ID: 1173545396

View in Genome Browser
Species Human (GRCh38)
Location 20:43893919-43893941
Sequence GTGAATTTGCTTTACGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173545396_1173545398 5 Left 1173545396 20:43893919-43893941 CCTTCCACGTAAAGCAAATTCAC No data
Right 1173545398 20:43893947-43893969 AATTACCCTTTTACCCAAGCTGG No data
1173545396_1173545401 16 Left 1173545396 20:43893919-43893941 CCTTCCACGTAAAGCAAATTCAC No data
Right 1173545401 20:43893958-43893980 TACCCAAGCTGGATTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173545396 Original CRISPR GTGAATTTGCTTTACGTGGA AGG (reversed) Intergenic
No off target data available for this crispr