ID: 1173549815

View in Genome Browser
Species Human (GRCh38)
Location 20:43924863-43924885
Sequence CTGTGTGTGGAGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1047
Summary {0: 1, 1: 0, 2: 11, 3: 92, 4: 943}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173549815_1173549821 -9 Left 1173549815 20:43924863-43924885 CCCTCTCCCTTCTCCACACACAG 0: 1
1: 0
2: 11
3: 92
4: 943
Right 1173549821 20:43924877-43924899 CACACACAGCCCTGTGTCCCGGG 0: 1
1: 1
2: 3
3: 55
4: 454
1173549815_1173549829 13 Left 1173549815 20:43924863-43924885 CCCTCTCCCTTCTCCACACACAG 0: 1
1: 0
2: 11
3: 92
4: 943
Right 1173549829 20:43924899-43924921 GGTGTCCACTGAAAAGGGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 199
1173549815_1173549825 7 Left 1173549815 20:43924863-43924885 CCCTCTCCCTTCTCCACACACAG 0: 1
1: 0
2: 11
3: 92
4: 943
Right 1173549825 20:43924893-43924915 TCCCGGGGTGTCCACTGAAAAGG 0: 1
1: 0
2: 0
3: 2
4: 89
1173549815_1173549820 -10 Left 1173549815 20:43924863-43924885 CCCTCTCCCTTCTCCACACACAG 0: 1
1: 0
2: 11
3: 92
4: 943
Right 1173549820 20:43924876-43924898 CCACACACAGCCCTGTGTCCCGG 0: 1
1: 0
2: 2
3: 49
4: 400
1173549815_1173549822 -8 Left 1173549815 20:43924863-43924885 CCCTCTCCCTTCTCCACACACAG 0: 1
1: 0
2: 11
3: 92
4: 943
Right 1173549822 20:43924878-43924900 ACACACAGCCCTGTGTCCCGGGG 0: 1
1: 0
2: 4
3: 33
4: 233
1173549815_1173549827 8 Left 1173549815 20:43924863-43924885 CCCTCTCCCTTCTCCACACACAG 0: 1
1: 0
2: 11
3: 92
4: 943
Right 1173549827 20:43924894-43924916 CCCGGGGTGTCCACTGAAAAGGG 0: 1
1: 0
2: 0
3: 1
4: 71
1173549815_1173549831 17 Left 1173549815 20:43924863-43924885 CCCTCTCCCTTCTCCACACACAG 0: 1
1: 0
2: 11
3: 92
4: 943
Right 1173549831 20:43924903-43924925 TCCACTGAAAAGGGAGTGGAGGG 0: 1
1: 0
2: 2
3: 15
4: 271
1173549815_1173549830 16 Left 1173549815 20:43924863-43924885 CCCTCTCCCTTCTCCACACACAG 0: 1
1: 0
2: 11
3: 92
4: 943
Right 1173549830 20:43924902-43924924 GTCCACTGAAAAGGGAGTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173549815 Original CRISPR CTGTGTGTGGAGAAGGGAGA GGG (reversed) Intronic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
900736756 1:4304036-4304058 CAGGTTGTGGAGAAGGGAGCGGG - Intergenic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900978580 1:6033507-6033529 ATGTGTGTGGAGAGAGGAAAAGG + Intronic
901034152 1:6326223-6326245 CCATGTGTGCAGTAGGGAGAGGG + Intronic
901436545 1:9250406-9250428 GTGTGTGTGGGGTAGGGAGTGGG - Intronic
901860765 1:12072949-12072971 CTATGTGTGGGGAAGGGGCAGGG - Intronic
901971861 1:12914536-12914558 CTGTGAGTGGAGAAGGGGTCAGG + Intronic
902013307 1:13287204-13287226 CTGTGAGTGGAGAAGGGGTCAGG - Intergenic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
903406586 1:23102396-23102418 CTGTGTTGGGAGAAGGGGCAGGG - Intronic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903756127 1:25662268-25662290 CTGAGAGTGGAGGAGGGAGATGG + Intronic
903783255 1:25836773-25836795 TTTTGTTTGGAGGAGGGAGAGGG + Intronic
903851839 1:26311931-26311953 ATGTGGGTGGAGAAGGGAGAAGG - Intronic
903925088 1:26826506-26826528 CTCTTTGTGCAGAAGGGAAAAGG + Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904205984 1:28855541-28855563 CTGTGGGTGGAGGGGAGAGAGGG + Intronic
904306164 1:29591805-29591827 CTTTGCGTGGTGAAGGGAGGTGG + Intergenic
904328353 1:29742015-29742037 CTGGGTGTGGAGAAGGGATGGGG + Intergenic
904370441 1:30044589-30044611 CTGGGAGTGGGGCAGGGAGACGG + Intergenic
904441656 1:30535722-30535744 GTGAGGGTGGGGAAGGGAGAGGG + Intergenic
904604583 1:31691643-31691665 CTGTGGGGGGATAAGGGGGAGGG + Intronic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
905036303 1:34920129-34920151 CTGTGAGAGGAGTAGAGAGAAGG - Intronic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905110151 1:35588832-35588854 CTGGGTCTGGGGAAGAGAGAGGG + Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905194803 1:36267600-36267622 CTTTGTGGGGAGAAGAAAGAGGG + Intronic
905291465 1:36924478-36924500 CTGGCTGTGGAGAGGGGAGGGGG + Intronic
905642206 1:39598210-39598232 CTGAGTGTGGAGGTGGGGGAGGG - Intergenic
905769866 1:40630600-40630622 CTCCTTGTGGGGAAGGGAGAAGG + Intronic
906097616 1:43234889-43234911 GGGTATGTGGAGAAGGGAGGTGG - Intronic
906123416 1:43410957-43410979 CTGGGTGGGGAGCAGGGTGAGGG + Intronic
906147578 1:43569130-43569152 GTGTGTGCGGACAGGGGAGAGGG + Intronic
906193591 1:43914792-43914814 CTGGGCCTGGAGAAGGGACAGGG + Intronic
906711004 1:47929991-47930013 ATGTATGTGGAGCAGGGAGGTGG - Intronic
907222190 1:52915087-52915109 CAGGGTGTGGGGAAGAGAGATGG + Intronic
908229211 1:62087183-62087205 CTGTCAGTGGAGAGGGGAGCTGG + Intronic
908250729 1:62263656-62263678 CTGTGTGAGGGGGAAGGAGAGGG - Intronic
909170056 1:72283063-72283085 CTGGGGATGGAGAAGGGAGGGGG + Intergenic
909587027 1:77301540-77301562 ATGTGTGGGAAGAAGGGAGCAGG - Intronic
909686196 1:78351819-78351841 CAGAGAGTGGAGAATGGAGACGG + Intronic
910434630 1:87192806-87192828 ATGTGTGTGGTGAAGGTTGATGG + Intergenic
911185027 1:94894595-94894617 CTGTTTTTGGGAAAGGGAGATGG - Intronic
911221298 1:95250248-95250270 CTGTGTGTGAAATGGGGAGAGGG + Intergenic
911370430 1:96988923-96988945 CTGTGGGTGGAGGAGGGAGGAGG + Intergenic
911549537 1:99262958-99262980 CTGTGTGTGGTGGGGGGTGAGGG + Intergenic
911596887 1:99808043-99808065 TAGTGTGTGGGGCAGGGAGAAGG + Intergenic
911725127 1:101235337-101235359 GTGTGGGTGGAGGCGGGAGAAGG + Intergenic
912075755 1:105873350-105873372 CTGGGTGTGGAGCAGAGAGTGGG + Intergenic
912727250 1:112069195-112069217 ATGTGTGTGGGGAAGTGAGGAGG - Intergenic
912801684 1:112723390-112723412 CTGTGTGTGCAACAGGCAGAGGG - Intronic
912891471 1:113536965-113536987 CTTTGTGTGGAGAATGTACAGGG - Intronic
913061542 1:115212982-115213004 TTGTGTATGGAAAATGGAGAAGG - Intergenic
913152432 1:116057907-116057929 TTGGGTGGGGAGAGGGGAGAAGG + Intronic
913212227 1:116591093-116591115 CTGCATTTGAAGAAGGGAGAAGG - Intronic
913370096 1:118089145-118089167 CTGTGTGTTGTGTGGGGAGAGGG + Intronic
914434927 1:147651504-147651526 GTGTGTGTTGATAAAGGAGAGGG + Intronic
914804876 1:150984418-150984440 GGGTGTCTGGGGAAGGGAGAAGG + Intronic
914810674 1:151025496-151025518 GTTCCTGTGGAGAAGGGAGATGG - Exonic
914895282 1:151665840-151665862 ATGTCTGTGGAGGAGGGAAAGGG - Intronic
915528455 1:156490148-156490170 CTGTGTGTGGGATGGGGAGAGGG - Intronic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
915687078 1:157644456-157644478 TTGTGTGTGGAGAGAGGTGATGG + Intergenic
916655411 1:166870981-166871003 CTGTGTGTGTTTAACGGAGAGGG + Intronic
916719550 1:167474026-167474048 CCGGGGGTGGTGAAGGGAGAGGG - Intronic
917499607 1:175574260-175574282 CAGGGTGGGGAGAAAGGAGAAGG - Intronic
918028478 1:180778509-180778531 CTGTGTTTGGAGCAGGTAGTGGG + Intronic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
918371186 1:183863125-183863147 GTGTGGGTGGAGCAGGGAGGAGG + Intronic
919600154 1:199612468-199612490 CTTGGTGGGGAGAAGGGAAAAGG - Intergenic
919645066 1:200087207-200087229 GTGTATGTGTTGAAGGGAGAGGG - Intronic
919743935 1:200996892-200996914 CTGTGTACTGAGATGGGAGAGGG - Intronic
919791333 1:201292690-201292712 CTGTCTGTGGGGAAGAGAGTTGG - Intronic
920034611 1:203057875-203057897 CTGTGTGTGGAGGAAGGGGTTGG + Intronic
920041286 1:203099306-203099328 CTGGGGGTGGGGTAGGGAGAGGG - Intronic
920059681 1:203218652-203218674 CTGGCTGGGGAGATGGGAGAAGG - Intronic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920740719 1:208578922-208578944 CAGTGTATGGAGATGGGAAATGG - Intergenic
920857308 1:209673842-209673864 TTGTGTGTGGAGAATGGTCAAGG - Intergenic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921446579 1:215254341-215254363 GTGTGTGTGGAGAGGGGATTGGG + Intergenic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922247727 1:223817193-223817215 CTGCATGTGGAGGAGGGGGAGGG + Intronic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
922317696 1:224457038-224457060 CTGGATGTGGCGAGGGGAGACGG + Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923051018 1:230391562-230391584 AGGTGTGAGGAGGAGGGAGAGGG - Intronic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
923386291 1:233468016-233468038 TTGTGTGTGGGGAAGGGATGGGG + Intergenic
923713570 1:236406195-236406217 CTGTGATAGGAGGAGGGAGAAGG + Intronic
923729336 1:236535638-236535660 TTGTGTGTAGAGAATGGGGAAGG - Intronic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1062944125 10:1447416-1447438 AGGTGTGGGGAGAAAGGAGATGG + Intronic
1063184176 10:3635433-3635455 CTGTCTGTGGAAGAGCGAGACGG + Intergenic
1063337370 10:5229066-5229088 ATGTGTGCTGAGAAGGGAGGTGG + Intergenic
1063374985 10:5548884-5548906 ATGTGTGTGGATAAGGGAGAGGG - Intergenic
1063649390 10:7918197-7918219 CTGGGAGTGGGGAAAGGAGAAGG + Intronic
1063962514 10:11318768-11318790 CTGTGTACAGAGAAGGGAGTTGG + Intronic
1064674564 10:17748266-17748288 ATGTGGCTGAAGAAGGGAGATGG + Intergenic
1064736008 10:18382532-18382554 TGGTGGGTGGGGAAGGGAGAAGG - Intronic
