ID: 1173523161

View in Genome Browser
Species Human (GRCh38)
Location 20:43713759-43713781
Sequence GGCCAGTGGACTTGCTGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 1, 2: 6, 3: 15, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173523149_1173523161 26 Left 1173523149 20:43713710-43713732 CCAGGCACTTGGGCACATTAGTC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG 0: 1
1: 1
2: 6
3: 15
4: 169
1173523154_1173523161 4 Left 1173523154 20:43713732-43713754 CCTGGGATGGGTGCTATACAGCC 0: 1
1: 0
2: 1
3: 7
4: 72
Right 1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG 0: 1
1: 1
2: 6
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173523161 Original CRISPR GGCCAGTGGACTTGCTGTGC CGG Intronic
900002210 1:20992-21014 GGCCAGAGGCCGGGCTGTGCTGG + Intergenic
900960161 1:5913982-5914004 GCCCAGTGTACTTACTTTGCGGG - Intronic
902378126 1:16039781-16039803 GGCCAGAGGACTTGGTGAGCTGG - Intergenic
902383216 1:16062277-16062299 GGCCAGAGGACCTGGTGAGCTGG - Intronic
902890461 1:19439588-19439610 GGACAGAGGACTCTCTGTGCTGG - Intronic
905045493 1:34996776-34996798 GGCAAGTAGAGTTGCTGTGCAGG - Intronic
905230760 1:36513754-36513776 AGGCAGTGGACATTCTGTGCAGG + Intergenic
905800519 1:40839516-40839538 TGCCAGTGGACTGGCCTTGCAGG + Exonic
907785810 1:57611608-57611630 TGCCAGTGTACTAGCTGTGGAGG - Intronic
909137251 1:71817019-71817041 GGCAAGTTGGCTTGCTGTGGAGG - Intronic
915272158 1:154760895-154760917 GGCCAGTGGCCTTGGTGGACAGG - Intronic
919892983 1:201989591-201989613 GACCAGTGGACCTGCTGGGGGGG + Intronic
920375066 1:205503945-205503967 GGCCAGTTCAATTGCTTTGCTGG + Intergenic
922661098 1:227430921-227430943 AGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG + Exonic
1069623448 10:69852054-69852076 GGCCTTTGCACTTGCTGTGCTGG + Intronic
1069987213 10:72292626-72292648 GGACTGTGGAGTTGCTGTGGGGG - Intergenic
1070361869 10:75698327-75698349 GGCCAGTGTTCTTACTTTGCTGG - Intronic
1076530392 10:131140877-131140899 GGCAAGAGGCCTGGCTGTGCAGG + Intronic
1076621879 10:131794198-131794220 GGCAAGTGGACTTTCTGTCTTGG - Intergenic
1076763420 10:132616919-132616941 GGCCAGTTGCTTTGCTGCGCTGG + Intronic
1077436298 11:2540776-2540798 AGCCTGGGGACTTGCTGTGAGGG + Intronic
1083372681 11:62194241-62194263 GGTCAGGGGACTTGCTGGGTGGG - Intergenic
1083714453 11:64567685-64567707 GGGCCGTGGACTTCCTGGGCCGG + Exonic
1083747389 11:64743630-64743652 GGCCTGTGGACAAGCTGAGCCGG - Intronic
1084788708 11:71459468-71459490 GGCCTCTGCACGTGCTGTGCTGG + Intronic
1088642763 11:111889360-111889382 AGCAAGTGTACTTGGTGTGCTGG + Intergenic
1089603725 11:119629677-119629699 GGAGAGGGGACATGCTGTGCAGG + Intronic
1090470925 11:126980441-126980463 AGCCAGTGGGCTTGCTGAGAAGG + Intronic
