ID: 1173526025

View in Genome Browser
Species Human (GRCh38)
Location 20:43733340-43733362
Sequence CCAGTCTGTAGTATTTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173526021_1173526025 16 Left 1173526021 20:43733301-43733323 CCAGAACTGTGAGAAAGAAATTT 0: 26
1: 1052
2: 3008
3: 5027
4: 6997
Right 1173526025 20:43733340-43733362 CCAGTCTGTAGTATTTCCTTAGG No data
1173526020_1173526025 19 Left 1173526020 20:43733298-43733320 CCTCCAGAACTGTGAGAAAGAAA 0: 35
1: 1275
2: 3837
3: 6472
4: 8541
Right 1173526025 20:43733340-43733362 CCAGTCTGTAGTATTTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173526025 Original CRISPR CCAGTCTGTAGTATTTCCTT AGG Intergenic
No off target data available for this crispr