1064769403 10:18708415-18708437 CTTTGGGAGGATAAGGGAGACGG + Intergenic
1065927737 10:30450643-30450665 ATGTCTCTGGAGAAGGAAGACGG - Intronic
1066100905 10:32117616-32117638 CTGTGTGTGGCAGAGGGTGAAGG + Intergenic
1066360722 10:34727801-34727823 GTGTGTGTGGTGGAGGGAGGGGG - Intronic
1066360731 10:34727865-34727887 GTGTGTGTGGCGGAGGGAGGGGG - Intronic
1066408899 10:35146357-35146379 GTGTGTCTTGAGAAGGGTGAAGG - Intronic
1066479850 10:35785387-35785409 CTGTTTTTGGAGAAGGCAGCAGG - Intergenic
1066543030 10:36469758-36469780 CTATGTGTGCAGGAGGGAGAGGG - Intergenic
1067478920 10:46583135-46583157 CCCTCTGTGGAAAAGGGAGAAGG + Intronic
1067615818 10:47758666-47758688 CCCTCTGTGGAAAAGGGAGAAGG - Intergenic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1069241447 10:66145269-66145291 CTTTGTGTGGAGAAGGGCCTTGG - Intronic
1069445730 10:68471770-68471792 CTGTGAGCGGAGAGGGGGGAGGG - Exonic
1069649591 10:70035777-70035799 CAGTAGGTGGAGATGGGAGAAGG - Intergenic
1069707417 10:70467486-70467508 TCATGTGTGGAGAAGGGTGAAGG + Intergenic
1069709058 10:70477845-70477867 CCGAGTGTGGAGCAGCGAGAGGG + Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069783314 10:70970439-70970461 CTGAGTGGGGAGGAGGGAGTGGG + Intergenic
1070050768 10:72887396-72887418 CTGGGGGTGGTGGAGGGAGAAGG - Exonic
1070855999 10:79608455-79608477 CTGGGAGTGGTGAAGAGAGATGG + Intergenic
1071215374 10:83394405-83394427 CTGTGTGCTGGGAAGAGAGAGGG - Intergenic
1071474939 10:86017990-86018012 CTGTGTGAGGAGGAGGGACGTGG - Intronic
1071600016 10:86954458-86954480 TGGTGTGGGGGGAAGGGAGAGGG + Intronic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1072058841 10:91788434-91788456 CTGTGCCTGGGGAAAGGAGAGGG + Intergenic
1072581182 10:96741281-96741303 GTGTGTGTGGACAGGGGAAATGG - Intergenic
1072850690 10:98888649-98888671 CAGTTTGGGGAGAAAGGAGACGG - Intronic
1073044174 10:100626474-100626496 CTGTGTGTGGCTGAGTGAGAAGG + Intergenic
1073241050 10:102058423-102058445 TCGTGTGTGGAGACGAGAGATGG - Intergenic
1073269182 10:102247288-102247310 GTGTGTTGGGAGAAGGGGGATGG + Intronic
1073333368 10:102686002-102686024 CTGGATTTTGAGAAGGGAGAGGG + Intronic
1073347514 10:102794991-102795013 CTGTATTTAGAGGAGGGAGAAGG + Intronic
1073420366 10:103419458-103419480 TTCTCTGTGGAGAAAGGAGATGG + Intronic
1073434118 10:103505951-103505973 CTGTGTGGGGACAGGGGAGGAGG + Intronic
1073449252 10:103600062-103600084 CTGGGTGGGGAGCAGGGTGAGGG + Exonic
1073513879 10:104060315-104060337 ATGTGCCAGGAGAAGGGAGAGGG + Intronic
1073711905 10:106052856-106052878 CCATGTGTGGAGAAGTGAGGTGG + Intergenic
1073789203 10:106922602-106922624 CTGTGTGTGTACAAGGGAGGGGG - Intronic
1074116014 10:110458000-110458022 CTGGGTGTGGAGTGGGGAGAGGG + Intergenic
1074132653 10:110595307-110595329 CTGGGTGGGGAGAAGGGAGCAGG - Intronic
1074842048 10:117364077-117364099 TTGTGTGTGGGAATGGGAGAAGG + Intronic
1075256865 10:120932281-120932303 CTGTGTGTTCAGATGGGAGCTGG - Intergenic
1075413738 10:122247747-122247769 CAGTGGGGGTAGAAGGGAGACGG + Intronic
1075744655 10:124718397-124718419 ATGTGGGGGTAGAAGGGAGAAGG - Intronic
1075863312 10:125696322-125696344 ATGTGGGTGGGGAAAGGAGAGGG + Intergenic
1075990953 10:126838204-126838226 GGGTGTCTGGAGAAGGGAGGTGG - Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076229587 10:128808985-128809007 CAGTGGGTGGAGCAGGGGGAAGG - Intergenic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1076819216 10:132930474-132930496 CTGTGTGGGGAGTATGGGGAAGG - Intronic
1076822658 10:132947143-132947165 CGGTGTCTGCAGAAGGCAGAGGG - Intergenic
1076984203 11:223624-223646 ACGTGTGAGGAGAAGGGAGAAGG - Intronic
1077032742 11:477015-477037 CTGGGTGGGGGGCAGGGAGAAGG + Intronic
1077287112 11:1772606-1772628 CTGGGTGTGGAGCAGGGAAGTGG + Intergenic
1077421394 11:2451757-2451779 CTGTGAGTGGAGGAGCGAAATGG - Intronic
1077789762 11:5425521-5425543 GTGTGTGTGGCGAGGGGAGGAGG + Intronic
1078452228 11:11448999-11449021 CTGTTTGTGAGGAAGGGAAAGGG - Intronic
1078662018 11:13295421-13295443 CTGTTTGTCGAGAAGTGGGAGGG + Intronic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1078856323 11:15208687-15208709 CTGAGTTTGGAGAAGGGATGGGG + Intronic
1079080658 11:17411512-17411534 GTGCGTGTGGTGTAGGGAGAGGG + Intronic
1079410168 11:20180087-20180109 GTGTGTCTGGAGCAGAGAGAGGG - Intergenic
1079668187 11:23134398-23134420 CTGTTTGTGGGGCACGGAGAAGG - Intergenic
1080552161 11:33382122-33382144 GTGAGTATGGAGAAGAGAGAGGG + Intergenic
1081038176 11:38176698-38176720 CTCTCAGTGGAGAGGGGAGATGG - Intergenic
1081365424 11:42229504-42229526 CTTGGTGTGGAGAGTGGAGATGG + Intergenic
1081376172 11:42361185-42361207 TTGTGTGTGTATAAGGGAGGTGG + Intergenic
1081977496 11:47244954-47244976 GTGTGTGTGAGGGAGGGAGAGGG + Intronic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1082901279 11:58255971-58255993 CTGTGTCTGCAGCAGTGAGAGGG + Intergenic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083260773 11:61521694-61521716 CTGTGTGGGGGAAAGGGAAAGGG - Intronic
1083325811 11:61872474-61872496 ATGTGTGTGGAGTAGGGGGCGGG + Intergenic
1083691151 11:64409662-64409684 TTGTGAGTGGGGAAGGGAGTGGG + Intergenic
1083720723 11:64602270-64602292 CTGTGTGGGGAGCTGGGACATGG - Exonic
1083788898 11:64971503-64971525 CTGGGTGTGGAGTGGGGAAAGGG + Intronic
1083944275 11:65915475-65915497 CTGGCTGTGGAGAACGGAGCGGG + Intergenic
1084333877 11:68445974-68445996 CTGTGTGTGATGGAGGGAGGAGG + Intronic
1085034940 11:73293965-73293987 CTGTGTGAGGAGAGGGGTCAGGG + Intronic
1085124736 11:73992144-73992166 CTGAGTATGGAGAAGGCAAAAGG - Intergenic
1085514067 11:77102288-77102310 TTGGGTGTGGAGGAGTGAGAGGG + Intronic
1085519095 11:77127769-77127791 GTGGGTGTGCAGGAGGGAGAAGG + Intergenic
1085729190 11:78982110-78982132 CTGCTTGTGGGGCAGGGAGAGGG + Intronic
1085881431 11:80471667-80471689 GTGTGTGTGGAGATGGGGGGGGG + Intergenic
1085996012 11:81914928-81914950 CTGATTGTGTAGAAGGGATACGG - Intergenic
1086002116 11:81996445-81996467 CTCTCAGTGGAGAAGGGAGCTGG + Intergenic
1086005625 11:82031921-82031943 CTAAGTATTGAGAAGGGAGAAGG + Intergenic
1086229200 11:84548190-84548212 CTGGCAGTGGAGAAGGAAGAAGG - Intronic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086902874 11:92387399-92387421 CTGTGTGTGTTGCAGGGTGAAGG + Intronic
1086973967 11:93112594-93112616 ATGTGAGTGGAAAAAGGAGATGG + Intergenic
1087080415 11:94165736-94165758 TTGTATGTGTAGAAGGGACAGGG - Intronic
1087313974 11:96584706-96584728 ATGTGTGTGGAGAGGGGATGAGG + Intergenic
1087478561 11:98669560-98669582 GTGTGTGTGTTGGAGGGAGAAGG - Intergenic
1087602975 11:100339346-100339368 CTCTCAGTGGAGAAGGGAGCTGG + Intronic
1087831359 11:102822957-102822979 CTGTGGGTGGAGCAGGGAGTTGG - Intergenic
1087917050 11:103823171-103823193 CTGGGAGTAGAGAAGGTAGAAGG + Intergenic
1088218131 11:107536771-107536793 CTTTTTGTGGAGGAGGGAGTTGG - Intronic
1088766286 11:112982559-112982581 CTGTGTGAGGTGATGGGAGGTGG + Intronic
1088809260 11:113379294-113379316 CTGGGGGTGGAGAAGGGAGGGGG - Intronic
1089199409 11:116714790-116714812 CTGAGTGTGGAGAGGGGGAAAGG + Intergenic
1089201869 11:116729533-116729555 CTGGGGGTGGAGCAGGGAGATGG + Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089310706 11:117556456-117556478 CTGTGAGTCGAGAAAGGAAAGGG - Intronic
1089729231 11:120510491-120510513 CAGTGTGTGGAGCTGGGGGAGGG + Intergenic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1090034231 11:123234528-123234550 CTGTGTGTGGTTATGGGGGATGG - Intergenic
1090078038 11:123591697-123591719 TTGGGGGTGGAGGAGGGAGAGGG + Intronic
1090379689 11:126317773-126317795 CTGTGTGTGGAGAAGTGGGGGGG + Intronic
1090827085 11:130395266-130395288 ACGTGTGTGGAGAAGAGATAGGG - Intergenic
1090849822 11:130562263-130562285 CTTGGTGTGGAGATGGGAGGGGG + Intergenic
1091002242 11:131919421-131919443 ATGTGTGAGCTGAAGGGAGAAGG + Intronic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1091693626 12:2613265-2613287 CCCTCTGTGGAGAAGGGGGAAGG + Intronic
1091822864 12:3489749-3489771 CTGTGTTCTGAGAAGGGAAAAGG + Intronic
1091929905 12:4387384-4387406 TTGTGTGCAGAGTAGGGAGAAGG + Intergenic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092252981 12:6911506-6911528 GTGTGTGTGGAGGGGGGTGAGGG + Intronic
1092547973 12:9468005-9468027 GTGTGTGTGAAAAAGAGAGATGG - Intergenic
1092547986 12:9468091-9468113 GTGTGTGTGAAAAAGAGAGATGG - Intergenic
1093880650 12:24400731-24400753 GTGTGTGTGGAGCATGGAGGGGG - Intergenic
1094087605 12:26610931-26610953 CTGTGCGGGGAGATGGGAGGAGG - Intronic
1094505014 12:31054361-31054383 GTGTGTGTGAAAAAGAGAGATGG + Intergenic
1096526483 12:52213078-52213100 CTGGGTCTGGAGAAGGGAGGAGG + Intergenic
1096553569 12:52389929-52389951 CTATCTGTGGAGCAGGGAGGAGG + Intergenic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097701561 12:62825733-62825755 CGGAGTGTGGAGCAGGGGGAGGG + Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098352795 12:69581747-69581769 CTGTTTGGGTAGTAGGGAGAAGG - Intergenic