1091375628 12:23052-23074 GGCCAGAGGCCGGGCTGTGCTGG + Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1099833035 12:87869773-87869795 GGACAGAGGACTTTCAGTGCTGG - Intergenic
1099835090 12:87900233-87900255 TGGCAGTGGACTTGCTCTGTTGG - Intergenic
1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG + Intergenic
1104141809 12:125994594-125994616 TGCCAGTGGTCTTTCTGTTCTGG + Intergenic
1104688948 12:130809999-130810021 GACCTGGGGTCTTGCTGTGCTGG - Intronic
1106920764 13:34561080-34561102 AGCCAGTGTACTTGCTGGGGAGG + Intergenic
1107943210 13:45393070-45393092 GGCCAGTGAACTTGATTTGAGGG - Intergenic
1110786484 13:79534133-79534155 GGTCAGTGGACTTGAGGTCCAGG - Intronic
1112053892 13:95671803-95671825 GGCAAGTCCTCTTGCTGTGCTGG - Intergenic
1113947131 13:114050666-114050688 TGTCAGGGGACTTGCTGTGGAGG + Intronic
1114424925 14:22613555-22613577 GGCCAGAGGATCTGCTGAGCTGG - Intergenic
1119873320 14:78035315-78035337 GGCCAATTTACTTCCTGTGCTGG + Intergenic
1121015433 14:90546166-90546188 GGCCAGTCCTCTAGCTGTGCTGG - Intronic
1121019536 14:90570805-90570827 GCCCGGTGGTGTTGCTGTGCGGG - Intronic
1121884643 14:97532374-97532396 TGCCAGTGGAGTTGCTTTGAGGG - Intergenic
1123012338 14:105355555-105355577 GGCCAGAGCACGTGCTGAGCAGG - Intronic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123094547 14:105760698-105760720 GGCCAGTGCAGTTGCTGGACTGG + Intergenic
1128606495 15:69040079-69040101 GGCCAGGGGTCCTGCTGGGCTGG - Intronic
1128636463 15:69305570-69305592 GGTCAGTGGCCTTCCAGTGCGGG + Intronic
1129892715 15:79082138-79082160 GGCCAGTGGACTGGGGGTGGGGG + Intronic
1130202313 15:81843314-81843336 GCCCAATGGACTTACTGTACTGG - Intergenic
1131133012 15:89912343-89912365 GGACAGTGGCCGTGCTGTGGCGG - Intronic
1132451300 15:101969947-101969969 GGCCAGAGGCCGGGCTGTGCTGG - Intergenic
1134838201 16:17379550-17379572 GCCCAGTGGCCTGGCTGGGCTGG - Intronic
1138834312 16:60414820-60414842 GGCCTGGGGACTTGCAGAGCTGG - Intergenic
1138976548 16:62214582-62214604 GCCCAGAGGATTTGGTGTGCAGG - Intergenic
1139672630 16:68502132-68502154 AGCAAGTGGCCTTGCTGGGCTGG + Intergenic
1139708861 16:68761221-68761243 GGGCAGAGGACCTGCTGTCCGGG - Intronic
1141650770 16:85391854-85391876 GGCTTCTGGACTTGCTATGCTGG + Intergenic
1142640268 17:1281355-1281377 GGCCAGAGGACTAGGTGTGGAGG + Intronic
1142644062 17:1300780-1300802 GGTCAGTGGCCCTGCTGTCCCGG + Exonic
1143023243 17:3927459-3927481 GCCCAGAGGCCTGGCTGTGCAGG + Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144586664 17:16491688-16491710 GGCCAGGGGGCGTGCTGGGCCGG - Intronic
1144632430 17:16881017-16881039 TCCCAGTGGGCTTGCTGGGCAGG + Intergenic
1146641783 17:34547332-34547354 GGGCAGTGGCCTTGTTTTGCAGG + Intergenic
1149008519 17:51830896-51830918 GGCCTGTGGTCTAGCTGTGAAGG - Intronic
1150834292 17:68550743-68550765 GTCCAGTGGACTAGCTCTGGGGG - Intronic
