ID: 1173549483

View in Genome Browser
Species Human (GRCh38)
Location 20:43922754-43922776
Sequence CAGGATGAGCAACCTGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173549477_1173549483 26 Left 1173549477 20:43922705-43922727 CCTGATATTTAAAACTTGCTGCC 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1173549483 20:43922754-43922776 CAGGATGAGCAACCTGATTGTGG 0: 1
1: 0
2: 0
3: 10
4: 123
1173549476_1173549483 27 Left 1173549476 20:43922704-43922726 CCCTGATATTTAAAACTTGCTGC 0: 1
1: 0
2: 0
3: 19
4: 242
Right 1173549483 20:43922754-43922776 CAGGATGAGCAACCTGATTGTGG 0: 1
1: 0
2: 0
3: 10
4: 123
1173549479_1173549483 5 Left 1173549479 20:43922726-43922748 CCGTACAGTTGCTAATTCTGGTG 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1173549483 20:43922754-43922776 CAGGATGAGCAACCTGATTGTGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173549483 Original CRISPR CAGGATGAGCAACCTGATTG TGG Intronic
902581759 1:17412175-17412197 CAGGAAGAGCAGCATCATTGTGG - Exonic
909870361 1:80731130-80731152 TAGGAAGAGCAAAGTGATTGTGG + Intergenic
910080209 1:83332885-83332907 CAAGATGAGCAGGCTGAGTGAGG - Intergenic
915304607 1:154970316-154970338 CCGGATGAGCAACCTGAGGCTGG - Exonic
1063094635 10:2898811-2898833 CAGGCTGAGAAACCTCACTGTGG - Intergenic
1064739407 10:18416853-18416875 ATGGATGAGCAAACTGATGGTGG + Intronic
1064804719 10:19117724-19117746 CATTATGAGAAACCAGATTGTGG + Intronic
1069218381 10:65851758-65851780 CAGAATGAGCAACATGCTTTTGG - Intergenic
1074200271 10:111228358-111228380 CAGAATGAGGAACTTGTTTGGGG + Intergenic
1079970418 11:27029710-27029732 CAGGATGAGCATACAAATTGAGG + Intergenic
1082006181 11:47420377-47420399 CAGGATGTCCACCCTGTTTGTGG + Exonic
1083414184 11:62514688-62514710 CAGGATGCTTAACCTGCTTGAGG - Intronic
1088941120 11:114457333-114457355 CAGGATAAGAAACATGATTTTGG + Intergenic
1090626060 11:128609947-128609969 CAGGAAGAGCATCCTGAGTGAGG + Intergenic
1090837862 11:130466459-130466481 CAGGTTGAGCAACCAGAATGTGG - Intronic
1092100411 12:5878917-5878939 CATGATTAGCAATCTGCTTGAGG - Intronic
1097141752 12:56908350-56908372 CAGGATGAGTCACCTGCTGGTGG + Intergenic
1097328021 12:58301441-58301463 CAGGATGGGCAGACTGCTTGAGG + Intergenic
1099200999 12:79676757-79676779 GAGAATTAGTAACCTGATTGGGG - Intronic
1101751992 12:107589548-107589570 CAGGATGTGCAACCAGAGAGGGG + Intronic
1102816760 12:115872210-115872232 CAGGATGATCAGCATGATTTGGG + Intergenic
1106075731 13:26459379-26459401 CAGGATGAGCAATGAGAGTGTGG - Intergenic
1106741931 13:32653545-32653567 GAGGATGTGCAACCTGTTTTGGG + Intronic
1109169976 13:59083156-59083178 CAGGATCAACAACCTGAGTTTGG - Intergenic
1110408060 13:75172911-75172933 CAGGATAAGTAACCTCATTAAGG - Intergenic
1110419260 13:75287013-75287035 TAGTATGAGCTACCTGTTTGGGG + Exonic
1111050010 13:82870530-82870552 CAGTATGAGCAAAATTATTGAGG + Intergenic
1111910015 13:94300798-94300820 CAGGATAAGCCAACTTATTGTGG - Intronic
1120128251 14:80772774-80772796 CAGGATGTGCAACAGGGTTGTGG - Intronic
1121284701 14:92726206-92726228 CAGGCTGGGCAACAAGATTGAGG + Intronic
1122902990 14:104789431-104789453 CAAGGTGAGCAAGCTGTTTGGGG + Intronic
1124920682 15:34023227-34023249 CTGGAGTAGCAACCTGAGTGGGG - Intronic
1124925273 15:34064367-34064389 GAGGATGAGCAAGCTGATTCTGG + Exonic
1126842446 15:52730445-52730467 CAGGAAGAGAAACCAGATTTGGG - Intergenic
1130664637 15:85859547-85859569 CAGGATGAGGAATCGGGTTGGGG - Intergenic