1098416925 12:70244127-70244149 CTGTGCATGGTGGAGGGAGAAGG + Intronic
1098998862 12:77153064-77153086 CAGTGTATGGGGGAGGGAGAAGG + Intergenic
1099899736 12:88693086-88693108 TCGTGTGTGCAGAAGGGGGAGGG + Intergenic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1101040679 12:100752359-100752381 GTGTGTGTGTAAGAGGGAGAGGG - Intronic
1101658730 12:106747544-106747566 CTGTGTGTGACGGAGGAAGAAGG - Exonic
1102290141 12:111692674-111692696 CTGTGTGGGAAGAAGGCACAGGG - Intronic
1102394218 12:112574099-112574121 GGGGGTGTGGAGGAGGGAGAGGG + Intronic
1102485648 12:113253785-113253807 CTGTGTGTGGAGAAGCAGCAAGG + Intronic
1102840348 12:116113694-116113716 CAGTGAGTGGAGGAGGAAGAGGG + Intronic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1103791720 12:123476884-123476906 CTGTGTGTGGGGAACGAAGAAGG + Intronic
1104332036 12:127855937-127855959 CTGGGGGTGGAGAAGGGTGTAGG - Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105215474 13:18281716-18281738 CTGCATTTGAAGAAGGGAGAAGG - Intergenic
1105236502 13:18560262-18560284 CACTGTTTGGCGAAGGGAGAAGG - Intergenic
1105435897 13:20378161-20378183 CAGTGAGTGGGGAAGGGAGGAGG - Intergenic
1105667938 13:22581062-22581084 CTGTTGGCGGAGTAGGGAGAGGG - Intergenic
1106497472 13:30293711-30293733 CTGTGTAGGGAGAAGGGAACAGG - Intronic
1106758766 13:32847698-32847720 GCATGTGTGAAGAAGGGAGAGGG + Intergenic
1106930509 13:34658964-34658986 CTGTATGTGTAGAAGGGCAATGG - Intergenic
1106962501 13:35015093-35015115 CTTTTTGTTGAGAAGGGAGGCGG - Intronic
1107029927 13:35840105-35840127 CTGTCTGTGGAGCAGAGAGAAGG + Intronic
1107054070 13:36084269-36084291 CTGTCTGGGGATAAGGGAAATGG - Intronic
1107860893 13:44660146-44660168 CTGTGTGTAGACATGGGAGAGGG + Intergenic
1108447800 13:50526847-50526869 CTGAGAGGGGAGAGGGGAGAGGG + Intronic
1108638139 13:52356620-52356642 CAGTCTCTGGAGTAGGGAGAGGG + Intergenic
1108699818 13:52933990-52934012 CCGCCTGTGGAGAACGGAGAGGG + Intergenic
1108732503 13:53249234-53249256 CTGTTTGTGGAGAAGGGGTTAGG - Intergenic
1108733539 13:53259061-53259083 CTGGGAGGGGAGAAAGGAGATGG + Intergenic
1109648764 13:65296676-65296698 CCGTGTATGGAGAGGAGAGATGG + Intergenic
1109881803 13:68487733-68487755 GTGTGTGTGGGAGAGGGAGAAGG + Intergenic
1110333993 13:74305054-74305076 ATGAGTGGGGAGAAGGGAGGAGG - Intergenic
1111112622 13:83734191-83734213 CTGTGGGTGGAGATTGGAGAAGG + Intergenic
1112388476 13:98961539-98961561 CTTTGTGGGGAGGAGGGAGGTGG - Intronic
1112587990 13:100736743-100736765 TGGTGTTTGGAAAAGGGAGAGGG - Intergenic
1112679350 13:101744388-101744410 CTGGATGTTGAGGAGGGAGATGG - Intronic
1113047532 13:106171745-106171767 CTGGGTGTGGTGGCGGGAGACGG + Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113404724 13:110027767-110027789 CTCTTTGTGGAGAGGAGAGAGGG + Intergenic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114666099 14:24377913-24377935 GAGTGTGTGGAGGAGGGAGGAGG + Exonic
1114866137 14:26597734-26597756 GAGAGAGTGGAGAAGGGAGAGGG + Exonic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115510026 14:34129788-34129810 CTATGGGTGGGGAAGGGAGGTGG + Intronic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1115960792 14:38835075-38835097 GTGTGTGTGGAGCAGGGCGGGGG - Intergenic
1115967127 14:38903051-38903073 ATGTGAGTGGTAAAGGGAGAGGG + Intergenic
1116133597 14:40891742-40891764 CTGTGTGTAGTGTAGGGACATGG - Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1117240349 14:53825974-53825996 CTGTCTCTGGGGCAGGGAGAGGG + Intergenic
1117574201 14:57081759-57081781 CTGTGTGTGGATGAAGGAGGAGG - Intergenic
1117712709 14:58548960-58548982 TTGTGTGTGGAGATGGGGGTGGG + Intronic
1118289954 14:64510603-64510625 ATGTGTGTGGAGGAGGGTGAAGG + Intronic
1118306792 14:64661759-64661781 CTGTGTGTGGAGGAGAAAGGGGG + Intergenic
1118349817 14:64965742-64965764 CTGTCTGGGGAGCGGGGAGAAGG + Intronic
1118769839 14:68935352-68935374 CTCTGACAGGAGAAGGGAGAGGG - Intronic
1118889310 14:69894651-69894673 CTGTGTGGTGAGAAGGGTGATGG + Intronic
1118925026 14:70184383-70184405 TTGAGTGTGGAGAAGGCATAGGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119689286 14:76658209-76658231 CTGTCTGTGGAGAGAGTAGAAGG + Intergenic
1120049518 14:79849040-79849062 CTGGGTGTGGGGAAGAGAGTTGG - Intronic
1120220241 14:81723469-81723491 TTGTGGGTGGAGGTGGGAGAGGG + Intergenic
1120945542 14:89992451-89992473 CTGTGGCTGGAGGAGGGTGAAGG - Intronic
1121234118 14:92379901-92379923 GTGAGGGTGGAGAGGGGAGAGGG - Intronic
1121638706 14:95471243-95471265 CTGGGTGTGGCCAAGGGAGATGG - Intronic
1121671677 14:95714711-95714733 TTGTGTATGGAAGAGGGAGAGGG - Intergenic
1122043633 14:99008179-99008201 CAATCTGTGGAGAAGAGAGAGGG - Intergenic
1122504340 14:102222183-102222205 CTGGGTGTGGAGAAGGGATGTGG - Intronic
1122537333 14:102474840-102474862 CTTTGTGTGGGGCAGGGGGAAGG - Intronic
1123039462 14:105484465-105484487 GTGTGGGTGGAGAAAGGAGCTGG + Intergenic
1123128757 14:105968800-105968822 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1123168637 14:106349844-106349866 CTCTGTATGGAGAAGTGAAAAGG + Intergenic
1123409283 15:20044963-20044985 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123518614 15:21051671-21051693 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123754801 15:23388879-23388901 GTGTGTGTGGAGGAGGAAGTGGG - Intergenic
1124247015 15:28079704-28079726 CTGAGTGTGGAGATGCCAGAAGG - Intronic
1125035029 15:35113374-35113396 GTGTGTGTGTAGGAGGGAGGTGG + Intergenic
1125205284 15:37147455-37147477 CTGTGGGTGGAGAAGTAAAAAGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125451714 15:39815180-39815202 CTGTGTGTAGAGGAGACAGAAGG + Intronic
1125692098 15:41604161-41604183 CTGAGTGGGGAGGAGGGAAATGG + Intergenic
1125888967 15:43251656-43251678 CTGGGTGTGGGGCAGGGTGAGGG + Intronic
1126437068 15:48646574-48646596 CTGTGTGTGGGGGAGGGCGAGGG - Intergenic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1128528180 15:68426457-68426479 CTGGGTGGGGAGAGGGGAGAGGG + Intronic
1128582359 15:68818826-68818848 CTGGGTGTGGTGATGGGGGAGGG - Intronic
1128846186 15:70897929-70897951 ATGTGTGTGTAGAAGGGAAGAGG + Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129081953 15:73049096-73049118 TTGTGTGTGGGGGTGGGAGAAGG - Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129712365 15:77826794-77826816 CTGTCTGTGGAATGGGGAGAGGG - Intergenic
1129714567 15:77839690-77839712 ATCTGTGTGGAGATGGGAGAAGG - Intergenic
1129785853 15:78309580-78309602 CTATGTGTGGAGAGGGGACAGGG + Intergenic
1130079721 15:80721940-80721962 CTTTGTGTTGGGAAGGGAGTTGG + Intronic
1130130906 15:81142066-81142088 ACGTGGGTGGGGAAGGGAGATGG - Intronic
1130157915 15:81369258-81369280 CTGTCTGTGGATAAAGGAGTTGG - Intronic
1130328548 15:82901485-82901507 ATATGTGTGGAGGTGGGAGAGGG - Intronic
1130346274 15:83048608-83048630 CTGTGTTTGGATAGTGGAGAGGG - Intronic
1130575091 15:85085034-85085056 GTCTGTGTGGAGAATGAAGAAGG - Intronic
1130680671 15:85993462-85993484 GGGGGTGTGGGGAAGGGAGAGGG + Intergenic
1130971866 15:88739937-88739959 CTGTGTGTGGCTAGTGGAGAAGG + Intergenic
1131353003 15:91718590-91718612 GAGTGTGTGTTGAAGGGAGAAGG + Intergenic
1131461336 15:92619667-92619689 CTGTGTGGGGAGCTGGGGGAGGG - Intronic
1131671354 15:94623061-94623083 CTGTTTGTGTAGAATGGAGGAGG + Intergenic
1132332527 15:101022654-101022676 CTCTCTGGGGAGAAGGGAGAAGG - Intronic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132482907 16:175508-175530 CTGTGGTTGGAGAATGGAGGTGG - Intergenic
1132499624 16:279755-279777 CTGCGTCTGGATAAGGGAGAAGG - Intronic
1134049911 16:11130291-11130313 CCGTGTTCAGAGAAGGGAGAAGG - Intronic
1134461568 16:14434101-14434123 GTGTGTGTGGAGGAGGAAGTGGG + Intergenic
1134841257 16:17403820-17403842 TTGTGTCTGGAGAAGAGACAAGG - Intronic
1135098129 16:19581504-19581526 CCCTGTGGGGAGAAGGCAGAAGG - Exonic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135776081 16:25258184-25258206 CTGTGTCTGGCGGAGGGACACGG + Intergenic
1136107415 16:28040103-28040125 ATGGGTGTGGAGAAGGGTGACGG - Intronic
1136136597 16:28260098-28260120 GTGTGTGTGTAAAAGAGAGAGGG + Intergenic
1136186541 16:28591819-28591841 CCCTGTTTGGAGAGGGGAGAGGG - Intergenic
1136254746 16:29030419-29030441 CTGTGTGGGCAGGAGAGAGATGG - Intergenic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136871525 16:33812073-33812095 CTGTGTTTGGAGAAAGGGGTGGG - Intergenic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137733674 16:50708733-50708755 CTGTGTGTGGTGCTGGCAGATGG + Intronic
1137961146 16:52883413-52883435 CTGTGTGTGGCCCAGGGTGAAGG - Intergenic
1138025366 16:53518065-53518087 GTGTGTGGGGAGGAGAGAGAGGG + Intergenic
1138102611 16:54265951-54265973 CTGTGTGGGGACATGGGGGAAGG - Intronic
1138221079 16:55250854-55250876 AACTGTGGGGAGAAGGGAGAGGG - Intergenic
1138851805 16:60638420-60638442 CTGTGTGTAGAGAAGAGATTAGG + Intergenic
1139480917 16:67230223-67230245 CTCTGTCTGGAGAAAGAAGAAGG + Exonic
