ID: 1173537301

View in Genome Browser
Species Human (GRCh38)
Location 20:43825394-43825416
Sequence CTGTAGCCCTAGAGTTATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173537298_1173537301 8 Left 1173537298 20:43825363-43825385 CCTGCAGTGGTGTCAGTGGGACC No data
Right 1173537301 20:43825394-43825416 CTGTAGCCCTAGAGTTATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173537301 Original CRISPR CTGTAGCCCTAGAGTTATTA GGG Intergenic
No off target data available for this crispr