ID: 1173539684

View in Genome Browser
Species Human (GRCh38)
Location 20:43842268-43842290
Sequence CTGCAGACAGCAGGGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173539684_1173539695 19 Left 1173539684 20:43842268-43842290 CCATCTACCCCTGCTGTCTGCAG No data
Right 1173539695 20:43842310-43842332 CATACCTGGCCTTCCAGAAGAGG No data
1173539684_1173539691 5 Left 1173539684 20:43842268-43842290 CCATCTACCCCTGCTGTCTGCAG No data
Right 1173539691 20:43842296-43842318 CCCCGGCAAAGCTCCATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173539684 Original CRISPR CTGCAGACAGCAGGGGTAGA TGG (reversed) Intergenic
No off target data available for this crispr