1139696817 16:68680949-68680971 CTTTCTGGGGAGAAAGGAGAGGG - Exonic
1140263789 16:73403214-73403236 GTTTGTGTGGAGCAGGAAGAAGG + Intergenic
1140740953 16:77940941-77940963 CTCTTTGTTGAAAAGGGAGAGGG - Intronic
1140909386 16:79437958-79437980 CTGTTTGTGGAGACAGGAGTCGG + Intergenic
1141403570 16:83772046-83772068 CTGTGGGTGGAGAAGGATGGGGG + Intronic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1141802657 16:86321684-86321706 CTGCGTGTGGTGAAGGGGGCTGG - Intergenic
1141835566 16:86536789-86536811 CTCTGTGCGGAGCAGGGGGAGGG - Intronic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142027054 16:87820032-87820054 GTGTGGGTGGAGGAGGGACAAGG - Intergenic
1203100647 16_KI270728v1_random:1303985-1304007 CTGTGTTTGGAGAAAGGGGTGGG + Intergenic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143003699 17:3812930-3812952 CTGTGTGAGCAGGAGCGAGAGGG + Exonic
1143130709 17:4675236-4675258 CTGGCTGTGGTGAAGGGATAGGG - Intronic
1143346885 17:6256271-6256293 ATGTATGTGGAGAAGAGGGAGGG + Intergenic
1144013147 17:11169517-11169539 CGGTGTGTGGAGAGAGGGGAAGG - Intergenic
1144121515 17:12158537-12158559 CTGGCTGTGGAGAAAGGGGAAGG - Intergenic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144413387 17:15022663-15022685 CCATGTCTGGAGAAGGGAAAAGG - Intergenic
1144701654 17:17344517-17344539 CTGGGTGTGAAGAGGGGACAGGG + Intronic
1144713213 17:17416527-17416549 CTCTGTGGGGAGATGGGAGTGGG + Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146243567 17:31255830-31255852 CTGGGAGTGGAGAAGGAACAAGG - Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1146709974 17:35032554-35032576 CTGTGTGTGGAGAATAGGGACGG + Intronic
1147222141 17:38941678-38941700 GTGTGTATTGAGAGGGGAGAGGG + Intronic
1147323890 17:39661258-39661280 CTGTCTGTGGAGATGGGGGGTGG + Intronic
1147647646 17:42043426-42043448 CTGTGTGTGGGGGAGGCAGGGGG - Intronic
1147763104 17:42813735-42813757 CAGTCTGTTGAGAAGGGATATGG - Intronic
1147998914 17:44376277-44376299 CCAGGGGTGGAGAAGGGAGATGG - Intronic
1148843394 17:50513828-50513850 GAGTTTGTGTAGAAGGGAGAAGG + Intronic
1148876372 17:50689782-50689804 CTGGGTTTGGAGGAGGGACAGGG + Intronic
1148883691 17:50755293-50755315 CTTTGTGGGGAGATGGGAGGTGG + Exonic
1148921216 17:51036545-51036567 CTGTGTGTGGTAGGGGGAGAGGG - Intronic
1149037411 17:52150309-52150331 GTGTTTGAGGAGAAGAGAGAAGG - Intronic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149256296 17:54831178-54831200 CCCTGTGTAGAGAAGGGAAAAGG - Intergenic
1149355380 17:55834346-55834368 TTGGGGGTGGAGCAGGGAGAGGG - Intronic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1149703594 17:58675623-58675645 GTCTGTCTGGGGAAGGGAGATGG - Intronic
1150305743 17:64083957-64083979 CCCTGTGTGGAGGAGGGAGTGGG - Intronic
1150340231 17:64360612-64360634 GTGTGTGGTGAGAAGGGAAAGGG + Intronic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151383506 17:73741466-73741488 CTCAGTGGGGAGCAGGGAGAGGG - Intergenic
1151521464 17:74633388-74633410 CTGTCTGGGGAGCAGGGAGCTGG - Intergenic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1152367800 17:79866776-79866798 TTGTGTGTGGGGCCGGGAGAAGG - Intergenic
1152388277 17:79988106-79988128 GTGTGTGTTTAGAAGGGAGAGGG + Intronic
1152523295 17:80872925-80872947 CTGGGTGTGAGCAAGGGAGAGGG + Intronic
1152913118 17:83016746-83016768 ATGAAGGTGGAGAAGGGAGATGG + Intronic
1153077784 18:1185160-1185182 ATGTGTTTGGATAAAGGAGAGGG + Intergenic
1153115668 18:1652616-1652638 CTGTGAGGGGAGCTGGGAGAAGG + Intergenic
1153223650 18:2882039-2882061 CTGTGTGGGGTGCAGGGAGGAGG + Intronic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1153679418 18:7485956-7485978 CTTTGGGTGGAACAGGGAGAAGG - Intergenic
1154245735 18:12695839-12695861 GTGTGTGTGGAGAAGGAATGAGG - Intronic
1154325762 18:13389437-13389459 GGGTGTGGGGAGAAGGGACAAGG - Intronic
1155075578 18:22351195-22351217 GTGTGTTGGGGGAAGGGAGATGG + Intergenic
1155227085 18:23738182-23738204 ATGTGTGGGGAGAAGAGAGGTGG + Intronic
1155971110 18:32084563-32084585 GTGTGTTTGGGCAAGGGAGAAGG + Intergenic
1156367003 18:36438638-36438660 CAATATGTGGGGAAGGGAGATGG - Intronic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1156911638 18:42417541-42417563 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
1157302019 18:46485969-46485991 CTATGGGTGGGGGAGGGAGAGGG - Intronic
1157497682 18:48167965-48167987 CAGAGTGTGGGGAAGAGAGAAGG + Intronic
1157802224 18:50630063-50630085 CTGTGTTGGGAGATGGGGGAGGG + Intronic
1158525223 18:58207267-58207289 CTGTGTGGGGATCAGGAAGAGGG + Intronic
1158626423 18:59075729-59075751 CTCAGTGTGGAGGTGGGAGAAGG + Intergenic
1159116122 18:64114970-64114992 GGGTGGGAGGAGAAGGGAGAAGG - Intergenic
1159789325 18:72758403-72758425 GTGTGTGTGGAGGAGGGGGGTGG + Intronic
1160503960 18:79417089-79417111 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160503987 18:79417181-79417203 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160503994 18:79417205-79417227 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504006 18:79417246-79417268 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504018 18:79417287-79417309 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504031 18:79417335-79417357 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504043 18:79417375-79417397 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504055 18:79417416-79417438 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504062 18:79417440-79417462 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504075 18:79417488-79417510 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504087 18:79417528-79417550 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504099 18:79417569-79417591 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504111 18:79417610-79417632 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504124 18:79417658-79417680 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504136 18:79417698-79417720 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504143 18:79417722-79417744 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504155 18:79417763-79417785 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504167 18:79417804-79417826 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504180 18:79417852-79417874 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504192 18:79417892-79417914 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160504199 18:79417916-79417938 CTGTGGTGGGAGATGGGAGATGG + Intronic
1160898364 19:1413531-1413553 CTGTCTGTAGACCAGGGAGAAGG + Intronic
1160899904 19:1422424-1422446 CTGAGGGAGGAGCAGGGAGAAGG - Intronic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1161327172 19:3669477-3669499 CTGGGTGTGGACTCGGGAGAGGG + Intronic
1161520862 19:4722972-4722994 CTGTGTGGGAAGAAGGTAGGCGG + Intronic
1161522035 19:4730091-4730113 GTGTGGGTGGAGGAGGGAGGAGG - Intergenic
1161821634 19:6533774-6533796 CTGGAGGGGGAGAAGGGAGAAGG - Intronic
1161941202 19:7405389-7405411 GTCTGTGTAGAGAAAGGAGAGGG - Intronic
1162566742 19:11448819-11448841 CTGTGTGTGGGGACTGGAGGAGG + Intronic
1162908280 19:13836181-13836203 CTGTGTCTGGAGGAGGGATGTGG - Intergenic
1162918116 19:13885074-13885096 GTGTGTGTGGCTAAGGGAGGTGG + Intronic
1162934754 19:13976388-13976410 ATTTCTGTGGAGATGGGAGAGGG + Intronic
1163157785 19:15448946-15448968 GTGTGTGTGGAGGGGGGTGAAGG - Intronic
1163704464 19:18804250-18804272 CTGTGTGCGTTGCAGGGAGATGG + Intergenic
1164484949 19:28647344-28647366 CTTTGTGAGGAGAAGGCAGGAGG - Intergenic
1164512005 19:28905078-28905100 CTGAGTGAGGAGCAGGGAGCTGG - Intergenic
1164976883 19:32580422-32580444 TTGTGCGTGGAGGAGGCAGATGG + Intergenic
1165283810 19:34820455-34820477 GTATGTGTGGAAAAGGAAGAAGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165389241 19:35528825-35528847 GTGTTTGTGGAACAGGGAGAAGG - Intergenic
1165805841 19:38580179-38580201 CAGTGGGTGGTGAAGGGATAAGG + Intronic
1165861543 19:38911849-38911871 GTGGCTGTGGAGAAAGGAGATGG + Exonic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166137041 19:40783902-40783924 CCGGCTGTGGAGAAGGGAGAAGG - Exonic
1166170701 19:41025972-41025994 CCGAGTGTGGAGGCGGGAGAAGG - Intergenic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
1166536091 19:43575698-43575720 TTGTGTGTGGCGGAGGGAGGCGG - Exonic
1166735136 19:45079485-45079507 TGGGGTGAGGAGAAGGGAGAAGG + Intronic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1166963615 19:46514854-46514876 GTGTGTGTGGACATGTGAGAGGG - Intronic
1167582749 19:50356055-50356077 CTGGCTTTGAAGAAGGGAGAAGG - Intronic
1167677664 19:50897555-50897577 GGGAGGGTGGAGAAGGGAGACGG - Intergenic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1168122632 19:54260748-54260770 GTGTGCTTGGGGAAGGGAGAAGG - Intronic
1168327566 19:55546027-55546049 CAGTGTGCGGACAGGGGAGAGGG - Intergenic