1151280099 17:73067288-73067310 TGTAAGTGGACCTGCTGTGCAGG + Intronic
1151377818 17:73703353-73703375 GGCCAGGGGAGGGGCTGTGCAGG + Intergenic
1151913125 17:77097607-77097629 GGAAAGTGGACTTGCTGGGTGGG + Intronic
1152941440 17:83174751-83174773 GGCCAGAGGACTGGCTGCACGGG + Intergenic
1156026076 18:32656194-32656216 AGCCAGTGGACTTGCGGGGAAGG - Intergenic
1157564586 18:48671150-48671172 GAACAGTGGACTTGCCCTGCTGG + Intronic
1160049798 18:75422106-75422128 GGCCAGTGGCCCTGCTGGGTGGG - Intronic
1160633963 19:62600-62622 GGCCAGAGGCCGGGCTGTGCTGG + Intergenic
1160730826 19:640945-640967 GGACAGGGGACTGGCTGGGCCGG + Intronic
1160806285 19:993601-993623 GGGCAGTGGCCTTGCTGGGCCGG + Intronic
1163204784 19:15794609-15794631 GGCCTGTGGAGATGATGTGCTGG + Exonic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164519621 19:28968703-28968725 TCCCACTGCACTTGCTGTGCTGG + Intergenic
927184085 2:20469741-20469763 GGCAAATTGAGTTGCTGTGCGGG + Intergenic
928767896 2:34670285-34670307 AGCCGGTGGACTTGGGGTGCAGG + Intergenic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
931267388 2:60672843-60672865 TGCCCATGGACTTGCTGTGGTGG + Intergenic
932411374 2:71549877-71549899 GGCCAGTGCCCTGTCTGTGCTGG + Intronic
935634114 2:105236930-105236952 GGCAAGTGGAGTTGCTGGGGAGG + Intergenic
937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG + Intronic
938201651 2:129377312-129377334 TGCCAGTTGACATGATGTGCTGG + Intergenic
938571885 2:132568889-132568911 AGCCAGTGGCCTTGCTGGGCAGG + Intronic
940218815 2:151329169-151329191 GGTCAGTTGCCTGGCTGTGCAGG - Intergenic
941765115 2:169288491-169288513 GGCCAGTGCCTTTGCTGGGCTGG - Intronic
944100369 2:196019910-196019932 GGAGATTGGTCTTGCTGTGCGGG - Intronic
944225959 2:197348870-197348892 GGCCAGGGTGCATGCTGTGCAGG + Intergenic
947475685 2:230445919-230445941 GGTGGGTGGGCTTGCTGTGCTGG - Intronic
948031828 2:234824327-234824349 GGCCAGTGCTCCTGCTGTGTGGG - Intergenic
948602693 2:239116298-239116320 CGGCATTGGACCTGCTGTGCTGG - Intronic
948762998 2:240204170-240204192 GGCCCGTGAGCTGGCTGTGCTGG - Intergenic
1168988176 20:2069301-2069323 TGCCAGTAGACTTGCCTTGCAGG + Intergenic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1173981032 20:47224346-47224368 GGCCAGTGGGCTTGCTGGCAGGG + Exonic
1175243138 20:57564403-57564425 TGCCAGAGGCCTTGGTGTGCCGG + Intronic
1176287272 21:5024787-5024809 GCCCCTCGGACTTGCTGTGCTGG + Intronic
1179869909 21:44238688-44238710 GCCCCTCGGACTTGCTGTGCTGG - Intronic
1180835738 22:18928639-18928661 GGGCATTGGTCTGGCTGTGCAGG - Intronic
1181972725 22:26704663-26704685 GCCCACTGGGCTTGCTCTGCAGG + Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1203285827 22_KI270734v1_random:153938-153960 GGGCATTGGTCTGGCTGTGCAGG - Intergenic
