ID: 1173526737

View in Genome Browser
Species Human (GRCh38)
Location 20:43738525-43738547
Sequence CTTTGGAAGGGTAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173526729_1173526737 -8 Left 1173526729 20:43738510-43738532 CCTATAATCCCAGCACTTTGGAA 0: 1158
1: 38766
2: 329426
3: 249898
4: 134520
Right 1173526737 20:43738525-43738547 CTTTGGAAGGGTAAGGTGGGTGG No data
1173526727_1173526737 11 Left 1173526727 20:43738491-43738513 CCTGGAGTGGTGGCTCATGCCTA 0: 59
1: 1969
2: 19810
3: 77239
4: 167693
Right 1173526737 20:43738525-43738547 CTTTGGAAGGGTAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173526737 Original CRISPR CTTTGGAAGGGTAAGGTGGG TGG Intergenic
No off target data available for this crispr