1168422280 19:56212417-56212439 CTGTGTCTGGAGAAGGATGTTGG - Intergenic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
1168688990 19:58365747-58365769 CGGTGTGTGGACCAGGTAGAGGG - Intergenic
925013215 2:501753-501775 CCGTCTGTGGAGAAGGGACGTGG - Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
926003781 2:9355454-9355476 GTGTGTGTGCAGCAGGGAGGCGG - Intronic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
927000161 2:18786612-18786634 CTGTCTGTGGGGAAAAGAGACGG + Intergenic
927041416 2:19234413-19234435 CAGTGCTTGGAGAAGGGGGAAGG + Intergenic
927153476 2:20208930-20208952 CTGTGGGTGGGGAAGGGGCAAGG - Intronic
927154547 2:20213879-20213901 CTGTGTGTGAAGGTGGGGGAGGG + Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927921514 2:26975603-26975625 TTGGGTGTGGGGAAGGGAAAAGG + Intronic
928327440 2:30330788-30330810 CTGTGTGGGGAGAGTTGAGAAGG + Intergenic
928475627 2:31624509-31624531 CTGTGTGGGGTGGGGGGAGAGGG - Intergenic
928661068 2:33502288-33502310 CTGTGTGTGGAGGTGGGTGGGGG + Intronic
928933016 2:36645085-36645107 CTGTGAGTCTACAAGGGAGATGG + Intronic
929240796 2:39651106-39651128 GTGTGTTTGAAGAAGGGACATGG + Intergenic
929243590 2:39677644-39677666 CTGTGTTTGGAGGAGTGGGATGG + Intronic
929411242 2:41699185-41699207 CTGTGTGAGGAAAACAGAGAGGG + Intergenic
929560405 2:42952974-42952996 CTCTGAGAGGAGAAGGGAGGAGG - Intergenic
929562675 2:42965517-42965539 CTTAGGCTGGAGAAGGGAGATGG + Intergenic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929930661 2:46253256-46253278 CTATGCCTGGAGAAGAGAGAGGG + Intergenic
930986510 2:57594641-57594663 ATGTGTGTGGGAGAGGGAGAAGG + Intergenic
931122790 2:59238904-59238926 GTGTGTGGGGAGGAGGGAGGAGG + Intergenic
931170400 2:59797370-59797392 CAGAGTGTGGAGGAGAGAGAGGG - Intergenic
931426680 2:62178095-62178117 GTGTATGTGGAGGAGGCAGAGGG - Intergenic
931605469 2:64048329-64048351 GTGGGAGTGGAGAATGGAGAAGG + Intergenic
933131845 2:78681921-78681943 CTGGGTGGGGAGAGGGGAGTGGG - Intergenic
933187572 2:79295539-79295561 TTGTGAGGGAAGAAGGGAGAGGG - Intronic
933373153 2:81442879-81442901 TTGTGTTTGGAAATGGGAGAGGG - Intergenic
933647621 2:84825331-84825353 CCGTGTGTGAGGAAGGGAGGAGG + Intronic
933665476 2:84961079-84961101 GTGTGTGTGGAGCAGGGAGGTGG - Intergenic
933700292 2:85250342-85250364 CTGTGTGTGGCAAGGTGAGAAGG - Intronic
934051151 2:88212066-88212088 CTGTGTGGGGAGAGAGGAGGTGG + Intergenic
934298856 2:91765011-91765033 CTGCATTTGAAGAAGGGAGAAGG + Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934853478 2:97715421-97715443 CTGTGACTGTAAAAGGGAGATGG - Intronic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
934942931 2:98515463-98515485 CGGTGGGTGGGGCAGGGAGAGGG + Intronic
934980233 2:98833410-98833432 CTGTGTGTGCAGCAGGCTGAGGG + Intronic
935011175 2:99137577-99137599 GTGGGAGGGGAGAAGGGAGAGGG - Intronic
935880781 2:107562935-107562957 GGGTGTGTGGAGAAGTGACAGGG + Intergenic
936863712 2:117053674-117053696 CTGTGTGTGGCCAAATGAGATGG - Intergenic
937479470 2:122243568-122243590 CTGTGTTGGGAGAAAGTAGAAGG - Intergenic
938226927 2:129624538-129624560 ATGTGTGTGGAGCAGGGAGTGGG - Intergenic
939052520 2:137325134-137325156 ATGTAGGTGGAGAAGGGAGCTGG - Intronic
939783880 2:146484187-146484209 ATGAGTAGGGAGAAGGGAGAAGG + Intergenic
940496483 2:154435422-154435444 GTGTCTGTGGAGTAGTGAGATGG + Intronic
941199104 2:162487474-162487496 GTGAGTGGGGAGGAGGGAGAGGG + Intronic
941673061 2:168315812-168315834 CTGTGTGAGGAAAAATGAGAAGG + Intergenic
942182942 2:173397565-173397587 GTGTGTGTGGAGGGGGGCGAGGG + Intergenic
943041127 2:182806878-182806900 CAGTGTGTCTAGAAGGGATAAGG - Intergenic
943640481 2:190352612-190352634 TTGTTTGTGCAGAAGGGACAGGG - Intronic
944192144 2:197014895-197014917 CTGTGTGTGGAGAGGTGGGGTGG - Intronic
944233346 2:197417917-197417939 TTCTGTGTGGAGAAGGTTGATGG - Intronic
944238360 2:197461587-197461609 GTGTGTGTGAGGGAGGGAGAGGG + Intronic
944342389 2:198617372-198617394 CAGTGGGTGGAGATGGGAGGAGG + Intergenic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944572432 2:201058205-201058227 CTGTGTGAAGAGGAAGGAGAGGG - Intronic
945523442 2:210858709-210858731 CTATGTGTGAAGAAGGATGACGG - Intergenic
945888904 2:215407879-215407901 GTGTGTGTGTATAAGGGAGTTGG + Intronic
946109622 2:217403183-217403205 AGGTGGGAGGAGAAGGGAGAGGG + Intronic
946212629 2:218159750-218159772 CTGTTTCTGGAGAATGGAGAAGG + Intergenic
946698147 2:222382978-222383000 GTGTGTGTTGGAAAGGGAGAAGG - Intergenic
947039905 2:225905386-225905408 CTGTGTGTGGGGCAGGGATGAGG - Intergenic
947175557 2:227363484-227363506 CTGTGTGTAGAGAAAGGAGAAGG - Exonic
947205484 2:227657296-227657318 CAGCGTTTGGAGAAGGAAGAAGG + Intergenic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
947791744 2:232872712-232872734 CTGTCTGGGGAGGGGGGAGATGG - Intronic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
1168797705 20:622538-622560 GTGTGGCTGGAGAAGGGAGAGGG - Intergenic
1169039600 20:2482200-2482222 ATGTGTGGGGAGAATGGACAAGG - Exonic
1169091056 20:2861723-2861745 CTGTGTGTGGAGAGAGGGGAGGG + Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169381834 20:5113802-5113824 CTGTGAGTGGAGAAGGAAATAGG - Intergenic
1169956191 20:11105587-11105609 ATGTTTGCGGAGAATGGAGAAGG + Intergenic
1170397691 20:15945910-15945932 GTGTGTCTAGAGAAGGCAGAGGG + Intronic
1170446550 20:16433954-16433976 CTGTGTCTGGAGTTGGGGGAGGG - Intronic
1170579540 20:17687400-17687422 ATGGGAGTGGAGAAGGTAGAAGG + Intergenic
1170696960 20:18667788-18667810 AGGCGTGGGGAGAAGGGAGAGGG - Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1171206659 20:23286973-23286995 CTGTGCGCGGAGGTGGGAGAGGG - Intergenic
1171262854 20:23748516-23748538 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1171271981 20:23824720-23824742 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1171413493 20:24962021-24962043 CTGTGTCGGGAGAAGAGAGTCGG - Intergenic
1172050143 20:32110714-32110736 CTGTGTGTGGATGAGGGTGGAGG + Intronic
1172189923 20:33055789-33055811 CTGTGTGTGGCTCAGGGACAGGG + Intronic
1173075233 20:39812175-39812197 ATGTGTGTGGAGACAGGAAAGGG - Intergenic
1173134089 20:40423942-40423964 ATGTGTGTGCAGAGGGGAGGAGG - Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173681122 20:44882873-44882895 AATTGTGTGGAGGAGGGAGAGGG + Intergenic
1173895757 20:46549598-46549620 TTGTGGGTGAAGAAGGGAGTTGG + Intronic
1174263485 20:49314506-49314528 CTGGGTGGGGAGAAGGAAGGAGG - Intergenic
1174774486 20:53331497-53331519 CTCTGAGGGGAGAGGGGAGAGGG + Intronic
1175348718 20:58302481-58302503 CTGTGTGTGAGGGAGGGAGTGGG - Intergenic
1175375622 20:58521668-58521690 ATGGGTGTGGAGATGGAAGAGGG + Intergenic
1175595228 20:60225608-60225630 CTGTGTGTGGAGGTGCGAGGGGG + Intergenic
1176057183 20:63154949-63154971 CAGTGTGGGGAGGAGGGAGGAGG - Intergenic
1176367757 21:6044122-6044144 CTGTGGGCGGAGACGGGGGAGGG - Intergenic
1176373775 21:6077358-6077380 GTGGGTGGGAAGAAGGGAGAGGG + Intergenic
1176769381 21:13055362-13055384 GTGTGTGGGGTAAAGGGAGAAGG + Intergenic
1176780492 21:13188547-13188569 CACTGTTTGGCGAAGGGAGAAGG - Intergenic
1177135808 21:17304464-17304486 CTGTTTGTTAAGCAGGGAGAAGG - Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179491587 21:41744786-41744808 CTGTGTGGGGACGAGGGAAAGGG + Intronic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1179516982 21:41915179-41915201 CTCTGTGTGGAGGTGGGAAATGG - Intronic
1179749702 21:43460885-43460907 GTGGGTGGGAAGAAGGGAGAGGG - Intergenic
1179755762 21:43494420-43494442 CTGTGGGCGGAGACGGGGGAGGG + Intergenic
1180166025 21:46029609-46029631 GTGTGTGTGGAGGGGGGACAGGG - Intergenic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1181372038 22:22426289-22426311 CAGTCTGTGGGGAAGTGAGATGG + Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181648700 22:24247311-24247333 CTGTGCCTGGAGGAGGGAGCAGG + Intergenic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181823468 22:25494151-25494173 CTGGATGAGGAGTAGGGAGAAGG - Intergenic
1181947501 22:26529479-26529501 CTGGGAGGGGAGAGGGGAGAGGG + Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182118551 22:27772415-27772437 GAGTGTGGGGAGGAGGGAGACGG + Intronic
1182768609 22:32776894-32776916 CTGTGTGTGCTCAAGGGATAGGG - Intronic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183285282 22:36958851-36958873 CTGTATGGGAAGAAGGGACAGGG - Intergenic
1183299896 22:37053712-37053734 CTGTGGGTGGAGGCAGGAGAGGG + Intronic
1183359483 22:37376074-37376096 CGGGGTGTGGAGAAGGGATGGGG - Intronic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183380266 22:37487155-37487177 CTCTGAGTGGAGGAGGGAGGAGG - Intergenic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183460508 22:37947220-37947242 CTGGGGGAGGACAAGGGAGAGGG - Intronic
1183685701 22:39360229-39360251 CTGAGGGTGGAGGAGAGAGAGGG - Intronic
1183812826 22:40272222-40272244 CTGTCTGTGCACAAGGGGGAGGG - Intronic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184557030 22:45239147-45239169 GTGTGTGTGGACAGGGGAGTGGG + Intronic
