAGG - Intronic
1020577731 7:9955454-9955476 CTGGGGAAAGAAAAGGGAGAAGG + Intergenic
1021638684 7:22716992-22717014 CAAGGGAAACAGAGAGGAGAAGG - Intergenic
1021989941 7:26131413-26131435 TGAGGGAAACAGAAGGGGAATGG + Intergenic
1022099951 7:27163509-27163531 TGGGGGTGAGAGAAGGGAGAAGG + Exonic
1022517811 7:30987045-30987067 GGGGGGAGCCAGAAGGGAGCGGG + Intronic
1022644481 7:32217649-32217671 TGGGGGAAAATGAAGGGAGGAGG + Intronic
1023253539 7:38290687-38290709 TGGGGGAGCCAGACGGGAGATGG - Intergenic
1024185485 7:46944335-46944357 CAGTGGAAACAGAAGTGAGCAGG - Intergenic
1024203063 7:47126034-47126056 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024268132 7:47622097-47622119 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1024725493 7:52189438-52189460 AGAGGGAAAGGGAAGGGAGAGGG + Intergenic
1024883648 7:54116990-54117012 CAGGTGATACAGAAGTGAGAGGG - Intergenic
1025273537 7:57550943-57550965 TGCGGGAGCCAGAAGGGAGATGG - Intergenic
1026153005 7:67803875-67803897 AGGAGGAGACAGAAGGTAGAAGG + Intergenic
1026794464 7:73357692-73357714 GGGAGGAAAGAGAAGGGAAAGGG + Intronic
1027333461 7:77123279-77123301 CGGTGGAAAGAGCAGGGACAAGG + Intronic
1027508932 7:79054656-79054678 TGGGAGGAACAGAATGGAGATGG - Intronic
1029033216 7:97490597-97490619 TGCGGGAGCCAGAAGGGAGATGG - Intergenic
1029190667 7:98769846-98769868 TGGGGGAAGCAGAAGGGAAGAGG - Intergenic
1029289283 7:99489691-99489713 TTGTGGAAACAGAAGGGATATGG - Intronic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029528899 7:101112350-101112372 CGGGGGCAAGGGAAGGGACAGGG - Intergenic
1029782334 7:102748032-102748054 CGGTGGAAAGAGCAGGGACAAGG - Intergenic
1030503272 7:110386548-110386570 CAGGGGAAATAGGATGGAGAGGG + Intergenic
1030794414 7:113770292-113770314 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1031219441 7:118945920-118945942 TGGGAGAGGCAGAAGGGAGATGG - Intergenic
1032542907 7:132718536-132718558 GGTTGGAGACAGAAGGGAGAAGG - Intronic
1032544993 7:132734370-132734392 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1033418502 7:141185376-141185398 TGAGGGAGCCAGAAGGGAGATGG + Intronic
1034099272 7:148437308-148437330 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035004447 7:155644769-155644791 CGGAGGACAGAGAAGGGAGGGGG - Exonic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1036854201 8:12228398-12228420 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1037017642 8:13928403-13928425 CCGGGGAAAAAGGTGGGAGAAGG + Intergenic
1037086714 8:14860434-14860456 AGAGGGAAAGAGAAGAGAGAAGG + Intronic
1037319528 8:17630160-17630182 TGGGGAAAACAGAAGAAAGACGG - Intronic
1037515842 8:19630882-19630904 AGGGGGAAACTGTAGGGAGGCGG - Intronic
1037531996 8:19785806-19785828 CGGGGGACACAGCAGAGAGTTGG - Intergenic
1037635976 8:20701308-20701330 TGGGGGAAAGGGAAGGGAAACGG - Intergenic
1037804325 8:22050637-22050659 GGAGGGACAGAGAAGGGAGAGGG + Intronic
1038064429 8:23948598-23948620 CGGGAGTACCAGAAAGGAGAAGG - Intergenic
1038862381 8:31401625-31401647 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1039390837 8:37179811-37179833 AGGGGGAAAGGGGAGGGAGAGGG - Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039927587 8:41950920-41950942 TTCTGGAAACAGAAGGGAGAGGG + Intronic
1041105746 8:54442500-54442522 TGGTGGAAACAAAAGGAAGATGG + Intergenic
1041312353 8:56529762-56529784 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1041726244 8:61020215-61020237 TGGGGGAAACGAAAGAGAGAAGG + Intergenic
