ID: 1173531515

View in Genome Browser
Species Human (GRCh38)
Location 20:43773115-43773137
Sequence CTCCCACAGTCCCCCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173531515_1173531519 -7 Left 1173531515 20:43773115-43773137 CCTGCCCTGGGGGACTGTGGGAG No data
Right 1173531519 20:43773131-43773153 GTGGGAGGAATTCAGCAGCAAGG No data
1173531515_1173531520 -4 Left 1173531515 20:43773115-43773137 CCTGCCCTGGGGGACTGTGGGAG No data
Right 1173531520 20:43773134-43773156 GGAGGAATTCAGCAGCAAGGAGG No data
1173531515_1173531521 -1 Left 1173531515 20:43773115-43773137 CCTGCCCTGGGGGACTGTGGGAG No data
Right 1173531521 20:43773137-43773159 GGAATTCAGCAGCAAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173531515 Original CRISPR CTCCCACAGTCCCCCAGGGC AGG (reversed) Intergenic
No off target data available for this crispr