1184770803 22:46595447-46595469 CTGTGTCTGGAAAGGGGAGGTGG + Intronic
1185225663 22:49650610-49650632 CTGTGTGTGGAGAAGGGTGGAGG + Intronic
949365562 3:3276758-3276780 ATGTGTTTGGAGGAGGGAGAGGG - Intergenic
949577587 3:5353536-5353558 GTGTGTGTGCACAGGGGAGAGGG + Intergenic
950040793 3:9917900-9917922 CTGTGTGTGGAGGAGCGGGTGGG - Intronic
950335570 3:12190250-12190272 CAGTGTGGGAACAAGGGAGAAGG - Intronic
950421428 3:12901879-12901901 CTGTGTGTGGCGAGTGCAGAGGG + Intronic
950537540 3:13588402-13588424 TTGTGTGGGGTGAAGGGAAATGG + Intronic
951633277 3:24744400-24744422 CTATTTGTGCAGAAAGGAGAGGG - Intergenic
951966455 3:28391342-28391364 GTGTGTGTGTGGCAGGGAGAGGG - Intronic
952917913 3:38263462-38263484 GTGTGTGGGGTGGAGGGAGAGGG - Intergenic
952966507 3:38624198-38624220 GTGTGTGTGTGTAAGGGAGAAGG - Intronic
953004857 3:38968954-38968976 CTGTGTGTGGGGTAGGGACATGG - Intergenic
953022868 3:39127088-39127110 CTGGGCCTTGAGAAGGGAGAAGG - Intronic
953461202 3:43082497-43082519 CAGTGTGTGTATATGGGAGAGGG - Intronic
953725786 3:45397250-45397272 CTGGGGGTGGAAAAGAGAGAAGG - Intronic
953747331 3:45585249-45585271 CTGTGTGTCATGTAGGGAGAGGG + Intronic
953752317 3:45618199-45618221 CTGAGTGGGGAGATGGGAGCAGG + Intronic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
954417898 3:50403034-50403056 CTGTGGCTGGACAAGGGAGGAGG - Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
955144709 3:56305499-56305521 GTGTGTGTGGATAAGAGAGTGGG - Intronic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
955995795 3:64679284-64679306 GTCTGTGTGGAAAAGAGAGAGGG - Intronic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957440389 3:80238863-80238885 ATGTGTGTGTAGTAGGGTGAAGG - Intergenic
958954622 3:100453756-100453778 CTGTGTTTGGAGGTGGGAAAAGG - Intronic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959864695 3:111252885-111252907 CTAGGACTGGAGAAGGGAGAGGG - Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960583706 3:119301719-119301741 CAGTGGGTGGAGAAAGGGGATGG + Intronic
960623595 3:119659610-119659632 ATGTGTGTGGTGATGGTAGAGGG + Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961265049 3:125634921-125634943 CTTGGTGGGGAGAAGGAAGATGG + Intergenic
961330637 3:126135947-126135969 CTGGGTGTGGTGAGGGGAGCCGG + Intronic
961426008 3:126848650-126848672 CTGGGGGTGGAGAAGGTAGAGGG + Intronic
961524864 3:127490389-127490411 GTGTGGGTGGTGGAGGGAGATGG - Intergenic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
962064171 3:131961862-131961884 CTGAGTAGGGAAAAGGGAGAAGG - Intronic
962463869 3:135639097-135639119 ATTTATGTGGAGAAGAGAGATGG - Intergenic
963437557 3:145289974-145289996 CTGTCTATGGAGTAGGGTGATGG + Intergenic
963704148 3:148665071-148665093 CTGTCTGGTGAGAGGGGAGAAGG - Intergenic
963721379 3:148865862-148865884 CGGAGTGGGGAGAATGGAGAGGG - Intronic
964092059 3:152889015-152889037 TTGTGTGTGGGGCAGGGAGGGGG + Intergenic
964158859 3:153621519-153621541 CTGTGTGTGTGGAAGAGAAAGGG + Intergenic
964428695 3:156580857-156580879 CAGTGTGTGTAGAAGGGTGTGGG - Intergenic
964531790 3:157676121-157676143 TGGTGTGGGGAGAAGGGAGATGG - Intronic
964722208 3:159778797-159778819 CTGTCTCTGGAGAAGACAGATGG + Intronic
966451899 3:180072928-180072950 CTGTATTTGGAGAAGAGGGAGGG + Intergenic
966548219 3:181175167-181175189 CTGTGAATGGAAAAAGGAGAAGG + Intergenic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967276925 3:187784865-187784887 TGGGGTGAGGAGAAGGGAGATGG + Intergenic
967936245 3:194730132-194730154 GTGTGTGTGGAGAGGAGAGTAGG + Intergenic
967947897 3:194818587-194818609 GTGGGTGAGGAGAGGGGAGAGGG - Intergenic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
968680260 4:1913849-1913871 TCGTGTGTGGAGACGAGAGATGG - Intronic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
969206390 4:5650215-5650237 CAGTGGGTGGAGTAGGGAGTGGG - Intronic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969549387 4:7854416-7854438 CTGAGTGTGGAGAAGGGCTGTGG - Intronic
969588826 4:8109706-8109728 CTGTCTGGGGATGAGGGAGAGGG + Intronic
970558543 4:17259968-17259990 CTTTGAGGGGAGAAGGGATAAGG + Intergenic
970641888 4:18075988-18076010 CTGAGCGTGGAGGAGGAAGAGGG + Intergenic
970740958 4:19237101-19237123 TTGTTGCTGGAGAAGGGAGAAGG - Intergenic
971862912 4:32131313-32131335 CTGGGTGTGGAGTGGGGGGAAGG - Intergenic
972775059 4:42232657-42232679 CTGTGAGTAGCGAAGGGAGCCGG + Intergenic
973667460 4:53177399-53177421 GTGGGTTAGGAGAAGGGAGAGGG + Intronic
973981772 4:56313989-56314011 CTGTGGGTGGAGAAAGCAAAAGG + Intronic
974794908 4:66736094-66736116 ATGTGTGTGGAAGAGGTAGAGGG + Intergenic
974880533 4:67751893-67751915 GTTTGTTTGTAGAAGGGAGAGGG - Intronic
975651851 4:76601252-76601274 CTGTGTGTGGTGTGGGGAGGGGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
976188941 4:82470611-82470633 CTGCCTGTGGAGGAGGGTGAAGG - Intergenic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
976600938 4:86936467-86936489 CGGTGTGTGTAGAAGGTAGGTGG + Intronic
976697184 4:87929608-87929630 TTATGTGTAGAGAAGGAAGAGGG + Intergenic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
977314899 4:95433868-95433890 CTGTGTGAGAAAAAGAGAGAAGG - Intronic
977334807 4:95684395-95684417 CTGGGTGTGAAGATGGGGGAAGG + Intergenic
978573450 4:110165199-110165221 CTGTGAGAGGATAATGGAGAGGG - Intronic
979004299 4:115270698-115270720 GTGTGTGTGTAAAAGAGAGATGG + Intergenic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
979942892 4:126784913-126784935 CTGTAGTTGGAGAAGGGAGGAGG - Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980099515 4:128527672-128527694 CTGTGCGTGGAGAGAGCAGAGGG + Intergenic
980833707 4:138163442-138163464 CTGTGTGTGGAATAAGGAGATGG + Intergenic
981457870 4:144977267-144977289 CTGTGGTTGGAGCATGGAGAAGG - Intronic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981584444 4:146286010-146286032 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584450 4:146286058-146286080 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584487 4:146286318-146286340 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584490 4:146286342-146286364 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584496 4:146286390-146286412 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584499 4:146286414-146286436 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584511 4:146286506-146286528 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584514 4:146286530-146286552 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584540 4:146286698-146286720 CTGTGTCTGGAGTGGTGAGAAGG + Intronic
981584546 4:146286746-146286768 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584557 4:146286838-146286860 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584573 4:146286982-146287004 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584576 4:146287006-146287028 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
982455409 4:155603706-155603728 CAGTGTGTGGGGCAGGGGGACGG + Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
983905169 4:173174145-173174167 GTGTGGGGGGAGAAGGGGGATGG - Intronic
983991070 4:174120610-174120632 GTGTGTGTGGTGTAGGGAGAGGG + Intergenic
984029063 4:174580816-174580838 CTGTGGGTGGTGCAGGGAGGAGG + Intergenic
984189127 4:176583664-176583686 GTGTGTATGGGGAAGAGAGAAGG + Intergenic
984466598 4:180107416-180107438 CTGTGTTAGGAAAATGGAGAAGG + Intergenic
984963788 4:185123672-185123694 GCGTGTGTGGAGAGGGGATAGGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986179704 5:5382304-5382326 GTGTTGGGGGAGAAGGGAGAGGG + Intergenic
986307090 5:6524083-6524105 CAGTGTGTGGCGGAGGGAGAGGG - Intergenic
986631112 5:9775168-9775190 CTTTGTGTGCAGAAAGGGGAGGG - Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
987544348 5:19293205-19293227 GTGTGTGTGGTGGGGGGAGATGG + Intergenic
988603586 5:32661651-32661673 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
988658979 5:33243582-33243604 CAGTATGTGGAGAAGAAAGAAGG - Intergenic
988814535 5:34821005-34821027 CCGTGTGTTGAGAATGTAGAGGG + Intronic
989039877 5:37216565-37216587 ATGTGTGGAGTGAAGGGAGATGG + Intronic
989398394 5:40982787-40982809 CTGTGGGAGGAGAAATGAGAGGG + Exonic
990155575 5:52873310-52873332 GTGTTTGTGGAGAAGGGCAAGGG - Intronic
990710042 5:58570489-58570511 AGCTGTGTGGAGAAAGGAGAAGG - Intergenic
990933872 5:61125630-61125652 CTGTGTATTGACAAGGCAGATGG + Intronic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
992341071 5:75823945-75823967 CTGTGGGAGGAGGAGGCAGAAGG + Intergenic
992878700 5:81083427-81083449 TTGTATGTGTAGAAGAGAGAAGG + Intronic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
994070027 5:95590361-95590383 CTGAGTGTGGAGAGTGGACAGGG + Intronic
994087004 5:95770001-95770023 CAGTGTTTGGAGAAGGGGGTAGG + Intronic