1130829524 15:87585108-87585130 CAGGAGGAGCAAATTGATTTGGG - Intergenic
1131190016 15:90307229-90307251 CATGTTGAACAATCTGATTGAGG + Intronic
1131574960 15:93579401-93579423 CACAATGAGCAAACAGATTGGGG + Intergenic
1132404935 15:101536382-101536404 CAGAGTGAGCAAGCTGCTTGGGG - Intergenic
1137874314 16:51981154-51981176 CATGATTAGCAACTTGACTGTGG + Intergenic
1139671242 16:68493464-68493486 AAGGGTGAGAAACCTGAGTGTGG + Intergenic
1139707257 16:68749761-68749783 CAGGATGAGAGACCTGGTTTTGG - Intronic
1142191413 16:88719941-88719963 CAGGATGTTCAACCAGAATGTGG - Exonic
1143201786 17:5118333-5118355 CAGCATGAGCAAGCTCTTTGCGG + Intronic
1146765866 17:35520959-35520981 CAGGCTGGCCATCCTGATTGGGG - Intronic
1150289506 17:63973288-63973310 CAGGATGAGGGGCCTGGTTGGGG + Intergenic
1152250714 17:79211262-79211284 CAAAATGAGCATCCTGATTCAGG - Intronic
1158420469 18:57288603-57288625 AAGGATCAGCAACCTGGTGGTGG - Intergenic
1162064509 19:8117002-8117024 CAGGGTGAGCAGCCTGCCTGGGG + Intronic
1163641234 19:18463269-18463291 GAGGAGGAGCAACCTGAGGGGGG + Intronic
1164829994 19:31313097-31313119 CAGGATGCCAAACCTGCTTGGGG + Intronic
1166746021 19:45142238-45142260 CAGGATGTGCAGCCTGTTGGGGG + Intronic
1166782471 19:45349676-45349698 CAGGGTGAGCAACGTGAGGGTGG + Intronic
1167721073 19:51181189-51181211 GAGGATGAGGAACGTGTTTGAGG + Intergenic
927146200 2:20168182-20168204 CAGGCTGAGCTGCCTGAATGGGG - Intergenic
927205724 2:20609153-20609175 CAGGATGAGCACCGTCCTTGGGG + Intronic
927670946 2:25068479-25068501 CAGGATGAGCATAATGAATGAGG - Intronic
935110745 2:100092201-100092223 GAGGAAGAGCAAGCTGAGTGGGG - Intronic
936124226 2:109772961-109772983 GAGGAAGAGCAAGCTGAGTGGGG + Intergenic
936220462 2:110598503-110598525 GAGGAAGAGCAAGCTGAGTGGGG - Intergenic
936744572 2:115559691-115559713 AATTATGTGCAACCTGATTGAGG + Intronic
936885974 2:117310346-117310368 CAGGATGTGCAACAGGAGTGTGG + Intergenic
938230298 2:129653339-129653361 CAGGATGAGTACCCAGATGGAGG + Intergenic
940780058 2:157923948-157923970 TAGGAAGAGTAACCTTATTGTGG + Intronic
944385715 2:199161977-199161999 CAAGATAAGCTACCTGACTGAGG - Intergenic
947563705 2:231179969-231179991 CAGGATTAGAAGCCTGATGGAGG + Intergenic
948861916 2:240756876-240756898 CAGGACGGGCATCCTGCTTGGGG + Intronic
1173549483 20:43922754-43922776 CAGGATGAGCAACCTGATTGTGG + Intronic
1175824476 20:61929618-61929640 CAGGATGCGCAAGCTGAGTTGGG - Exonic
1179768556 21:43595026-43595048 CAGGGTGGGCAAACTGCTTGAGG + Intronic
1179898595 21:44377308-44377330 CAGGTTGTGCCACCTGCTTGGGG + Intronic
1184417264 22:44359572-44359594 CAGGATGAGCACCCTGGATGAGG + Intergenic
952845904 3:37688012-37688034 CAGGATGAGGAAGCTGCTGGAGG + Intronic
955623473 3:60891347-60891369 CAGGGTGATCAACCTGATCTGGG - Intronic
955650160 3:61185458-61185480 CAGGAAGAGCAGTGTGATTGTGG - Intronic
957332277 3:78780587-78780609 CAGGGTGAGCAAACAAATTGAGG - Intronic
960270861 3:115672908-115672930 CAGGATGAGCTACATGCGTGTGG + Intronic
964706210 3:159621538-159621560 AAGGATTAGCAGCCTCATTGGGG - Intronic
968218458 3:196914929-196914951 GAGGAAGAGCAAAATGATTGTGG + Intronic
970560669 4:17278998-17279020 GAGGTTCAGCAACCTGCTTGAGG - Intergenic
972203163 4:36739981-36740003 AAAGATGAGCAAACTGATTTTGG - Intergenic
972722318 4:41712543-41712565 AAGTATGAGTAACCTGAATGAGG + Intergenic
975025927 4:69549091-69549113 CAGCATGAGCAAACTGTGTGCGG - Intergenic
976635161 4:87279896-87279918 CAGGATCAGCTACCTAATTTGGG + Intergenic
979567181 4:122167531-122167553 CAGGAGAAGCAACCAGATTAAGG - Intronic
984752804 4:183295297-183295319 CAAGATGAGCAGCTTGAATGAGG - Intronic
986519787 5:8602457-8602479 CAGGATGAGCAACATCATGGAGG + Intergenic
987287696 5:16474992-16475014 CCTGATGAGCAACCTGGCTGGGG - Exonic
987918283 5:24245013-24245035 CAGGAAGAGCAAGAAGATTGAGG + Intergenic
995832840 5:116372853-116372875 GAGGATGAGCTGCCTGCTTGTGG + Intronic
997330825 5:133060032-133060054 GAGGAGAAGCAAACTGATTGTGG + Intronic
998678218 5:144434408-144434430 CAGTATGAGGATCCTGAATGAGG + Intronic
999430926 5:151524783-151524805 CAGGAAGAGCAACATGAGTTGGG - Intronic
1002706035 5:181161191-181161213 CAGGACGAGCATCGTCATTGGGG + Intergenic
1002706044 5:181161221-181161243 CAGGACGAGCATCGTCATTGGGG + Intergenic
1002761537 6:206119-206141 CAGGATGCCCCACCTGCTTGGGG - Intergenic
1002939962 6:1707499-1707521 CAGGGTGAGCAACCAGATGGAGG + Intronic
1004492187 6:16128035-16128057 TAGAATGAGCAACCTGAGAGAGG + Intergenic
1005824386 6:29623889-29623911 TAGGATGTGGAACCTCATTGTGG - Exonic
1006680963 6:35796454-35796476 GAGGGTGAGCAACCTGCCTGAGG - Intronic
1010024848 6:71203300-71203322 CAGGATGAGCGACCTCATCAAGG - Intergenic
1011977797 6:93327666-93327688 CAAGATGAGCACACTGAATGTGG - Intronic
1014154861 6:118098889-118098911 CAGGAAGAGACACCTGAATGGGG - Intronic
1016870769 6:148814205-148814227 CAGGAGGAGCCACCTGTATGAGG + Intronic
1018066909 6:160131028-160131050 CAGGATGAGGAGGCTGATAGGGG + Intronic
1019012987 6:168857517-168857539 CATGATGATCAACATGGTTGAGG - Intergenic
1021157260 7:17226020-17226042 CAGGAAGAGCTACCTGATAGTGG - Intergenic
1021296557 7:18914939-18914961 CAGAATGAGAAACATGATTTTGG + Intronic
1021674644 7:23067943-23067965 CAGGATGAATAGCCTGACTGGGG + Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1028368854 7:90068140-90068162 CAGAATGAGCAAATTGATGGGGG - Intergenic
1028394258 7:90349771-90349793 CAGCATTAACAACCTGATTTGGG + Intronic
1030859465 7:114606618-114606640 CAGAAACAGCAACCTGATTGGGG + Intronic
1034496367 7:151425457-151425479 CAGGAGGACCTACCTGTTTGAGG + Intergenic
1037097158 8:14999853-14999875 CAGGATGAGCATCCTGTTTTAGG + Intronic
1038053854 8:23839134-23839156 CAGGAGGAGCTAGATGATTGCGG + Intergenic
1038452880 8:27651167-27651189 CAGGATGAGCAGCCAGCCTGAGG - Intronic
1043263298 8:78228713-78228735 CAGGATGAACATCCAGATTCTGG + Intergenic
1046997714 8:120542967-120542989 CATGAGGAGCACCCTGAGTGCGG + Intronic
1047694796 8:127392857-127392879 CAGGATGAGCAAACCCATGGAGG + Intergenic
1048027258 8:130598053-130598075 CAAGATGTGCAGACTGATTGGGG - Intergenic
1048468034 8:134683745-134683767 CAGGATGGGCCTCCTGCTTGCGG - Intronic
1060039192 9:120285094-120285116 CAAGATGAGCAACCTGAGAATGG + Intergenic
1061216632 9:129225459-129225481 CAGGGTGAGCACTCTGCTTGTGG - Intergenic
1186237649 X:7530887-7530909 CAGAATGAGTCACCTGAGTGTGG - Intergenic
1191740547 X:64432589-64432611 CTGGATGAGCAACCTGAGGCTGG + Intergenic
1195239775 X:102939496-102939518 CAGGTTAAGCAACCTGGCTGGGG + Intergenic
1195297933 X:103498553-103498575 CAGGTTAAGCAACCTGGCTGGGG - Intergenic
1196728813 X:118921560-118921582 CAGCATTGACAACCTGATTGGGG - Intergenic
1199515958 X:148675704-148675726 CAGGATGTTCATCCTGAGTGGGG + Intronic
1200907098 Y:8494813-8494835 CAGGATGATCAAGCTTATTGTGG + Intergenic
1202259896 Y:22959338-22959360 CATGATGATCAAGCTTATTGTGG + Intergenic
1202412882 Y:24593082-24593104 CATGATGATCAAGCTTATTGTGG + Intergenic
1202457899 Y:25076988-25077010 CATGATGATCAAGCTTATTGTGG - Intergenic