949730713 3:7109530-7109552 TGCCAGTAGACTTACTGTCCAGG + Intronic
949879470 3:8650041-8650063 GGCCTTTGCACTTGCTGTACTGG + Intronic
950262671 3:11554010-11554032 GGCCCTGGGACCTGCTGTGCTGG + Intronic
952301509 3:32107782-32107804 GGCCACTGGCCTTGCTGGGATGG - Intronic
953217165 3:40930425-40930447 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
954103990 3:48399253-48399275 GGCCTGAGGACCTGCTGTCCTGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
960840970 3:121958198-121958220 AGCCAGTGGACTTGGGGGGCAGG + Intergenic
963946091 3:151146895-151146917 GGCCAGTGGTCTGACTCTGCTGG + Intronic
964151596 3:153532015-153532037 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
965386345 3:168050596-168050618 GGCCAGTGGATTGGCGGTGAAGG - Intronic
966231605 3:177658577-177658599 TTCCAGTTGACTTGCTGTGTGGG + Intergenic
968326643 3:197823439-197823461 GGCCATTGAAATTGGTGTGCAGG - Intronic
968703363 4:2067019-2067041 AGCCACGGGTCTTGCTGTGCTGG + Exonic
974456173 4:62131317-62131339 GGCCAGTGGTGTTCCTGTGCTGG - Intergenic
978186076 4:105858361-105858383 GCCGAGTGGTCTTGCTGAGCGGG - Intronic
980661102 4:135859243-135859265 GGCCAGAGGACACACTGTGCTGG - Intergenic
981015564 4:139970440-139970462 GGACTTTGGACTTACTGTGCAGG + Intronic
982455516 4:155604805-155604827 GGCCAGTGTACTTGAAGTGATGG - Intergenic
983665677 4:170179678-170179700 GGCAAGTGGACTTGCTGTTGGGG + Intergenic
989267069 5:39487139-39487161 TGCCAGAGGAATAGCTGTGCTGG + Intergenic
990233921 5:53745956-53745978 GGCCAGTGTGCTCGCTGGGCAGG - Intergenic
990747987 5:58980904-58980926 GGCCTTTGGACTTGCTTTCCTGG - Intronic
991970459 5:72135983-72136005 GGCCAGTGCATTTGGTGAGCTGG + Intronic
994112215 5:96019427-96019449 AGCCATTGGACTTGCTCTGGGGG + Intergenic
996405611 5:123099702-123099724 GGCCACTGCACTCGCTGCGCCGG + Exonic
997582874 5:135028314-135028336 GGCCTGCGGACTGGATGTGCGGG - Exonic
1001085935 5:168700118-168700140 GCCCAGTGCCCGTGCTGTGCTGG - Intronic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006835777 6:36998072-36998094 GGGCAGCGGGCTGGCTGTGCAGG + Intergenic
1009790783 6:68399489-68399511 GCCCAGAAGGCTTGCTGTGCTGG + Intergenic
1011242246 6:85285405-85285427 GGCCTCTGGGCTTGCAGTGCTGG - Intergenic
1016223295 6:141703319-141703341 GGCCAGTGGATTCCCTGGGCAGG + Intergenic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017928287 6:158929601-158929623 TGCCAGTGGACTTGGTGTGTGGG + Intergenic
1019144845 6:169969980-169970002 GGGCTGTGGCCTGGCTGTGCTGG + Intergenic
1023663158 7:42491347-42491369 TGCCAGTGACCTTGGTGTGCAGG + Intergenic
1024341552 7:48268640-48268662 GTCCAGTGGACGTGCTGAGTTGG - Intronic
1024410271 7:49032437-49032459 AGCCAGTGTACTTGATATGCTGG - Intergenic
1027050529 7:75018759-75018781 GGCCTTTGCACATGCTGTGCTGG - Intronic