994133939 5:96263294-96263316 CTGTGGGTGGAGAAGGGTGGGGG + Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
995629588 5:114118834-114118856 CTGAGTGAGGAAAAGTGAGAAGG - Intergenic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996583758 5:125062083-125062105 CTTTGAGTGGAGAATGGAAAAGG + Intergenic
996600511 5:125257550-125257572 CTGTGTGTATAGCAGGGAAAGGG - Intergenic
996775021 5:127123255-127123277 ATGAGAGTGGAGAAGGGACATGG + Intergenic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997251416 5:132391598-132391620 ATGTTTGAGGAGGAGGGAGAAGG + Intronic
997335487 5:133106154-133106176 GTGTGTGTGGGGAAGGGTGTGGG + Exonic
997396594 5:133564893-133564915 ATGTGTGTTGAGAAGTGAGAGGG - Intronic
997572154 5:134938632-134938654 GTGAGAGTGGAGAAGGGGGAGGG + Intronic
997582025 5:135024223-135024245 CTGCTTGTGGAGCAGGGAGGAGG - Intergenic
998042600 5:138961904-138961926 CTGTGTTTGGAGAAGCTAAAAGG - Intronic
998052897 5:139051185-139051207 GTGTGTGTGTTCAAGGGAGAGGG - Intronic
998186154 5:139981496-139981518 CTGTGTTAAGAGAAGGGAAACGG - Intronic
998378561 5:141708005-141708027 CTGTGTGTGGAGAATAGACTGGG + Intergenic
998534233 5:142914649-142914671 CTGTGTGTAGAGGTGTGAGAGGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998992610 5:147834653-147834675 CAGTGTGGGGAGAAGGGAATTGG + Intergenic
999174982 5:149625748-149625770 GTGTGTGTGGAGAGGTGGGAGGG - Intronic
999276423 5:150333685-150333707 CTGTGTGGGGTGAAGGGAGCAGG - Intronic
999477185 5:151911280-151911302 CTCTGTCTGGAGGTGGGAGATGG - Intronic
999622879 5:153490414-153490436 CTGTGTGTGCAGAAAGGTGGAGG - Intronic
999708284 5:154293753-154293775 CTGTGTGTGGCCCAAGGAGAAGG - Intronic
999964911 5:156798840-156798862 CTGTGTGTGGCGTGGGGGGATGG + Intergenic
1000177766 5:158774602-158774624 CTGTGGGTGGACAAAGGAGGGGG + Intronic
1000472566 5:161663752-161663774 CTGTCTGTGAAGAAGAGTGAAGG + Intronic
1000518131 5:162265555-162265577 TTTTGTGTGGAAAAGAGAGATGG - Intergenic
1000824152 5:166023183-166023205 GTGTGTGTGGAGACGGTAGGAGG + Intergenic
1000935359 5:167299472-167299494 ATGTGTGTAGGGAAGGGAGGGGG + Intronic
1000990750 5:167908709-167908731 CTGTGTTGGGAAAAGAGAGAAGG - Intronic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001104897 5:168844500-168844522 CTGTGTGGGGAGGAGAGAGGGGG - Intronic
1001197835 5:169689553-169689575 CTGTGTGTGCAGGAGTGAGACGG - Intronic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002095410 5:176828072-176828094 GTGGGTGTGGAGGAGGGGGAAGG - Intronic
1002290059 5:178194292-178194314 CTGTGCAGGGAGAAGGGAGGTGG + Intergenic
1002517613 5:179771255-179771277 CTGTGTGACGAGCAGGGACAGGG + Intronic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1002917534 6:1541352-1541374 GTGTGAGTGGAGGAGGGAGCTGG + Intergenic
1003290222 6:4774460-4774482 CGCTGTTTGGAGGAGGGAGAGGG + Intronic
1003995949 6:11538719-11538741 CGATGTGTGTAGAAGGGGGAGGG - Intronic
1004622938 6:17347116-17347138 GGGTGTGTGGAGTAGGGAGATGG + Intergenic
1005054399 6:21716451-21716473 GTGTGTGTGGGGTAGGGTGAGGG + Intergenic
1005512253 6:26521547-26521569 CTGCCTGTGAAGGAGGGAGAGGG - Intergenic
1005819882 6:29588957-29588979 ATGGGTGTGAAGAAGGCAGAGGG - Exonic
1006174266 6:32112477-32112499 GGGTGTGGGGAGAAGGGAGGAGG + Intronic
1006354624 6:33547741-33547763 CTGTTTGTGGACAAGGAAAAGGG + Intergenic
1006641336 6:35491259-35491281 CGGTGGGGGGTGAAGGGAGAAGG + Intronic
1006934059 6:37705344-37705366 GGGTGTGAGGAGAAAGGAGAAGG + Intergenic
1007075824 6:39065554-39065576 TTGTGTGTAAAGAAGGGAAAAGG + Intronic
1007282131 6:40720520-40720542 CTGTGGGTGGAGTTGGGGGAGGG - Intergenic
1007382414 6:41499414-41499436 CTGGGTGTGGTGAAGGGAAGGGG - Intergenic
1007693672 6:43718460-43718482 CTGTGTGTGGTGTAGGGAGATGG + Intergenic
1007811836 6:44491759-44491781 CCATCTCTGGAGAAGGGAGAGGG + Intergenic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008447773 6:51613038-51613060 CTGTTTGTGAACAAGGAAGAGGG - Intergenic
1008646229 6:53517668-53517690 GTGTTTGTGTGGAAGGGAGAAGG + Intronic
1010046230 6:71447304-71447326 CTGTCTGGGGAGAAGGGGCAGGG + Intergenic
1010082212 6:71877060-71877082 CTCTCTGTGGAGATGGTAGATGG + Intergenic
1010293425 6:74167147-74167169 CTGTGTGTGGAGAAGACATTTGG + Intergenic
1011043567 6:83057605-83057627 CTGTGGGTGGAAAAGAAAGAAGG + Intronic
1011316541 6:86038467-86038489 CTGTGTGTGGAGTGGGGGGATGG - Intergenic
1011339274 6:86294755-86294777 CTGTGTGTAGAGAAGTCAGAAGG - Intergenic
1011745315 6:90402764-90402786 CTGTGTGTTGAGACAGGAGGTGG + Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1012426629 6:99122066-99122088 CTGTCAGTGAGGAAGGGAGAAGG - Intergenic
1012943465 6:105441530-105441552 TTTTGTGGGGAGAAGGGAGAGGG + Intergenic
1012998992 6:106002877-106002899 CTGTGTGTGGCCAAGAGAGGAGG + Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013630292 6:111979912-111979934 GTGTGTGAGGAGGAGGGACATGG + Intergenic
1013648708 6:112171559-112171581 CTGGATGTGGAGGAGGGAAAGGG + Intronic
1013734056 6:113205353-113205375 GTGTGTGTGGTGAAGGGTGCAGG + Intergenic
1013787771 6:113800904-113800926 GTGTAGGTGGAGAAGGGGGACGG + Intergenic
1014237638 6:118977572-118977594 CTTTTTGGGGAGAAGGGATAGGG - Intronic
1014734716 6:125078877-125078899 CTATTTGTGGAGATGGGGGAGGG - Intronic
1014948758 6:127529117-127529139 CTCTATGTGGATAAGAGAGATGG - Intronic
1015033182 6:128621467-128621489 CTGTGGGGGGAGTAGGGAGAGGG - Intergenic
1015711883 6:136150930-136150952 TTGTCTTTGGTGAAGGGAGAAGG + Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017988214 6:159463201-159463223 CTGTGGCTGGCGAAGGTAGACGG - Intergenic
1018158313 6:161011454-161011476 AAGTGTGTGAAGAAGGGAGGGGG - Intronic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018591023 6:165422248-165422270 ATGTGTGTGTATAAGGGAGTAGG - Intronic
1018619727 6:165718483-165718505 CTGTGTGTAGTGAACGGACAAGG + Intronic
1018719676 6:166563219-166563241 GTGTCTCTGGAGAAGGAAGATGG + Intronic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1019226029 6:170510238-170510260 AACAGTGTGGAGAAGGGAGAGGG + Intergenic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1019327456 7:445442-445464 GTGTGTGCTGAGTAGGGAGAGGG - Intergenic
1019388259 7:770753-770775 CTCAGTGTGGGGGAGGGAGATGG - Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019685176 7:2377905-2377927 CTGGGTGTCGAGGAAGGAGAAGG + Intronic
1019685232 7:2378222-2378244 CTGGGTGTCGAGGAAGGAGAAGG + Intronic
1019795041 7:3043117-3043139 GTGGGTGTGGAGCTGGGAGATGG - Intronic
1019911401 7:4102504-4102526 CTGCGTGTGGGGAAGGGAGGAGG - Intronic
1020370999 7:7431895-7431917 CTAGGTGTGGAGGAAGGAGAAGG + Intronic
1020905831 7:14062988-14063010 CTGTGTGGGGTGAGGGGAGGGGG - Intergenic
1021767992 7:23968402-23968424 CAGTGTGTGGGTAAGGGAGTGGG + Intergenic
1021809466 7:24389441-24389463 TTGTGTTGGGAGAAGGGGGAAGG - Intergenic
1023487138 7:40699346-40699368 TTGTGTGTGCAGATGGGACAAGG + Intronic
1023780896 7:43654139-43654161 CTGGGTGTGGAGAGAGGTGAAGG - Intronic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024217830 7:47263011-47263033 CTGTGTGGGGAGGAGGGTGTTGG - Intergenic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1026284890 7:68954619-68954641 ATGTGTGGGAAGAATGGAGAGGG + Intergenic
1026377538 7:69767079-69767101 GTGTGTGTTGAGATGGGAGAGGG + Intronic
1026867689 7:73833494-73833516 CAGAGGGTGGAGAAGGGAAAAGG - Intergenic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027219511 7:76204956-76204978 CTGAGTGAGGAGAAAGGAGCTGG - Intronic
1027226725 7:76248302-76248324 CTGTGTGGGGATGAGGGAGAGGG + Intronic
1027377645 7:77569137-77569159 GTGTCTGTGGGGAAGGGAAATGG - Intronic
1027759344 7:82258278-82258300 CTGTCTGAGGAGAAAGGAGTAGG - Intronic
1028318826 7:89436155-89436177 CTTAGTTTGGAGAAGGGAGGAGG - Intergenic
1028561486 7:92180391-92180413 CTGGGTGTGGAAAAGGGGGCTGG - Intergenic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1029099236 7:98114634-98114656 CTGCATCTGGTGAAGGGAGACGG + Intronic
1029813958 7:103075138-103075160 CTGGATGTGGAGAAAGGAAATGG - Exonic
1029969996 7:104779547-104779569 CTGTGCCTGGTGCAGGGAGAGGG - Intronic
1030416139 7:109245859-109245881 CTGTGTGTGAATGGGGGAGAGGG - Intergenic
1031522862 7:122787698-122787720 CTGAGTGTGGGGCAGGGACAAGG + Intronic
1031658425 7:124388399-124388421 CCATGTGTGATGAAGGGAGAAGG + Intergenic
1031999514 7:128255609-128255631 ATGTTTGGGCAGAAGGGAGAAGG + Exonic
1032245106 7:130204919-130204941 TTGTGTGTGGATAAAGGACAAGG + Intronic
1032508782 7:132455627-132455649 GTGTGTGTGGAGAATGCAAACGG - Intronic
1033088932 7:138367456-138367478 CGGTGTGTAGGGAAGGGAGGGGG - Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1033603416 7:142907085-142907107 CAGTGTGGGGCAAAGGGAGATGG + Intergenic
1033789400 7:144773447-144773469 CTGTGGGTGGTCAAGGTAGAAGG + Intronic
1033889226 7:145988304-145988326 TTGTGTGTGGAGAAGAAAGAGGG - Intergenic