1041934719 8:63322440-63322462 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042598198 8:70471749-70471771 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1042678151 8:71346466-71346488 TGGGGAAAACTGCAGGGAGAAGG - Intronic
1043238457 8:77899699-77899721 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1043605284 8:81991723-81991745 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1044085340 8:87936428-87936450 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1044206203 8:89494331-89494353 ACGGGGAGCCAGAAGGGAGATGG - Intergenic
1045054499 8:98357697-98357719 AGGAGGAAGCAGAAAGGAGAAGG - Intergenic
1045702187 8:104879959-104879981 CTGGGGAAATAAAAGTGAGATGG - Intronic
1045861522 8:106819235-106819257 TGGGGGAGCCAGAAGGGAGACGG - Intergenic
1045938499 8:107710982-107711004 TGGGGGAGTCAGAAGGGAGATGG + Intergenic
1046138915 8:110064051-110064073 TGGGGGAGCCAGAAGGGAAATGG - Intergenic
1046142709 8:110115894-110115916 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1046277442 8:111982237-111982259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1046590326 8:116198474-116198496 TGGGGGACCCAAAAGGGAGATGG + Intergenic
1046870163 8:119197120-119197142 TGGGGGAGCCAGAAGGGAGATGG + Intronic
1047202103 8:122775977-122775999 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1047542607 8:125785030-125785052 TGGGGGAGCAAGAAGGGAGATGG - Intergenic
1047586521 8:126279690-126279712 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
1047990242 8:130278741-130278763 TGGGTGAAACAGAAGAGAGGGGG + Intronic
1048135036 8:131740118-131740140 TGGGAGAGCCAGAAGGGAGATGG - Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048879166 8:138859016-138859038 CTGGGGACCGAGAAGGGAGATGG - Intronic
1048978102 8:139684558-139684580 CAGGGGAAAAAGAAGGCAAAAGG + Intronic
1049726981 8:144151503-144151525 TGGGGGAGCCAGAAAGGAGATGG - Intronic
1050043620 9:1521102-1521124 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1050342485 9:4654643-4654665 TGGGGGAGCCAGCAGGGAGATGG + Intronic
1050479300 9:6073393-6073415 TCGGGGAGTCAGAAGGGAGACGG - Intergenic
1051103580 9:13550957-13550979 TGGGGCAGCCAGAAGGGAGATGG + Intergenic
1051278354 9:15418083-15418105 GGGAGGAGACAGAAGGAAGAAGG - Intergenic
1051640996 9:19224726-19224748 TGCGGGAAAGAGAAGGGAGTAGG - Intergenic
1052778402 9:32755813-32755835 GCGGGGAGCCAGAAGGGAGATGG + Intergenic
1052830245 9:33209367-33209389 TGGGGAAGACAGAAGGGATATGG + Intergenic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1054928618 9:70613664-70613686 AGGCAGAAACAGCAGGGAGAAGG - Intronic
1055092836 9:72380204-72380226 AGAGGGAAAAAGAAAGGAGAGGG - Intergenic
1055177336 9:73336259-73336281 AGGGGGAAAAGGAAGGAAGATGG - Intergenic
1056400446 9:86222653-86222675 AGGGTGGAAGAGAAGGGAGAGGG - Intronic
1057374794 9:94510773-94510795 CGGAGCAAACAGAAAGCAGATGG + Intergenic
1057490081 9:95513790-95513812 GGGAGGAAACAGAAGGTGGAAGG - Intronic
1058311933 9:103514845-103514867 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1058584468 9:106492243-106492265 TGGGGGAGCCAGAAGGGAAATGG + Intergenic
1059042495 9:110829909-110829931 TGGCGGAGCCAGAAGGGAGACGG - Intergenic
1059042603 9:110830565-110830587 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1059166988 9:112086728-112086750 GGTGGGCAACAGAAGCGAGAGGG + Intronic
1059351451 9:113668182-113668204 TGGGGGAAACAGAATGGTGGTGG - Intergenic
1059422323 9:114199983-114200005 TGGGGGCAACAGGAGGGAGCTGG - Intronic
1059432271 9:114257371-114257393 CGGGGGAGACATTAGGCAGAGGG + Intronic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG + Intergenic
1061700575 9:132412030-132412052 CGGGGGAAGCAAAAGGAAAAAGG - Intronic
1061994659 9:134177399-134177421 CGGGGGGAAGAGGAGGGACACGG - Intergenic
1062194118 9:135263848-135263870 AGGGGGAGAGAGAAGGGAGGGGG - Intergenic
1062194229 9:135264113-135264135 AGGGGGAGAGAGAAGGGAGGGGG - Intergenic
1185708506 X:2282839-2282861 AGGGAGAGAGAGAAGGGAGAAGG + Intronic
1185837749 X:3360948-3360970 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1185942865 X:4340803-4340825 TGGGGGAGCCAGCAGGGAGATGG + Intergenic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186473114 X:9836520-9836542 AGGGAGAGAGAGAAGGGAGAAGG - Intronic
1186588102 X:10898150-10898172 AAGGGGAAAGGGAAGGGAGAAGG + Intergenic
1187412351 X:19062346-19062368 CAGGGGAAACTGAAAGCAGAGGG - Intronic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1189110763 X:38286584-38286606 AGGAGGAAACAGAGGGGAGAGGG - Exonic
1189377839 X:40479672-40479694 AGGGGAGAAAAGAAGGGAGAGGG - Intergenic
1189959065 X:46307555-46307577 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1190520923 X:51279241-51279263 CGGGGGAGACCGTGGGGAGACGG - Intergenic
1190575507 X:51832607-51832629 GAGGGGAAAGAGAAGGGAAAAGG + Intronic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192559021 X:72113261-72113283 TGTGGGAAACAGATGGGAGGTGG + Intergenic
1192783790 X:74318972-74318994 TCGGGGAAAGAGAAGGGAGGTGG + Intergenic
1193358422 X:80551155-80551177 TCGGGGAGCCAGAAGGGAGATGG + Intergenic
1193416378 X:81229529-81229551 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1193702468 X:84779913-84779935 TGGGGGAGCCAGAAGGGAGATGG + Intergenic
1193898240 X:87141118-87141140 TGAGGGAGCCAGAAGGGAGATGG - Intergenic
1194026964 X:88764462-88764484 CTGTGGAAACAGAAGGGATCAGG + Intergenic
1194353312 X:92849790-92849812 TGGTTGAAACAGCAGGGAGAGGG - Intergenic
1194535672 X:95103551-95103573 TGCGGGAGTCAGAAGGGAGATGG + Intergenic
1195025519 X:100873080-100873102 CAGGCAAAACAGAAGAGAGAAGG - Intronic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1196072302 X:111539336-111539358 TGGGGGAACCAGAAGGGAGATGG - Intergenic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1196261398 X:113586386-113586408 TGGTGGAGCCAGAAGGGAGATGG + Intergenic
1196281508 X:113828472-113828494 AGCAGGAGACAGAAGGGAGATGG - Intergenic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198105302 X:133455895-133455917 AGGGGGAAAAAGAAGAGAAAGGG + Intergenic
1198964274 X:142210757-142210779 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1199142628 X:144331436-144331458 CGGGGGAGCCAGAAGGGAGATGG + Intergenic
1199143309 X:144335917-144335939 TGAGGGAGCCAGAAGGGAGATGG + Intergenic
1199649706 X:149939497-149939519 CGGGAGAAACAGGGAGGAGATGG + Intergenic
1199665068 X:150089982-150090004 GGGGGGAAGCAAAAGGGAGGGGG - Intergenic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200155010 X:153970574-153970596 GGGAGGAAAGAGGAGGGAGAGGG + Intronic
1200661670 Y:5966863-5966885 TGGTTGAAACAGCAGGGAGAGGG - Intergenic
1200883074 Y:8240962-8240984 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200940573 Y:8775978-8776000 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200955187 Y:8937524-8937546 TGGGGGAGCCAGAAGGGAGATGG - Intergenic
1201479825 Y:14427608-14427630 GTGGGGAAAGAGCAGGGAGATGG + Intergenic
1201576046 Y:15462187-15462209 GGGGGGAAACAATAAGGAGAAGG + Intergenic
1202200009 Y:22336240-22336262 ATGGGGAGCCAGAAGGGAGATGG - Intronic
1202233324 Y:22678768-22678790 ATGGGGAGCCAGAAGGGAGACGG - Intergenic
1202309832 Y:23517390-23517412 ATGGGGAGCCAGAAGGGAGACGG + Intergenic
1202560969 Y:26153203-26153225 ATGGGGAGCCAGAAGGGAGACGG - Intergenic