1028972501 7:96875072-96875094 AGCCAGTGGACTTGGATTGCAGG + Intergenic
1029338020 7:99919072-99919094 GGCCAGTGTGCCTGGTGTGCAGG - Exonic
1029382516 7:100222911-100222933 GGCCTTTGCACATGCTGTGCTGG + Intronic
1029704751 7:102270343-102270365 GGCCAGGAGACTGGCTGTGCGGG - Intronic
1032091605 7:128914260-128914282 GGGCACTGGCCTAGCTGTGCTGG + Intergenic
1033353084 7:140578207-140578229 GGCCAGGGGACATCCTGGGCGGG + Intronic
1035249138 7:157585550-157585572 TGCCAGGTGACTTCCTGTGCGGG - Intronic
1037120107 8:15273786-15273808 TGCCAGTAGACTTGCATTGCAGG + Intergenic
1037971330 8:23173985-23174007 GGCCAGTGGGCTGGCACTGCTGG + Intergenic
1038949414 8:32398309-32398331 AGCCAGTGGGGTTGCTGTGAGGG - Intronic
1039546600 8:38415170-38415192 CCCATGTGGACTTGCTGTGCTGG - Intronic
1039900843 8:41751643-41751665 GGCCAGAGGACTTGCTGCCCAGG - Intronic
1039930098 8:41978989-41979011 AGTCAGTGGACTTCCAGTGCAGG - Intronic
1041171058 8:55142134-55142156 GGCCAGTGGGCTCCCTGTGGGGG - Exonic
1041767143 8:61430778-61430800 GGACAGTGCACTTGTTTTGCAGG + Intronic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1042821814 8:72937547-72937569 TGGCAGTGGCCTGGCTGTGCTGG - Exonic
1047893057 8:129334216-129334238 GTTCAGTGGACTTGCTGTTGTGG - Intergenic
1048337521 8:133514284-133514306 GGCCAGGGAGCTTGCTGTACTGG - Intronic
1049885018 9:21105-21127 GGCCAGAGGCCGGGCTGTGCTGG + Intergenic
1055549470 9:77418326-77418348 GACCAGAAGACATGCTGTGCTGG - Exonic
1056926536 9:90839322-90839344 GGCCATGTGACTTCCTGTGCCGG - Intronic
1057024809 9:91726676-91726698 GACCAGTGGAATTGCGATGCTGG + Exonic
1057606409 9:96500882-96500904 GGCCAGTGTGCTCGCTGGGCTGG - Exonic
1057696429 9:97326129-97326151 GGCCAGCTGACCTCCTGTGCAGG - Intronic
1059251338 9:112890268-112890290 GGCCAGTGGAGGTGCTGTACGGG - Exonic
1059292811 9:113242338-113242360 GGCCATTGGACTTGTTTGGCTGG + Intronic
1059385379 9:113960250-113960272 GGACAGTGGGCTCTCTGTGCTGG + Intronic
1060810599 9:126609818-126609840 TGTCTGTGGTCTTGCTGTGCCGG - Intergenic
1061206087 9:129164278-129164300 GGCCAGTGGCCTTCTTGTTCTGG + Intergenic
1062665560 9:137669472-137669494 GTCCAGTGCACGTGCTGTGGGGG - Intronic
1062665568 9:137669509-137669531 GTCGAGTGCACGTGCTGTGCGGG - Intronic
1062665574 9:137669546-137669568 GGTGAGTGCACGTGCTGTGCGGG - Intronic
1187338618 X:18402083-18402105 GACCTGGGGACTTGCTGTCCTGG + Intergenic
1188716516 X:33465208-33465230 GCCCAGTTCTCTTGCTGTGCTGG - Intergenic
1188797530 X:34484175-34484197 GGCCTGGGGGCTTGTTGTGCAGG + Intergenic
1190470102 X:50770131-50770153 GGGCAGGGGAGTTGCTGTGCTGG - Intronic
1191799935 X:65067091-65067113 GTCAAGTGGTCTTGCTGAGCAGG - Intergenic
1197819266 X:130529326-130529348 GGGCAGTGGCCCTGCTGGGCAGG + Intergenic
1198812072 X:140546234-140546256 GGCCATTGGGTTTCCTGTGCTGG + Intergenic