1034421297 7:150992458-150992480 CTGTCTCAGGAGGAGGGAGATGG - Intronic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1034858974 7:154580220-154580242 GTGTGTGTGTATAAGGGGGAGGG - Intronic
1034949486 7:155287334-155287356 TTGTGTGTGGTGGAGGGACAGGG - Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035290507 7:157834969-157834991 CTGTGGGTGGTGAATGGAGCTGG + Intronic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1035519814 8:266858-266880 GCGTGTGGGGAGACGGGAGAGGG + Intergenic
1035815920 8:2540300-2540322 GTGTGTGCGGAGAAGGGAGGCGG + Intergenic
1036050704 8:5192994-5193016 CTGTTTGTGGGGTAGGGGGACGG + Intergenic
1036132014 8:6124294-6124316 CTGTGTGTGGATAAAAGGGAAGG + Intergenic
1036174825 8:6527406-6527428 ATGAGGGAGGAGAAGGGAGAGGG - Intronic
1036216559 8:6884458-6884480 CTGAGTGTGAAGAGGGGAGGGGG + Intergenic
1036749675 8:11435905-11435927 CTGTGTATGAAGACGGGATATGG - Intronic
1037269990 8:17116006-17116028 TTTAGTGTGGAGCAGGGAGAAGG - Intronic
1037374938 8:18217441-18217463 CTGTGCCTGGACAAAGGAGAAGG + Intronic
1037544116 8:19900840-19900862 CTGTTTGTGGGGAAGGGTGGAGG + Intergenic
1037719129 8:21427917-21427939 ATGGGAATGGAGAAGGGAGAAGG - Intergenic
1037900079 8:22682977-22682999 CTGTGTTTGGAGGAAGGGGACGG + Intergenic
1038040122 8:23717217-23717239 CTGTCTGGGGAGGAGGTAGAAGG - Intergenic
1038276109 8:26122237-26122259 CTGTGTGTGCTGGAGGGACATGG - Intergenic
1038529462 8:28306156-28306178 GTGTGTGTGGAGCGGGGAGTGGG - Intergenic
1038533822 8:28339588-28339610 GTGTGTGTGGAGTGGGGAGGGGG - Intronic
1038542768 8:28402751-28402773 CTGTGTGTGCAGGAGGCAGGAGG - Intronic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1039755445 8:40517528-40517550 CTGAATGTGGATAAGGGAAAAGG - Intergenic
1040552703 8:48450748-48450770 CTGTGTCTGGATGAGGGGGAAGG + Intergenic
1040742347 8:50593326-50593348 CTGTGTCTGAAGAAGAGAGTTGG + Intronic
1040796125 8:51291635-51291657 CTGTTTGTTAAGCAGGGAGAAGG + Intergenic
1040969439 8:53117821-53117843 GTGTGTGTGTGGTAGGGAGAAGG + Intergenic
1041113922 8:54515679-54515701 CTGTGTGTGGTGTTGGCAGAGGG + Intergenic
1041351019 8:56947653-56947675 GTGTGTGTGTTGCAGGGAGAGGG - Intergenic
1041358967 8:57030221-57030243 CTGGGTGTTGTGAAGGGAGTAGG - Intergenic
1041360461 8:57047445-57047467 CTAAGTGTGGAGAGGGGACAAGG - Intergenic
1041703222 8:60815445-60815467 CTGTTTGAGGGGCAGGGAGAGGG + Intronic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1044263910 8:90160595-90160617 CTCTCTGTGGAGAGGGGACATGG + Intergenic
1044725544 8:95191616-95191638 GTGTGTGTGTAGTATGGAGAGGG + Intergenic
1044918156 8:97137977-97137999 CAGTCTGAGGAGAAGTGAGAGGG - Intronic
1045455469 8:102374672-102374694 CTATGTGTGCAGAAGGCAGTAGG - Intronic
1045662706 8:104454555-104454577 CTGTATGTAGTGAAGGGAGTGGG + Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046303956 8:112337280-112337302 ATGTGTGTGGGGAAGGGAAGGGG - Intronic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1046827462 8:118706958-118706980 GTGTGTGTGGTGTAGGGAAAGGG + Intergenic
1046829633 8:118730340-118730362 GTGAGGGTGGGGAAGGGAGATGG - Intergenic
1047668250 8:127116192-127116214 GTGTGTTTGGAGAAGGCTGAGGG + Intergenic
1048296426 8:133217923-133217945 GTGTGTGTGGAGAAGGGAGTGGG - Intronic
1048303433 8:133267467-133267489 CAGAGAGGGGAGAAGGGAGATGG - Intronic
1048744250 8:137595773-137595795 CTGTCTTTGGAGAAGGGAGGTGG + Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1050776043 9:9261668-9261690 GTGTGTGTTCAGGAGGGAGAGGG + Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051299769 9:15636196-15636218 CTGGGTATGGAGTAGGTAGATGG + Intronic
1051604796 9:18908647-18908669 GTGTGTGTGGAGTGGGGAGGGGG - Exonic
1053152552 9:35752158-35752180 CTGTTACTGGAGAAGGGAGAGGG + Intronic
1053277492 9:36794438-36794460 CAGTGTGTGGAGGAGGCAGGAGG - Intergenic
1054337870 9:63823833-63823855 CTGTGTGTGTAGTAGGTACACGG - Intergenic
1054832562 9:69643045-69643067 CTGTGTGTGGAGGGGGGAGGAGG - Intronic
1054861872 9:69962195-69962217 CTGAGTGGGGAGAGGGGACAGGG + Intergenic
1055426973 9:76206446-76206468 CTGGGTGTGGTGCAGGGAAAGGG - Intronic
1056823589 9:89861299-89861321 CTCCATGTGGAAAAGGGAGAAGG + Intergenic
1057190383 9:93083972-93083994 GTGTGTGTGGAGGCTGGAGATGG + Intronic
1057195515 9:93114043-93114065 CTCAGGGTGGAGGAGGGAGAGGG - Intergenic
1057546503 9:96022902-96022924 GTGTCTGTGGGGGAGGGAGAGGG - Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057652628 9:96931802-96931824 CTGTGTGTTGGGCCGGGAGAGGG - Exonic
1057837312 9:98455554-98455576 GTGTGTGTGGTGGAGGGAGGGGG + Intronic
1058445791 9:105053776-105053798 CTGAGTGAGGAGATGGGAGGAGG - Intergenic
1058828037 9:108792612-108792634 CTGTCAGTAGAGAAGGGAGCTGG - Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059447586 9:114348490-114348512 CTGTGAGTGGAGAGCGGACAGGG + Intronic
1059645491 9:116262676-116262698 CTGGGTGGGGAGAATTGAGAGGG + Intronic
1059960727 9:119561783-119561805 CGGGGTGTGGGGAAGGGGGAGGG + Intergenic
1060066937 9:120510534-120510556 GTGTGTTTGGTGAAGGGTGAGGG - Intronic
1060183213 9:121547920-121547942 ATGGGAGTGGAGAAGGGAGATGG - Intergenic
1060224012 9:121780554-121780576 GAGTGTGTGGAGCAAGGAGAAGG + Intronic
1060812237 9:126616279-126616301 GTGTGTATTGAGGAGGGAGATGG + Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1061377107 9:130233067-130233089 CTGTGTGTGGATGCGGAAGAAGG - Exonic
1061385001 9:130284584-130284606 ATATCTGTGGAGAAGAGAGAGGG - Intronic
1061679546 9:132236177-132236199 CTGTGGTGGGTGAAGGGAGAAGG + Intronic
1061816719 9:133201737-133201759 CTGTATGTGCAAAAGAGAGATGG - Intergenic
1061859911 9:133462680-133462702 CTGTGGGTGGAGGAGGGAGTTGG + Intronic
1062370466 9:136236186-136236208 CTCTGTGCGGAGCAGGGAGTGGG - Intronic
1062546668 9:137066657-137066679 CTGGGTGTGCAGAAGAGAGCTGG - Intronic
1062733374 9:138121286-138121308 CTGTGTGCGGGGGAGGGCGATGG - Intronic
1202784659 9_KI270718v1_random:37432-37454 CTGTGTGTGTAGTAGGTACATGG + Intergenic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1185562348 X:1069478-1069500 CTGGGTGGGGCGAAGGGAGGGGG + Intergenic
1186218680 X:7326471-7326493 CTGAGTGTGGACAAAGGAAAAGG - Intronic
1186317545 X:8387029-8387051 TTGTGTGTGGGGGAGAGAGACGG + Intergenic
1186532219 X:10308901-10308923 ATGTGTGTGGTGAGGGGAGGGGG - Intergenic
1186965727 X:14784415-14784437 CTGGTTTTGGAGATGGGAGAAGG - Intergenic
1186981473 X:14961945-14961967 CTGTGTGTGGAGGAAGAAAATGG - Intergenic
1187151419 X:16685210-16685232 CTGTCTATGGAGGAGGGAGAAGG - Intronic
1188182697 X:27075335-27075357 CTGTCAGTGGAGAAAGGAGCTGG - Intergenic
1188660600 X:32753099-32753121 CTTGTTGTGGAGAAGGAAGAGGG - Intronic
1188732499 X:33668261-33668283 GTGTGTGTGTATATGGGAGATGG + Intergenic
1189117019 X:38353380-38353402 GTGTCTGTGGGGAAGGGAAAGGG + Intronic
1189169750 X:38897716-38897738 ATGTGTGAGGAGGAAGGAGAAGG - Intergenic
1189217737 X:39341623-39341645 CTGGGTGGGCAGAAGGGATATGG - Intergenic
1189324211 X:40103149-40103171 CTGTGTGCGGCGGAGGGAGGAGG + Intronic
1189609865 X:42720892-42720914 GTGGGTGTGGAGAGGGGGGAGGG - Intergenic
1189655129 X:43237092-43237114 CCATGTTTGGGGAAGGGAGAGGG - Intergenic
1189823975 X:44898516-44898538 CTGTGTGTGCAGGAGGGAGGTGG + Intronic
1190066633 X:47245870-47245892 TTGAGTGTGGAGGAGGGAGGAGG - Intronic
1190127811 X:47722050-47722072 GTGTGTCTGGATAAGGGATAAGG + Intergenic
1190183986 X:48219152-48219174 GTGTGTGTGGTGGAGGGAGGAGG + Intronic
1190204842 X:48394540-48394562 GTGTGTGTGGTGGAGGGAGGGGG + Intergenic
1190205694 X:48400863-48400885 GTGTGTGTGGTGGAGGGAGGGGG - Intergenic
1190259755 X:48790457-48790479 GTGTGTGTGGATGGGGGAGAGGG + Intronic
1190404016 X:50068232-50068254 GTGTGTGTGGAGGTGGGGGAGGG - Intronic
1190665875 X:52695586-52695608 GTGTGTGTGGTGGAGGGAGGGGG - Intronic
1190673543 X:52762824-52762846 GTGTGTGTGGTGGAGGGAGGGGG + Intronic
1192180683 X:68913867-68913889 AGGTGTGTGGAGATGTGAGAGGG + Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1193023759 X:76821701-76821723 GTCTGTTTGGAGAAAGGAGAAGG - Intergenic
1193208143 X:78773181-78773203 ATTTGTGTGGACAAAGGAGAAGG + Intergenic
1194125175 X:90007983-90008005 CTGTGTATGGAAGAGGGAGATGG + Intergenic
1194709286 X:97215471-97215493 CTGTCTGTGGAAAAGAGAAATGG + Intronic
1194711527 X:97242219-97242241 CTGGGTTTGGAGGTGGGAGATGG - Intronic
1195205462 X:102595426-102595448 CTGGATGGGTAGAAGGGAGAGGG - Intergenic
1195377267 X:104240020-104240042 GTATGTGTGGAAAAGGAAGAGGG + Intergenic
1197573438 X:128178256-128178278 CTGGGTTTGGAGAATGGAGGTGG + Intergenic
1199001758 X:142647234-142647256 ATGTGTGTACAGCAGGGAGAAGG - Intergenic
1199600572 X:149539335-149539357 CTGTGGGTGGAGCTGGGGGAGGG - Intergenic
1199650010 X:149940606-149940628 CTGTGGGTGGAGTTGGGGGAGGG + Intergenic
1199843701 X:151675560-151675582 TGGGGTGTGGAGGAGGGAGAAGG - Intronic
1199942714 X:152640691-152640713 GGGAGTGTGGAGGAGGGAGAAGG - Intronic
1200775594 Y:7167482-7167504 ATGTGTGTGGCGAGGGGAGCAGG + Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic