ID: 1173550510

View in Genome Browser
Species Human (GRCh38)
Location 20:43930001-43930023
Sequence AAAAATACTCAGAAGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1635
Summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 1563}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173550510_1173550514 27 Left 1173550510 20:43930001-43930023 CCCAGCTGCTTCTGAGTATTTTT 0: 1
1: 0
2: 4
3: 67
4: 1563
Right 1173550514 20:43930051-43930073 TACTTGGTTGCTCCCCCTTCAGG 0: 1
1: 0
2: 1
3: 6
4: 63
1173550510_1173550513 11 Left 1173550510 20:43930001-43930023 CCCAGCTGCTTCTGAGTATTTTT 0: 1
1: 0
2: 4
3: 67
4: 1563
Right 1173550513 20:43930035-43930057 CATATATCTGTGAAATTACTTGG 0: 1
1: 0
2: 0
3: 27
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173550510 Original CRISPR AAAAATACTCAGAAGCAGCT GGG (reversed) Intronic
900930895 1:5736804-5736826 AAAAATACATAGAAATAGCTGGG - Intergenic
901070954 1:6518091-6518113 AAAAATACAAAAAATCAGCTGGG - Intronic
901076601 1:6559050-6559072 AAAAATACAAAGAATTAGCTGGG - Intronic
901542875 1:9932182-9932204 AAAAATACAAAAAATCAGCTGGG + Intronic
901746095 1:11374735-11374757 AAAAGAACTCATAAGCAGTTTGG + Intergenic
901831749 1:11896816-11896838 AAAAATACACAAAATTAGCTGGG + Intergenic
901887615 1:12233885-12233907 AAAAATACAAAAAATCAGCTGGG + Intronic
901894696 1:12300966-12300988 AAAAATAGGCATAAGTAGCTGGG - Intronic
902043106 1:13506616-13506638 AAAAATACTAAAAACTAGCTGGG - Intronic
902134905 1:14296794-14296816 AAAAATACAAAAAAGTAGCTAGG - Intergenic
902166860 1:14579462-14579484 AAAAATACAAAAAAGCAGCTGGG + Intergenic
902415168 1:16234241-16234263 AAAAATACCAAAAATCAGCTGGG + Intronic
902605603 1:17567525-17567547 AAAAATACAAAAAAGGAGCTGGG - Intronic
902889469 1:19431558-19431580 AAAAATACAAAAAATCAGCTGGG + Intronic
902909009 1:19581309-19581331 AAAAATACAAAAAAGCAGCCAGG - Intergenic
903076926 1:20777617-20777639 AAAAATACAAAAAATCAGCTGGG - Intronic
903133090 1:21291664-21291686 AAAAATACAAAAAATCAGCTGGG + Intronic
903467904 1:23565143-23565165 AAAAATACTGAAATTCAGCTGGG + Intergenic
903645701 1:24894890-24894912 AAAAAAACTGAGAAACAGGTTGG - Intergenic
903714289 1:25352332-25352354 AAAAATACAAAAAATCAGCTGGG + Intronic
903733388 1:25514575-25514597 AAAAATACAAAGAATTAGCTGGG - Intergenic
903866322 1:26401038-26401060 AAAAATACAAAAAATCAGCTGGG - Intergenic
903890720 1:26568587-26568609 AAAAATACAAAGAATTAGCTGGG + Intronic
903939344 1:26918432-26918454 AAAAATACGAAAAATCAGCTGGG - Intronic
904240491 1:29141486-29141508 AAAAATACAAAAAAGTAGCTAGG - Intergenic
904645961 1:31966551-31966573 AAAAATACACAAAATTAGCTGGG - Intergenic
904646142 1:31968020-31968042 AAAAATACACAAAATTAGCTGGG + Intergenic
905299284 1:36975453-36975475 AAAAATACAAAAAATCAGCTGGG - Intronic
905502447 1:38450452-38450474 AAAAATACACAAAATTAGCTGGG + Intergenic
905977000 1:42183113-42183135 AAAAATACAAAGAATTAGCTGGG + Intronic
906118348 1:43370199-43370221 AAAAATACAAAAAATCAGCTGGG + Intergenic
906147838 1:43570418-43570440 AAAGAGGCTCAGAATCAGCTTGG + Intronic
906821589 1:48935796-48935818 AAAAATACAAAAAATCAGCTGGG + Intronic
906994466 1:50776962-50776984 AAAAATATACAGAATCAGCCAGG + Intronic
907008522 1:50941000-50941022 AAAAATACTTGGATGCAGTTTGG + Intronic
907060181 1:51414250-51414272 AAAAATACAAAAAATCAGCTGGG + Intronic
907105802 1:51881471-51881493 AAAAATACAAAGAATTAGCTGGG + Intergenic
907200468 1:52722392-52722414 AAAAATACCAAAAAGTAGCTGGG - Intergenic
907215782 1:52862470-52862492 AAAAATACAAAAAAGTAGCTGGG - Intronic
907229920 1:52987204-52987226 AAAAATATTCAGAAGAGGCAGGG - Intronic
907416255 1:54316183-54316205 AAAAATACAAAAAATCAGCTGGG + Intronic
907521822 1:55028806-55028828 AAAAATACAAAAAACCAGCTGGG - Intergenic
907742632 1:57182044-57182066 AAAAATACAAAAAATCAGCTGGG - Intronic
907998955 1:59661878-59661900 AAAAATACAAAAAATCAGCTGGG - Intronic
908150872 1:61301372-61301394 ATAAATCCTGAGAAGCAGGTAGG + Intronic
908214830 1:61940553-61940575 AAAAATACAAAAAATCAGCTGGG + Intronic
908335688 1:63120578-63120600 AAAAATACCCAAAATTAGCTGGG + Intergenic
908548617 1:65187184-65187206 AAAAATACTAAAAATTAGCTGGG + Intronic
908563478 1:65330626-65330648 AAAAATACACAAAATTAGCTGGG - Intronic
908612425 1:65877452-65877474 AAAAATACAAAGAATTAGCTGGG + Intronic
908714839 1:67058502-67058524 AAAAATTCTGAGAATCAGCATGG + Intergenic
908838979 1:68259323-68259345 AAAAATACACAAAATTAGCTGGG - Intergenic
908966104 1:69765488-69765510 AAAAATATTCACAAAGAGCTTGG - Intronic
909312664 1:74173134-74173156 AAAAATACAAAAAATCAGCTGGG + Intronic
909503081 1:76357293-76357315 AAAAATACAAAAAAGTAGCTGGG - Intronic
909519209 1:76547691-76547713 AAAAATACAAAAAAGTAGCTGGG + Intronic
909786048 1:79615079-79615101 AAAAACTCTCAAAACCAGCTTGG - Intergenic
909853972 1:80505039-80505061 AAACACTCCCAGAAGCAGCTTGG + Intergenic
909950214 1:81710457-81710479 AAAAATACAAAAAATCAGCTAGG + Intronic
910088782 1:83436850-83436872 AAAAATACAAAAAAGTAGCTGGG - Intergenic
910416424 1:87004045-87004067 AAAAAGATTCAGAAGCTGTTTGG - Intronic
910890547 1:92014962-92014984 AAAAATACAAAAAATCAGCTGGG + Intergenic
911125079 1:94333859-94333881 AAAAAAAGTCAGATGCAGCTGGG + Intergenic
911756366 1:101561200-101561222 AAAAGTACACAGAAAGAGCTGGG - Intergenic
911923011 1:103791077-103791099 AAAAATACAAAAAAGTAGCTGGG + Intergenic
912317625 1:108680528-108680550 AAAAATACTAAAAATCAGCCGGG + Intergenic
912326277 1:108766011-108766033 AAAAATACAAAAAATCAGCTGGG - Intronic
912780530 1:112542958-112542980 AAAAATACAAAAAAGTAGCTGGG - Intronic
912810780 1:112792784-112792806 AAAAATACAAAAAATCAGCTGGG + Intergenic
912923418 1:113891717-113891739 AAAAATACAAAGAATTAGCTGGG - Intergenic
913018727 1:114765201-114765223 AAAAAAACTCAAAATTAGCTGGG - Intergenic
913154545 1:116082465-116082487 AAAAATACAAAGAATTAGCTGGG - Intergenic
913299126 1:117352226-117352248 AAAAATACACAGAATTAGCTGGG - Intergenic
914095870 1:144544020-144544042 AAAAATACAAAAAAGTAGCTGGG - Intergenic
914302653 1:146389945-146389967 AAAAATACAAAAAAGTAGCTGGG + Intergenic
914311365 1:146469966-146469988 AAAAATACAAAAAATCAGCTGGG + Intergenic
914320624 1:146556100-146556122 GTAAATAATCAGAAACAGCTCGG + Intergenic
914438983 1:147686099-147686121 AAAAATACAAAAAAGTAGCTGGG + Intergenic
914810845 1:151026943-151026965 AAAAATACAAAGAATTAGCTGGG - Intronic
914991634 1:152503929-152503951 TAAAATACTGAGAAGCAAATTGG + Intergenic
915378040 1:155415220-155415242 AAAAATACACAAAATTAGCTGGG + Intronic
915381163 1:155441924-155441946 AAAAATACAAAAAAGTAGCTGGG - Intronic
915467871 1:156107924-156107946 AAAAATACAAAAAATCAGCTGGG - Intronic
915901385 1:159848910-159848932 AAAAATACTAAAAATTAGCTGGG + Intronic
915987814 1:160483733-160483755 AAAGAGCCTGAGAAGCAGCTAGG + Intergenic
916178293 1:162061473-162061495 AAAAATACAAAAAAGTAGCTGGG - Intergenic
916227851 1:162507745-162507767 AAAAATACACAAAATTAGCTGGG - Intronic
916230670 1:162538182-162538204 AAAAATACAAAAAATCAGCTGGG + Intergenic
917097722 1:171416025-171416047 AAAAATACAAAAAATCAGCTGGG + Intergenic
917320942 1:173780888-173780910 AAAAATACAAAAAAACAGCTGGG - Intronic
917341756 1:173986721-173986743 AAAAATACACAGAATCAGCCAGG - Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917818081 1:178730991-178731013 AAGAATTCTCAGAATCAGCCAGG - Intronic
917822164 1:178774112-178774134 AAAAATACCCAAAATTAGCTGGG + Intronic
917919366 1:179737538-179737560 AAAAAGACCAAAAAGCAGCTGGG + Intergenic
917938630 1:179894088-179894110 AAAAATACAAAAAAGTAGCTGGG + Intronic
918162822 1:181917271-181917293 AAAAAGACCCAGCAGCAGCGTGG + Intergenic
918357365 1:183718083-183718105 AAAAATACAAAAAATCAGCTGGG + Intronic
918380893 1:183954044-183954066 AACAGTATTCAGAAGGAGCTTGG - Intronic
918420805 1:184362655-184362677 CAAACTACTCAGAAGTAGATGGG - Intergenic
918494662 1:185121296-185121318 CAAAATATTCAGAAGCTGCCAGG + Intronic
918562192 1:185881866-185881888 AAAAATATTCAGAACAAGTTTGG - Intronic
919204966 1:194410015-194410037 AAAAATACCCAAAATTAGCTGGG - Intergenic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
919590430 1:199495100-199495122 AAAAATACAAAGAATTAGCTGGG + Intergenic
919708325 1:200700465-200700487 AAAAATACACAAAATTAGCTGGG - Intergenic
919870996 1:201821254-201821276 AAAAATAGTAAGAGCCAGCTAGG - Exonic
920149941 1:203897711-203897733 AAAAATACAAAAAATCAGCTGGG + Intergenic
920233293 1:204484571-204484593 AAAAATACTAAAAATTAGCTGGG + Intronic
920247319 1:204598168-204598190 ACAAATACAAAAAAGCAGCTGGG - Intergenic
920328905 1:205190463-205190485 AAAAATACAAAAAATCAGCTGGG + Intronic
920896454 1:210055660-210055682 AAAAATACAAAGAATTAGCTGGG + Intronic
921024584 1:211265556-211265578 AAAAATACAAAAAATCAGCTGGG + Intronic
921029122 1:211321903-211321925 AAAAATACAAAAAAGTAGCTGGG - Intergenic
921215093 1:212929805-212929827 AAAAATACAAAAAATCAGCTGGG + Intergenic
921349513 1:214221439-214221461 AAAAATACTAAAAATTAGCTGGG - Intergenic
921651023 1:217678367-217678389 AAAAATACACAAAATTAGCTGGG - Intronic
921860982 1:220042018-220042040 AAAAATACTAAAAATTAGCTGGG + Intronic
922292123 1:224216987-224217009 AAAAATACTAAAAATTAGCTGGG + Intergenic
922298347 1:224272182-224272204 AAAAATACAAAAAATCAGCTGGG + Intronic
922303153 1:224321089-224321111 AAAAATACAAAGAATCAGCGGGG + Intronic
922453265 1:225753760-225753782 AAAAATACAAAAAAGCAGCAGGG - Intergenic
922519842 1:226240371-226240393 AAAAAAACTTAGAACAAGCTGGG - Intronic
922520174 1:226243533-226243555 AAAAATACACAAAATTAGCTGGG + Intronic
923150376 1:231227747-231227769 AAAAATACAAAAAAGTAGCTGGG - Intronic
923424141 1:233851892-233851914 AAAAATACTCTGAAATATCTGGG - Intergenic
924047823 1:240050464-240050486 GAGAAGACTCAGAAGCTGCTGGG + Intronic
924103286 1:240625871-240625893 AAAAATACAAAGAAGTAGCCGGG + Intergenic
924247133 1:242096117-242096139 AAAAATACAAAGAATTAGCTGGG - Intronic
924331388 1:242944123-242944145 AAAAATACAAAAAACCAGCTGGG - Intergenic
924742496 1:246803319-246803341 AGAAAAACTTAAAAGCAGCTGGG + Intergenic
924759744 1:246972516-246972538 AAAAAAACTCAGAGGCCACTGGG - Intronic
924803625 1:247345744-247345766 AAAAATCATCTGAAGTAGCTGGG - Intergenic
1062772587 10:114690-114712 TAAAATACTTAGAAACAGATTGG - Intergenic
1063001352 10:1926692-1926714 AAAAATTTTCAAAATCAGCTGGG + Intergenic
1063128156 10:3153456-3153478 AAAAATACAAAAAATCAGCTGGG + Intronic
1063147559 10:3309620-3309642 AAAAATACAAAAAATCAGCTGGG + Intergenic
1063239041 10:4149456-4149478 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239045 10:4149482-4149504 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239049 10:4149508-4149530 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239053 10:4149534-4149556 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239057 10:4149560-4149582 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063345808 10:5311424-5311446 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1063410549 10:5833490-5833512 AAAAATACAAACAAGTAGCTGGG + Intronic
1063649028 10:7915099-7915121 AAAAATACAAAAAAGTAGCTGGG - Intronic
1063650779 10:7934979-7935001 ATAAATACTAAGAAGAGGCTGGG + Intronic
1063972512 10:11391045-11391067 AAAAATAACTAAAAGCAGCTGGG + Intergenic
1064071215 10:12229593-12229615 AAAAATACTCTGCAGCACCAAGG - Intronic
1064182531 10:13131078-13131100 AAAAATACAAAAAATCAGCTGGG - Intronic
1064214201 10:13385984-13386006 AAAAATACAAAGAATTAGCTGGG + Intergenic
1064378555 10:14819252-14819274 AAAAACACTCATAGGCAACTTGG - Intronic
1064614010 10:17134087-17134109 AAAAATACAAAAAATCAGCTGGG + Intergenic
1065036301 10:21642359-21642381 AAAAATACGAAGAAGTAGCCGGG + Intronic
1065054737 10:21833308-21833330 AAAAATACAAAAAATCAGCTGGG + Intronic
1065184056 10:23155513-23155535 AAAAATACACAGAATTTGCTGGG + Intergenic
1065221492 10:23500511-23500533 AAAAATACTAAAAATTAGCTGGG - Intergenic
1065334538 10:24642943-24642965 AAAAATTCCCAAAACCAGCTTGG + Intronic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1065571920 10:27079994-27080016 AAAAATACAAAGAATTAGCTGGG + Intronic
1065587100 10:27229429-27229451 AAAAATACTAAAAATTAGCTGGG + Intronic
1065600352 10:27361691-27361713 AAAAATACCCGGAAGAAACTAGG - Intergenic
1065696204 10:28382399-28382421 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1065942012 10:30573510-30573532 AAAAATACAAAAAATCAGCTGGG - Intergenic
1066273765 10:33848362-33848384 AAAAATACAAAAAATCAGCTGGG - Intergenic
1066348362 10:34611985-34612007 AAAAATACAAAAAATCAGCTGGG - Intronic
1066406243 10:35121384-35121406 AAAAATACAAAAAATCAGCTGGG - Intergenic
1066574882 10:36814437-36814459 AAAAATACACAAAATTAGCTGGG + Intergenic
1067102129 10:43341397-43341419 AAAAATACAAAAAATCAGCTGGG + Intergenic
1067912891 10:50364961-50364983 AAAGATAATCAAAAGCAACTAGG + Intronic
1068097464 10:52510047-52510069 AAAAATACAAAGAATTAGCTGGG + Intergenic
1068107560 10:52638179-52638201 ATAAATACTCAGCATCAGCCGGG + Intergenic
1068505416 10:57894054-57894076 AAAAATACAAAAAATCAGCTGGG - Intergenic
1068763861 10:60741534-60741556 AAAGATACTCATATGGAGCTGGG + Intergenic
1068888681 10:62125606-62125628 AAAAATACAAAGAATTAGCTGGG + Intergenic
1069055302 10:63838655-63838677 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1069217008 10:65833440-65833462 AAAAATACAAAAAAACAGCTGGG - Intergenic
1069272380 10:66545645-66545667 AAAAATACTCATATGTTGCTGGG - Intronic
1069349124 10:67503994-67504016 AAAAATACAAAAAATCAGCTGGG + Intronic
1069441034 10:68428164-68428186 AAAAATACAAAGAATTAGCTGGG + Intronic
1069494452 10:68890315-68890337 AATAATAAGCAGCAGCAGCTGGG - Intronic
1069500453 10:68948435-68948457 AAAAATACAAAAAATCAGCTGGG - Intergenic
1069515716 10:69075382-69075404 AAAAATACAAAAAATCAGCTGGG + Intergenic
1069518096 10:69095749-69095771 AAAAATACTAAAAATTAGCTGGG + Intronic
1069568998 10:69483147-69483169 AAAAATACAAAAAAGCAGCCGGG - Intronic
1069759999 10:70803090-70803112 AAAAATACAAAAAATCAGCTGGG - Intergenic
1069929302 10:71871815-71871837 AAAAATACACAAAATTAGCTGGG + Intergenic
1070058582 10:72958662-72958684 AAAAATACAAAAAATCAGCTGGG + Intergenic
1070211844 10:74331643-74331665 AAAAATACAAAGAATTAGCTGGG - Intronic
1070335026 10:75447733-75447755 AAAAATACACATAATTAGCTGGG + Intronic
1070945377 10:80386942-80386964 AAAAATACAAAGAATTAGCTGGG + Intergenic
1071849195 10:89551280-89551302 AAAAATACTAAAAATTAGCTAGG + Intronic
1071928333 10:90436952-90436974 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1072108655 10:92297325-92297347 AAAAATACAAAAAATCAGCTAGG - Intronic
1072134802 10:92535262-92535284 AAAAATACAAAGAATTAGCTGGG - Intronic
1072279707 10:93854583-93854605 AAAAATACTAAAAATTAGCTGGG - Intergenic
1072316936 10:94212415-94212437 AAAAATACAAAAAATCAGCTGGG - Intronic
1072346791 10:94515506-94515528 AAAAATACAAAAAATCAGCTGGG - Intronic
1072502891 10:96036376-96036398 AAAAATACAAAAAATCAGCTGGG - Intergenic
1072621505 10:97082593-97082615 AAAAATACAAAGAATTAGCTGGG - Intronic
1072960197 10:99922489-99922511 AAAAAAAAACAGCAGCAGCTAGG - Intronic
1073032580 10:100539070-100539092 AAAAATACACAAAATTAGCTGGG - Intronic
1073056292 10:100705060-100705082 AAAGATACACACACGCAGCTGGG + Intergenic
1073236910 10:102024482-102024504 AAAAATACTCAGAATCCTCCGGG + Intronic
1073272003 10:102272832-102272854 AAAAATACTCACAAGCCCCTAGG - Intronic
1073335942 10:102709063-102709085 AAAAATACACAAAATTAGCTGGG - Intronic
1073356983 10:102863172-102863194 AAAAATACAAAGAATTAGCTGGG + Exonic
1073525218 10:104174892-104174914 AAAAATACAAAAAATCAGCTGGG + Intronic
1074034820 10:109727923-109727945 AAAAATAGCCTGAAGCAGCTGGG + Intergenic
1074256579 10:111808650-111808672 AAAAATACCTAGAAGCAGAATGG + Intergenic
1074778487 10:116783861-116783883 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1075084118 10:119402691-119402713 AAAAATACAAAAAATCAGCTGGG + Intronic
1075309240 10:121398124-121398146 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1075597170 10:123740511-123740533 AAAAATACAAAAAATCAGCTGGG - Intronic
1075634908 10:124024002-124024024 AAAAATACAAAAAATCAGCTGGG - Intronic
1075794775 10:125112092-125112114 AAAAAAAGTCAAATGCAGCTGGG - Intronic
1075906544 10:126086514-126086536 AAAAATACAAAGAATCAGCCAGG + Intronic
1076477550 10:130762970-130762992 AAAAATACAAAAAATCAGCTGGG + Intergenic
1076528966 10:131131938-131131960 AGAAATACATAAAAGCAGCTAGG + Intronic
1076622370 10:131799810-131799832 AAAATTACTCAGGAGCACCTTGG + Intergenic
1076639849 10:131907580-131907602 AAAAATACAAAAAATCAGCTGGG + Intronic
1077067732 11:650792-650814 AAAAATACAAAGAATTAGCTGGG + Intronic
1077494083 11:2877350-2877372 AAAAATACAAAAAATCAGCTGGG - Intergenic
1077558534 11:3240594-3240616 AAAAATACAAAAAATCAGCTGGG - Intergenic
1078213780 11:9293875-9293897 AAAAAGAATCAGAAGTAGCCAGG - Intronic
1078295408 11:10063516-10063538 AAAAATACAAAGAAATAGCTGGG - Intronic
1078505343 11:11936646-11936668 AGAAGTACTCAGCAACAGCTTGG + Intronic
1078584864 11:12575206-12575228 AAAAAAACTTAAAAGCAGCCAGG + Intergenic
1078780052 11:14429637-14429659 AAAAATACAAAGAATTAGCTGGG - Intergenic
1079227810 11:18622789-18622811 AAAAATACAAAAAATCAGCTGGG + Intronic
1079878663 11:25894312-25894334 AAAAATACACAAAATTAGCTGGG - Intergenic
1080003851 11:27383041-27383063 AAAAATAATCAGAAGGACCAGGG + Intronic
1080594445 11:33757795-33757817 AAAAATACAAAAAAGTAGCTGGG + Intronic
1081272355 11:41100404-41100426 AAAAATACAAAAAAGTAGCTGGG + Intronic
1081412569 11:42777038-42777060 AAAAATACAAAAAAGTAGCTTGG - Intergenic
1081466607 11:43324836-43324858 AAAAATACAAAAAATCAGCTGGG - Intronic
1081750092 11:45504230-45504252 AAAAATACAAAGAATTAGCTGGG - Intergenic
1082019247 11:47517811-47517833 AAAAATACAAAAAAGTAGCTGGG - Intronic
1082285257 11:50311033-50311055 AAAAATACAAAAAATCAGCTGGG - Intergenic
1082629910 11:55529846-55529868 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1082821853 11:57549492-57549514 AAAAAGACTCAAACCCAGCTGGG - Intronic
1083411133 11:62493171-62493193 AAAAATACTAAAAATTAGCTGGG - Intronic
1083440738 11:62674526-62674548 AAAAATACAAAGAATTAGCTGGG + Intergenic
1083442374 11:62685638-62685660 AAAAATACAAAAAATCAGCTGGG - Intergenic
1083577643 11:63803820-63803842 AAAAATACAAAGAATTAGCTGGG - Intergenic
1083610816 11:64003376-64003398 AAAAATACAAAAAATCAGCTGGG - Intronic
1083751143 11:64761280-64761302 AAAAGTTCTCAGAAACAGCTTGG - Intergenic
1083844572 11:65323679-65323701 AAAAATACACAAAATTAGCTGGG - Intergenic
1083876662 11:65527577-65527599 AAAAATACAAAAAATCAGCTGGG + Intronic
1083937659 11:65878651-65878673 AAAAATACAAAAAAGCAGCTGGG - Intergenic
1083948557 11:65940707-65940729 AAAAATACAAAAAATCAGCTGGG + Intergenic
1084069368 11:66724260-66724282 AAAAATACAAAAAATCAGCTGGG + Intronic
1084091970 11:66884768-66884790 AAAAGGACTCAGACGCAGCCTGG + Intronic
1084293008 11:68188183-68188205 AAAAATACAAAAAATCAGCTGGG - Intronic
1084347216 11:68561389-68561411 AAAAATATTCAGAGAAAGCTGGG - Intronic
1084498820 11:69522439-69522461 TAAATTACTCAGACTCAGCTGGG - Intergenic
1084535747 11:69755652-69755674 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1084733210 11:71087922-71087944 AAAAATAGTCAAATGCAGCCAGG - Intronic
1084929775 11:72545730-72545752 AAATATACGAAGAAGGAGCTGGG - Intergenic
1085019524 11:73196719-73196741 AAAACTCCTCTGGAGCAGCTGGG - Intergenic
1085026048 11:73237232-73237254 AAAAAAACTCAGAAGGACATCGG - Intergenic
1085087711 11:73682500-73682522 AAAAATACACAAAATTAGCTGGG + Intronic
1085168228 11:74424026-74424048 AAAAATACACAAAACCAGCCAGG - Intergenic
1085438216 11:76530318-76530340 AAAAATACAAAAAATCAGCTGGG - Intronic
1085613148 11:77971485-77971507 AAAAATACAAAAAATCAGCTGGG + Intronic
1085658665 11:78341700-78341722 ACAAATATTCAGAACCTGCTAGG + Intronic
1085719358 11:78899412-78899434 AAAAATAAACAAAATCAGCTGGG + Intronic
1086178841 11:83925159-83925181 TCAGATACTCACAAGCAGCTGGG + Intronic
1086402815 11:86474334-86474356 GAAAACACTCAGGAACAGCTTGG + Intronic
1086512114 11:87570114-87570136 AAAAATACACAAAATTAGCTGGG + Intergenic
1086662447 11:89437065-89437087 AAAAATACTCTTTATCAGCTGGG + Intronic
1086989951 11:93291931-93291953 AAAATTACTAAGAAGCATCAAGG + Intergenic
1087029716 11:93690393-93690415 AAAAATACTAAAAAGTAGCTGGG + Intronic
1087063259 11:94003658-94003680 AAGATTACTCAGGAGCAGCACGG + Intergenic
1087111689 11:94476699-94476721 AAAAAAACCCTGAAACAGCTAGG - Intronic
1087124806 11:94614466-94614488 AAAAATACACAAAATTAGCTGGG - Intronic
1087392774 11:97559725-97559747 AAAAATACTAAAAATCAGCTGGG - Intergenic
1087526815 11:99324800-99324822 AAAAATACAAAAAAGTAGCTGGG - Intronic
1088055519 11:105571684-105571706 AAAAATACAAAAAATCAGCTGGG - Intergenic
1088269404 11:108018369-108018391 AAAAATACTCAGAAAAGGCTGGG + Intronic
1088459471 11:110067344-110067366 AAAAATACACAAAATTAGCTAGG + Intergenic
1088470063 11:110181321-110181343 AAAAATACAAAAAATCAGCTGGG - Intronic
1088529972 11:110798052-110798074 AAAAATACAAAAAATCAGCTGGG + Intergenic
1088790413 11:113220765-113220787 AAAAATACACAAAATTAGCTGGG - Intronic
1089266391 11:117265572-117265594 AAAAATACCAAAAATCAGCTGGG - Intronic
1089425994 11:118375518-118375540 AAAAATACACAAAATTAGCTGGG - Intronic
1089444833 11:118543644-118543666 AAAAATACAAAGAATTAGCTGGG - Intronic
1089475273 11:118754803-118754825 AAAAGTATTGAGGAGCAGCTGGG - Exonic
1089508727 11:118982078-118982100 AAAAATACACAAAATTAGCTGGG - Intergenic
1089742312 11:120593021-120593043 AAAAATACAAAAAATCAGCTGGG + Intronic
1089914463 11:122139427-122139449 AAACACACTCAGAAGCCGGTGGG + Intergenic
1089983802 11:122794364-122794386 AAAAATACAAAAAATCAGCTGGG - Intronic
1089989383 11:122844518-122844540 AAAAATACTGAGAAACAGGAAGG - Intronic
1090294171 11:125571715-125571737 AAAAATACACAAAATTAGCTGGG + Intronic
1090581486 11:128165012-128165034 AAAAATACACAAAATTAGCTGGG + Intergenic
1090651397 11:128809864-128809886 AAAAATACCCAGAATATGCTGGG - Intronic
1090709201 11:129371108-129371130 ATAGATATTCAGAAGCAGCCAGG - Intergenic
1090775074 11:129957476-129957498 AAAAATACAAAAAAGTAGCTGGG - Intronic
1091370997 11:135057718-135057740 GAAAAGACACAGAAGCTGCTGGG - Intergenic
1091717282 12:2787901-2787923 AAAAATACACAAAATTAGCTGGG - Intergenic
1091774770 12:3177296-3177318 AAAAATACACAGAATTAGCTGGG - Intronic
1091974705 12:4814924-4814946 AAAAATACACAGAAAAAGCGAGG - Intronic
1092368235 12:7894858-7894880 AAAAATACAAAGAATTAGCTAGG + Intergenic
1092390297 12:8071344-8071366 AAAAATACAAAAAATCAGCTGGG + Intergenic
1092612237 12:10184821-10184843 AAAAATACTAAGAAAGAACTTGG - Intronic
1093206531 12:16258320-16258342 ACAAATACTCAGAAATATCTGGG + Intronic
1093272480 12:17081652-17081674 ATTAATAATCAAAAGCAGCTTGG + Intergenic
1093424769 12:19016001-19016023 AAAAATACACAGAATTAGCTGGG + Intergenic
1093582249 12:20796217-20796239 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1094178869 12:27569717-27569739 AAAAATACAAAAAAGTAGCTGGG - Intronic
1094695413 12:32813482-32813504 AAAAATAGTAGGAAGAAGCTGGG + Intronic
1095036549 12:37385235-37385257 AAACATTCTCAGAAACTGCTTGG + Intergenic
1095061225 12:37692585-37692607 AAGAATACTCAGAAACTTCTTGG - Intergenic
1095063233 12:37729618-37729640 AAAAATACACAGAAGCATTCTGG + Intergenic
1095248344 12:39947819-39947841 AAAAATACACAAAATTAGCTGGG - Intronic
1095267241 12:40174739-40174761 AAAAATACAAAAAATCAGCTGGG - Intergenic
1095380246 12:41582163-41582185 AAACATTCTCAGTAGCATCTGGG + Intergenic
1095478437 12:42609892-42609914 AAAAAAATTCAGAATTAGCTGGG - Intergenic
1095582999 12:43821270-43821292 AAAAATACACATAAGCACATGGG + Intergenic
1095863439 12:46945543-46945565 AAAAATATAAAGCAGCAGCTGGG + Intergenic
1095892226 12:47245442-47245464 AAAAATACAAAGAATTAGCTGGG + Intergenic
1096016796 12:48283530-48283552 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1096318263 12:50588310-50588332 AAAAATACAAAGAATTAGCTGGG - Intronic
1096434330 12:51575906-51575928 AAAAATACAAAGAATCAGCTGGG + Intergenic
1096526857 12:52215204-52215226 AAAAATACAAAAAATCAGCTGGG - Intergenic
1096614324 12:52823157-52823179 AAGGATGCTCAGAAGAAGCTTGG - Exonic
1096689742 12:53313015-53313037 AAAAATACAAAAAATCAGCTGGG - Intronic
1097120721 12:56729562-56729584 AAAAATACAAAAAATCAGCTGGG + Intronic
1097853465 12:64436863-64436885 ACAAATACCCAGAATCAGCTGGG - Intronic
1097966935 12:65591233-65591255 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1097980514 12:65733417-65733439 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1098513155 12:71342519-71342541 AAAAATACTAAAAATTAGCTGGG - Intronic
1099044880 12:77705257-77705279 AAAAATACAAAAAATCAGCTGGG + Intergenic
1099130999 12:78831039-78831061 AAAAATACAAAAAATCAGCTAGG + Intergenic
1100063683 12:90613093-90613115 AAAAATACACAGAAGTAAGTAGG + Intergenic
1100149015 12:91712809-91712831 AAAAATACAAAAAATCAGCTGGG - Intergenic
1100169585 12:91959271-91959293 AAAAATACAAAAAATCAGCTGGG - Intergenic
1100614492 12:96220546-96220568 AAAAATACAAAAAACCAGCTGGG - Intronic
1100627081 12:96346289-96346311 AAAAATACTAAAAAACAGCCGGG + Intronic
1101392385 12:104313691-104313713 ATCAAGACTCAGAAGCAGCAAGG - Intronic
1101663296 12:106786308-106786330 AAAAATACTAAAAATTAGCTGGG - Intronic
1101981885 12:109414867-109414889 AAAAATACAAAGAATTAGCTGGG - Intronic
1102686887 12:114731937-114731959 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1102696815 12:114806469-114806491 AAAAATACAAAAAATCAGCTAGG + Intergenic
1102807356 12:115793772-115793794 AAAAATACAAAAAATCAGCTGGG + Intergenic
1102871108 12:116414484-116414506 AACAAAACTAAGGAGCAGCTGGG + Intergenic
1102994357 12:117337089-117337111 AAAAAGAGTAAAAAGCAGCTGGG - Intronic
1103384239 12:120519397-120519419 AAAAATACACAAAATCAGCCAGG + Intronic
1103475459 12:121214943-121214965 AAAAATACACAAAATTAGCTGGG - Intronic
1103530486 12:121597795-121597817 AAAAATACACAAAATTAGCTGGG + Intergenic
1104075759 12:125388266-125388288 AAAAATACACAAAAGTAGCTGGG + Intronic
1104437321 12:128766401-128766423 AAAAACACACAGAAAGAGCTGGG + Intergenic
1104527820 12:129540644-129540666 AAAAATACACAAAATTAGCTGGG - Intronic
1105042905 12:132975331-132975353 AAAAATACAAAAAATCAGCTGGG - Intergenic
1105309740 13:19195746-19195768 AAAAATTTTCAGAAGGAGGTCGG + Intergenic
1105351721 13:19621966-19621988 AAAAATACAAAAAATCAGCTGGG + Intergenic
1105550914 13:21395225-21395247 AAAAATACAAAGAATTAGCTGGG - Intronic
1106063438 13:26319306-26319328 AAAAATACAAAAAAACAGCTGGG + Intronic
1106574998 13:30966596-30966618 AAAAATACAAAGAATTAGCTGGG - Intronic
1106723332 13:32458223-32458245 AAAAATACAAAAAAGTAGCTGGG - Intronic
1106871381 13:34025744-34025766 AAAAATACAAAGAATCAGCTGGG - Intergenic
1106949005 13:34861819-34861841 AAAAATACAAAAAATCAGCTGGG - Intergenic
1107389694 13:39951361-39951383 AAAATTATTCAGACACAGCTCGG - Intergenic
1107512265 13:41096530-41096552 AAAAATACAAAAAATCAGCTGGG - Intergenic
1107709321 13:43136314-43136336 AAAAATACAAAGAATTAGCTGGG + Intergenic
1107909626 13:45093216-45093238 AAAAACACAAAAAAGCAGCTGGG + Intergenic
1108178151 13:47815468-47815490 AAGAATTCTCAGAAGCTTCTGGG - Intergenic
1108190339 13:47932010-47932032 AAAAATACAAAGAATTAGCTGGG - Intergenic
1108339540 13:49484428-49484450 AAAAATACAAAAAAGTAGCTGGG - Intronic
1108475478 13:50811907-50811929 AAAAATACAAAAAATCAGCTGGG + Intronic
1108623971 13:52209827-52209849 AAAAATACTAAAAAGTAGCCGGG + Intergenic
1108632473 13:52300230-52300252 AAAAATACAAAAAATCAGCTGGG - Intergenic
1108662089 13:52596594-52596616 AAAAATACTAAAAAGTAGCCGGG - Intergenic
1108827706 13:54434998-54435020 AAAAATACACAAAAGTAGCCCGG - Intergenic
1108918030 13:55640588-55640610 AAAAATACAGAAAATCAGCTGGG - Intergenic
1109850949 13:68062345-68062367 AAAAATAATCAGAAGAATATAGG + Intergenic
1110417316 13:75267693-75267715 AAGAATACTCAGATGCGGCAGGG + Intergenic
1110592126 13:77275526-77275548 AAAGACTCTCAGAAGGAGCTGGG + Intronic
1110615703 13:77539693-77539715 AAAAATACAAAAAATCAGCTGGG - Intronic
1110808021 13:79780704-79780726 AACAAGACTCAGAAGCGACTTGG + Intergenic
1111109907 13:83693586-83693608 AAAAATACACAAAATTAGCTGGG - Intergenic
1111111287 13:83713434-83713456 AATAATAATCAGAATCTGCTAGG + Intergenic
1111156669 13:84336993-84337015 AAAAATACAAAAAATCAGCTGGG + Intergenic
1111180349 13:84655110-84655132 AACAATACTCAGAACTAGCATGG + Intergenic
1111295870 13:86277149-86277171 AAAAGTATTGAGGAGCAGCTGGG + Intergenic
1111598576 13:90442711-90442733 AAAAATACAAAAAATCAGCTGGG + Intergenic
1111691703 13:91571562-91571584 AAAAATACAAAAAAGTAGCTGGG + Intronic
1111942916 13:94631976-94631998 GACAGTAGTCAGAAGCAGCTGGG + Exonic
1112073433 13:95881011-95881033 AAAAATACAAAGAATCAGCCGGG + Intronic
1112132505 13:96539514-96539536 AAAAATACAAAAAATCAGCTGGG - Intronic
1112159881 13:96855945-96855967 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1112300813 13:98228197-98228219 AAAAATACAAAGAATTAGCTGGG + Intronic
1112349060 13:98617799-98617821 AAAAATACGAAAAATCAGCTGGG + Intergenic
1112481452 13:99779433-99779455 AAAAATACTCAGAACTGGCCAGG - Intronic
1112492102 13:99876258-99876280 AAAAATACAAAAAATCAGCTGGG + Intronic
1112982064 13:105397033-105397055 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1113278954 13:108767395-108767417 AAAAATACCCAGATACAGCCAGG - Intronic
1113336191 13:109378361-109378383 AAAAATACGAAAAATCAGCTGGG + Intergenic
1113525997 13:110977153-110977175 AAAAAAACAAAGAAGCAGTTAGG - Intergenic
1113850715 13:113416074-113416096 AATGATGCTCAGAAGCTGCTGGG - Intergenic
1114273097 14:21116374-21116396 AAAAATTCTTAGAAGCAGAATGG - Intergenic
1114284346 14:21226159-21226181 AAAAATACAAAAAATCAGCTGGG + Intronic
1114285840 14:21242321-21242343 AAAAATACTAAAAATTAGCTGGG + Intronic
1114325327 14:21583196-21583218 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1114470861 14:22960469-22960491 AAAAATACAAAAAATCAGCTGGG + Intronic
1115102673 14:29721937-29721959 CAAATTAGCCAGAAGCAGCTTGG + Intronic
1115157805 14:30360196-30360218 AAAAATACCAAAAAGTAGCTGGG + Intergenic
1115260938 14:31453096-31453118 AAAAATAAACAAAAGTAGCTGGG - Intronic
1115323740 14:32114065-32114087 AAAAATACAAAAAATCAGCTGGG + Intronic
1115406475 14:33022502-33022524 AAAAATACAAAAAAGTAGCTGGG + Intronic
1115577156 14:34722917-34722939 AAAAAGACTAAGAAGGAGCTTGG + Intergenic
1116240021 14:42328753-42328775 AAAAATACAAAAAATCAGCTGGG - Intergenic
1116361574 14:44005000-44005022 AAAAATACACAAAATTAGCTTGG + Intergenic
1116842413 14:49832741-49832763 AAAAACACTCATAAGCTACTAGG + Intronic
1116971559 14:51071502-51071524 AAAAATTCTGAGCTGCAGCTGGG + Intronic
1116974799 14:51104281-51104303 AAAAAAAATCACAAGCAGCCAGG - Intergenic
1116975047 14:51106456-51106478 AAAAATACAAAGAATTAGCTAGG - Intergenic
1116990089 14:51266956-51266978 AAAAATACTAAAAATTAGCTGGG - Intergenic
1117236806 14:53786575-53786597 AAAAATACAAAAAATCAGCTGGG + Intergenic
1118057486 14:62095718-62095740 AAAAATACTAAGAAACACTTGGG - Intronic
1118113292 14:62747172-62747194 AAAAATACAAAAAATCAGCTGGG + Intronic
1118211283 14:63768032-63768054 AAAAATACAAAAAATCAGCTGGG + Intergenic
1118461218 14:65988955-65988977 AAAAATACAAAAAAGTAGCTGGG - Intronic
1118541177 14:66827122-66827144 AAAAATACAAAGAATTAGCTGGG + Intronic
1118598752 14:67456439-67456461 AAAAATACAAAAAATCAGCTGGG + Intronic
1118734162 14:68690238-68690260 ACAAACACTCAGGATCAGCTTGG - Intronic
1118745442 14:68769883-68769905 AAAAATACAAAGAATTAGCTGGG - Intergenic
1119075516 14:71634239-71634261 AAAAATACAAAAAATCAGCTGGG + Intronic
1119231896 14:72986687-72986709 AAAAATACAAAAAATCAGCTGGG - Intronic
1119245213 14:73098802-73098824 AAAAATACAAAAAAGTAGCTGGG - Intronic
1119285223 14:73447955-73447977 AAAAATACAAAAAAGTAGCTGGG - Intronic
1119349841 14:73955111-73955133 AAAAATACAAAAAATCAGCTGGG - Intronic
1119374873 14:74182169-74182191 AAAAATACAAAGAATTAGCTGGG - Intronic
1119461529 14:74808641-74808663 AAAAATACAAAAAATCAGCTGGG + Intronic
1119495641 14:75076427-75076449 AAAAATACACAAAATTAGCTGGG - Intronic
1119804087 14:77471037-77471059 AAAAATACAAAAAATCAGCTGGG + Intergenic
1119852000 14:77872833-77872855 AAAAATACAAAGAATTAGCTGGG - Intronic
1120189737 14:81429772-81429794 AAAAATACAAAAAATCAGCTGGG + Intronic
1120235087 14:81881598-81881620 AAAAATTCTCAGAATCTTCTAGG + Intergenic
1120269247 14:82290065-82290087 AAAAATACAAAAAATCAGCTGGG + Intergenic
1120366700 14:83580498-83580520 AAAAATACAAAAAATCAGCTGGG + Intergenic
1120869039 14:89320905-89320927 AAAACTCCTCAGAGTCAGCTGGG - Intronic
1120925018 14:89788970-89788992 AAAAATACAAAAAATCAGCTAGG - Intergenic
1120977334 14:90260569-90260591 AAAAATACAAAGAATTAGCTGGG + Intronic
1121051898 14:90824730-90824752 AAAAATACAAAAAATCAGCTGGG - Intergenic
1121102084 14:91256517-91256539 AAAAATACTAAAAATTAGCTGGG - Intergenic
1121131253 14:91449578-91449600 AAAAATACAAAAAAACAGCTGGG + Intergenic
1121341133 14:93105862-93105884 AAAAATACAAAAAATCAGCTGGG - Intronic
1121354057 14:93198609-93198631 AAAAATACAAAAAATCAGCTAGG - Intronic
1121357630 14:93229405-93229427 AAAAATACAAAGAATTAGCTGGG + Intergenic
1121580084 14:95023597-95023619 AAAAAACCTCAGTATCAGCTGGG - Intergenic
1122187367 14:100010554-100010576 AAAAATACAAAGAATTAGCTGGG - Intronic
1122328300 14:100895910-100895932 AAAAATACACAAAATTAGCTGGG + Intergenic
1123131041 14:105985803-105985825 AAAAATACAAAGAATTAGCTGGG - Intergenic
1123499115 15:20864285-20864307 AAAAATACAAAGAATTAGCTGGG - Intronic
1123556351 15:21437904-21437926 AAAAATACAAAGAATTAGCTGGG - Intronic
1123581277 15:21717024-21717046 AAAAATACAAAGAATTAGCTGGG - Intergenic
1123592591 15:21875250-21875272 AAAAATACAAAGAATTAGCTGGG - Intergenic
1123617926 15:22159647-22159669 AAAAATACAAAGAATTAGCTGGG - Intergenic
1124022766 15:25939229-25939251 AAACATAATGAGAAGCATCTGGG - Intergenic
1124228534 15:27918961-27918983 AAAAATATTAAGAAGCAATTAGG + Intronic
1124234878 15:27981470-27981492 TAAAATACTTAGAAACAGTTTGG + Intronic
1124287664 15:28418051-28418073 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1124288185 15:28423752-28423774 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1124435515 15:29645717-29645739 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1124507060 15:30287197-30287219 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1124687873 15:31797862-31797884 AAAAATGCCCAAAAACAGCTGGG + Intronic
1124700506 15:31908176-31908198 AAAAATACAAAAAAACAGCTGGG - Intergenic
1124706544 15:31971320-31971342 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1124736497 15:32251464-32251486 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1124873999 15:33573626-33573648 ATAAATATTCAGAATCACCTGGG + Intronic
1124967038 15:34441166-34441188 AAAAATACAAAGAATTAGCTGGG - Intergenic
1125025479 15:35025178-35025200 AAAAATACAAAAAATCAGCTGGG - Intergenic
1125299133 15:38235588-38235610 AAAAATACAAAAAATCAGCTGGG + Intergenic
1125486954 15:40117936-40117958 AAAATTACTCTGAAGCATCTGGG - Intergenic
1125625114 15:41102028-41102050 AAAAATACAAAAAAGTAGCTGGG + Intronic
1125667805 15:41446034-41446056 AAAAAGAGTCAGAGGAAGCTGGG - Intronic
1125701994 15:41694685-41694707 AAAAATACAAAAAATCAGCTGGG - Intronic
1125818545 15:42607742-42607764 ATAAATACTTGGAAGCAGGTGGG - Intronic
1125893487 15:43282887-43282909 AAAAATACAAAAAAGTAGCTGGG + Intronic
1125916866 15:43495336-43495358 AAAAATACAAAAAATCAGCTGGG + Intronic
1125934355 15:43622020-43622042 AAAAATACAAAAAATCAGCTGGG - Intergenic
1126150176 15:45516707-45516729 AAAAATACTAAAAAGTAGCTGGG + Intronic
1126586095 15:50288984-50289006 AAAAATATTCAAAATTAGCTAGG - Intronic
1126628897 15:50713558-50713580 AAAAATACTCAGGAAATGCTGGG - Intronic
1127037336 15:54932426-54932448 AAAAATACAAAAAATCAGCTGGG - Intergenic
1127225694 15:56926150-56926172 AAAAATACACAGAATTAGCCAGG + Intronic
1127432066 15:58920154-58920176 AAAAATACAAAAAAGTAGCTGGG + Intronic
1127503275 15:59574696-59574718 AAAAATACAAAAAATCAGCTGGG - Intergenic
1127891961 15:63260126-63260148 CATAAAAATCAGAAGCAGCTGGG - Intronic
1128439923 15:67696816-67696838 AAAAATACAAAAAATCAGCTGGG + Intronic
1129013493 15:72444393-72444415 AAAAATACACAAAATTAGCTGGG + Intergenic
1129049614 15:72769504-72769526 AAAAATACAAAGAATTAGCTGGG - Intronic
1129094867 15:73195400-73195422 AAAAACACACAGACGCAGCATGG - Intronic
1129376174 15:75133616-75133638 AAAAATACACAAAATTAGCTGGG + Intergenic
1129448406 15:75634880-75634902 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1129812941 15:78525314-78525336 AAAAATACAAAAAATCAGCTGGG - Intronic
1130009956 15:80143531-80143553 AAAAATACAAAAAATCAGCTGGG + Intergenic
1130289007 15:82580158-82580180 AAAAATACTAAAAATTAGCTGGG + Intronic
1130770886 15:86922449-86922471 AAAAATACACAGAATTAGCTGGG - Intronic
1130812399 15:87393699-87393721 AAAAATACACAAAAGTAGCCAGG + Intergenic
1131495903 15:92910553-92910575 AAAAATAGTAAGAAGTAGCTGGG - Intronic
1131656219 15:94461732-94461754 AAAAATACTAAGCAGAAGATGGG + Intronic
1131756719 15:95572024-95572046 AAAAATACTCAAAAGATGGTTGG + Intergenic
1132121890 15:99183480-99183502 AAAAATACAAAAAATCAGCTGGG - Intronic
1132261873 15:100433073-100433095 AAAAATACAAAGAATCAGCCAGG + Intronic
1202964692 15_KI270727v1_random:165093-165115 AAAAATACAAAGAATTAGCTGGG - Intergenic
1132534897 16:473593-473615 AAAAATACAAAAAATCAGCTGGG - Intronic
1132795005 16:1715884-1715906 AAAAATACAAAAAATCAGCTGGG - Intronic
1132795669 16:1720871-1720893 AAAAATACAAAGAATTAGCTGGG + Intronic
1133544132 16:6788634-6788656 AAAAATACAAACAATCAGCTGGG - Intronic
1133956824 16:10451890-10451912 AAAAATACAAAAAAGTAGCTGGG + Intronic
1133986611 16:10673809-10673831 AAAAATACAAAAAATCAGCTGGG - Intronic
1134228153 16:12408180-12408202 AAAAAAAACTAGAAGCAGCTGGG + Intronic
1134332062 16:13260175-13260197 AAAAATACAAAAAATCAGCTGGG - Intergenic
1134487619 16:14670769-14670791 TAAAATACTCAGACCCGGCTGGG + Intergenic
1134548178 16:15126193-15126215 AAAAATACAAAAAATCAGCTGGG - Intronic
1135016430 16:18927752-18927774 AAAAAAACAAAGCAGCAGCTGGG + Intergenic
1135110808 16:19689429-19689451 AAAAATACAAAAAATCAGCTGGG - Intronic
1135118662 16:19746006-19746028 AAAAATACTAAGAATTAGCTAGG + Intronic
1135132140 16:19861914-19861936 AAAAAGACCCAGTGGCAGCTTGG - Exonic
1135194255 16:20381473-20381495 AAAAATACTAAAAATTAGCTGGG + Intronic
1135199993 16:20429169-20429191 AAAAATACTAAAAATTAGCTGGG - Intronic
1135307243 16:21377664-21377686 AAAAATACAAAAAATCAGCTGGG - Intergenic
1135391486 16:22097124-22097146 AAAAATACACAAAATCAGCTGGG - Intronic
1135406927 16:22205422-22205444 AAAAATACAAAAAAGCAGCCGGG - Intergenic
1135560534 16:23472871-23472893 AAAAATACAAAAAAGTAGCTGGG + Intronic
1135764091 16:25162427-25162449 AAAAATACAAAAAATCAGCTGGG + Intronic
1136001094 16:27293560-27293582 AAAAATACAAAAAATCAGCTTGG - Intergenic
1136154774 16:28375273-28375295 AAAAATACTGAGATACCGCTAGG + Intergenic
1136208318 16:28739985-28740007 AAAAATACTGAGATACCGCTAGG - Intergenic
1136264403 16:29106666-29106688 AAAAATACTGAGATACTGCTAGG - Intergenic
1136303989 16:29356802-29356824 AAAAATACAAAAAATCAGCTGGG - Intergenic
1136313007 16:29427682-29427704 AAAAATACTAAAAATTAGCTGGG + Intergenic
1136344338 16:29665213-29665235 AAAAATACAAAAAAGCAGCTGGG - Exonic
1136423820 16:30155156-30155178 AAAAATAAACAAAATCAGCTGGG + Intergenic
1136448901 16:30341142-30341164 AAAAATACACAAAAGTAGCCAGG + Intergenic
1137258324 16:46797506-46797528 AAAAATACACAAAATTAGCTAGG - Intronic
1137276061 16:46934394-46934416 AAAAATACAAAAAATCAGCTGGG + Intergenic
1137601461 16:49759236-49759258 AAAAATACAAAAAATCAGCTGGG + Intronic
1137796304 16:51223158-51223180 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1138155483 16:54698977-54698999 AAGCAAACTCAGAAGCAGCCTGG + Intergenic
1138473272 16:57255395-57255417 AAAAATACAAAAAATCAGCTGGG + Intronic
1138669837 16:58604973-58604995 AAAAATACAAAAAAGTAGCTGGG + Intronic
1138869187 16:60860572-60860594 AAAAATAGTGAGCAGGAGCTAGG + Intergenic
1139304974 16:65977491-65977513 AAAAATACAAAGAATTAGCTGGG - Intergenic
1139417996 16:66830207-66830229 GAAAATACTCATGACCAGCTTGG + Intronic
1139434912 16:66931005-66931027 AAAAAAACTGAAAAACAGCTAGG + Intergenic
1139518633 16:67466674-67466696 AAAAATAAACAAAATCAGCTGGG + Intronic
1139748917 16:69096776-69096798 AAAAATACAAAAAATCAGCTGGG - Intergenic
1139810009 16:69606693-69606715 AAAAATACACAAAATTAGCTGGG + Intronic
1139907356 16:70375821-70375843 AAAAATACAAAAAATCAGCTGGG - Intergenic
1139908991 16:70385142-70385164 AAAAATACAAAAAATCAGCTGGG + Intronic
1140012909 16:71154005-71154027 GTAAATAATCAGAAACAGCTCGG - Intronic
1140099737 16:71905537-71905559 AAAAATACAAAAAAGTAGCTGGG - Intronic
1140503540 16:75455194-75455216 AAAAATACAAAGAATTAGCTGGG + Intronic
1140538133 16:75729948-75729970 AAAAATACAAAAAAGTAGCTGGG - Intronic
1140558781 16:75953204-75953226 AAGTATACTGAGAAGGAGCTAGG + Intergenic
1140609049 16:76576349-76576371 AAAAATACAAAGAATTAGCTGGG - Intronic
1140820873 16:78661881-78661903 AAAAATACAAAAAATCAGCTGGG + Intronic
1141097741 16:81174930-81174952 AAATATGCTCAGAACCTGCTAGG + Intergenic
1141180461 16:81749511-81749533 AAAAATACACATAATTAGCTGGG - Intronic
1141404236 16:83777530-83777552 AAAACTGCTGAGAAGCAGCTTGG + Intronic
1141520196 16:84573613-84573635 AAAAATACAAAGAATTAGCTGGG + Intronic
1141542834 16:84739430-84739452 AAAAATACAAAAAATCAGCTGGG - Intronic
1141605158 16:85148679-85148701 AAAAATACAAAAAATCAGCTGGG + Intergenic
1141668852 16:85480874-85480896 AATAATACTCCGGAGCAGCTGGG + Intergenic
1141908756 16:87044396-87044418 AAAAATACAAAAAATCAGCTGGG + Intergenic
1142346835 16:89559556-89559578 AAAAATACAAAAAATCAGCTGGG + Intergenic
1142407332 16:89897940-89897962 AAAAATACAAAAAATCAGCTGGG + Intronic
1142540343 17:654032-654054 AAAAATACACAAAATTAGCTGGG + Intronic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1142704035 17:1683154-1683176 AAAAATACACAAAATTAGCTGGG - Intronic
1142928071 17:3258686-3258708 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1143010604 17:3864405-3864427 AAAAATACAAAAAATCAGCTGGG - Intronic
1143069380 17:4277794-4277816 AAAAATACTCAGAAAGTGCATGG + Intronic
1143153246 17:4819835-4819857 AAAAATACAAAAAATCAGCTGGG + Intronic
1143194018 17:5061518-5061540 AAAAATACAAAAAAGTAGCTAGG + Intergenic
1143312252 17:6001946-6001968 AAAAATACACAAAATTAGCTGGG + Intronic
1143704785 17:8689158-8689180 AAAAATGCACAAAACCAGCTGGG - Intergenic
1143721411 17:8813273-8813295 AAAAAACCTCAGGAGCAGATGGG + Intronic
1143834987 17:9684466-9684488 TAAAATATTCAGCATCAGCTTGG + Intronic
1143976436 17:10833591-10833613 AAAAATACAAAAAATCAGCTGGG + Intronic
1144118394 17:12124834-12124856 AAAAATACAAAAAAGTAGCTGGG - Intronic
1144385142 17:14742430-14742452 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1144544322 17:16178336-16178358 AAAAATACAAAGAATCAGCCGGG + Intronic
1144620397 17:16815052-16815074 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1144636795 17:16915185-16915207 AAAAATACAAAAAAGCAGCTGGG + Intergenic
1144861051 17:18302388-18302410 AAAAATCCTCTGAAGCCGCAGGG + Exonic
1144969660 17:19099767-19099789 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1144978256 17:19152297-19152319 AAAAATACAAAAAAGTAGCTGGG - Intronic
1144989965 17:19225936-19225958 AAAAATACAAAAAAGTAGCTGGG + Intronic
1145200830 17:20943299-20943321 AAAAATACAAAAAATCAGCTGGG - Intergenic
1145214041 17:21039110-21039132 AAAAATACACAAAATTAGCTGGG - Intronic
1145300385 17:21630608-21630630 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1145349903 17:22072630-22072652 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1145988505 17:29063634-29063656 AAAAATACAAAGAATTAGCTGGG + Intergenic
1146097008 17:29940234-29940256 AAAAATACAAAAAAGTAGCTGGG - Intronic
1146116227 17:30141841-30141863 AAAAATACAAAGAATTAGCTGGG + Intronic
1146193417 17:30790775-30790797 AAAAATACTAAAAATTAGCTGGG - Intronic
1146245868 17:31282219-31282241 AAAAATACAAAAAATCAGCTGGG + Intronic
1146304187 17:31717860-31717882 AAAAATACAAAAAATCAGCTAGG - Intergenic
1146332819 17:31942011-31942033 AAAAATACAAAAAATCAGCTGGG - Intronic
1146379328 17:32317030-32317052 AAAAATACAAAAAAGTAGCTGGG - Intronic
1146387609 17:32391225-32391247 AAAAATACAAAAAATCAGCTGGG - Intergenic
1146473404 17:33142402-33142424 ATAAATGTTCAGAAGCAGCTGGG - Intronic
1146949288 17:36894589-36894611 AAAAAAACCCTGAACCAGCTGGG - Intergenic
1147172149 17:38628092-38628114 AAAAATACTAAAAATTAGCTAGG - Intergenic
1147281951 17:39369510-39369532 AAAAATACTAAAAATTAGCTGGG - Intronic
1147397388 17:40155048-40155070 AAAAATACAAAAAATCAGCTGGG - Intronic
1147607000 17:41779486-41779508 AAAAATACAAAGAATTAGCTGGG - Intronic
1147723246 17:42551607-42551629 AAAAATACTAAAAATTAGCTGGG + Exonic
1147789268 17:43003140-43003162 AAAAATACTAAGAATTATCTGGG + Intergenic
1147844570 17:43395795-43395817 AAAAATACTAAAAATTAGCTGGG + Intergenic
1147865343 17:43548343-43548365 AAAAAAACTCAGAACCAGAGGGG - Intronic
1147871883 17:43593259-43593281 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1148257579 17:46149161-46149183 AAAAATACAAAAAATCAGCTGGG - Intronic
1148421133 17:47547863-47547885 AAAAATACAAAAAATCAGCTGGG + Intronic
1148474706 17:47920445-47920467 AAAAATACAAAAAATCAGCTGGG - Intronic
1148580038 17:48737313-48737335 AAAAATACAAAGAATTAGCTAGG + Intergenic
1148627775 17:49083150-49083172 AAAAACACCCAGATGCAGCTGGG - Intergenic
1148734354 17:49856752-49856774 AAAAATACAAAAAATCAGCTGGG + Intergenic
1148774175 17:50085367-50085389 AAAATTACTGGGAACCAGCTGGG + Intronic
1148814297 17:50315567-50315589 AAAAATACAAAAAAACAGCTGGG + Intergenic
1149247890 17:54733074-54733096 AAAAATACTCAACATCAGCCAGG + Intergenic
1149271897 17:54988612-54988634 AAAAATACTCAAAATTAGCTGGG + Intronic
1149322309 17:55493827-55493849 AAAAAAAAGCAGCAGCAGCTTGG + Intergenic
1149554715 17:57565163-57565185 AAAAATCCTTAGATGCAGATGGG - Intronic
1149619435 17:58031762-58031784 AAAAATACTAAAAATTAGCTGGG + Intergenic
1149707942 17:58712657-58712679 AAAAATACAAAAAAGTAGCTAGG + Intronic
1149836183 17:59915147-59915169 AAAAATACAAAAAAGTAGCTGGG - Intronic
1149912052 17:60575680-60575702 ACAAACACACAAAAGCAGCTTGG - Intronic
1149918860 17:60637399-60637421 AAAAATACTGAGTAGGAGCGGGG - Intronic
1149935085 17:60797053-60797075 AAAAATACAGAGAATTAGCTGGG - Intronic
1149951373 17:60990805-60990827 AAAAATACTGAAAATCAGCCAGG - Intronic
1150096329 17:62379256-62379278 AAAAATACAAAAAAGTAGCTGGG + Intronic
1150372017 17:64647287-64647309 AAAAAAAATCAGAAGAAACTGGG + Intronic
1150398815 17:64840705-64840727 AAAAATACAAAGAATTAGCTGGG + Intergenic
1150654100 17:67028390-67028412 AAAAATACAAAGAATTAGCTGGG + Intronic
1150663920 17:67112388-67112410 ACATATAGTCAGAGGCAGCTTGG - Intronic
1150693520 17:67384584-67384606 AAAAATACAAAAAATCAGCTGGG - Intronic
1150730086 17:67685263-67685285 AAGAATGCTAAGCAGCAGCTTGG - Intronic
1150921952 17:69493463-69493485 AAAAATACTCAGCTGCAGCTGGG + Intronic
1150974323 17:70066651-70066673 AAAAATACAAAAAATCAGCTGGG - Intronic
1151144494 17:72028382-72028404 AAAAATACAAAAAATCAGCTGGG - Intergenic
1151186676 17:72369891-72369913 AAAAATACTAAAAATTAGCTGGG - Intergenic
1151298773 17:73205906-73205928 AATGATACTCAGCAGCTGCTAGG - Intronic
1151305687 17:73261498-73261520 AAAAATACAAAAAATCAGCTGGG + Intronic
1151469221 17:74307506-74307528 AAAAATACAAAAAATCAGCTGGG + Intronic
1151699059 17:75732925-75732947 AAAAATACAAAAAAGTAGCTGGG + Intronic
1151708989 17:75789495-75789517 AAAAATACAAAGAATTAGCTGGG - Intronic
1151797892 17:76358667-76358689 AAAAATACAAAAAAGTAGCTGGG + Intronic
1151913913 17:77103600-77103622 TAAAATACACAAAATCAGCTGGG - Intronic
1151924383 17:77183798-77183820 AAAGATAAACAGAAGCAGCAAGG - Intronic
1152316666 17:79584924-79584946 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1152444720 17:80335080-80335102 AAAAATACAAAAAAGTAGCTGGG - Intronic
1152497014 17:80680338-80680360 TAAAATACTCAGAATCAGCAGGG + Intronic
1152513823 17:80809350-80809372 AAAAATACAAAAAATCAGCTGGG - Intronic
1152541307 17:80977763-80977785 AAAAATACTCAGTAAGGGCTGGG - Intergenic
1152743018 17:82026737-82026759 AAAAATACAAAAAAGTAGCTGGG - Intronic
1152833797 17:82516220-82516242 AAAAATACAAAAAATCAGCTGGG - Intergenic
1153004213 18:482770-482792 AAAAATACAAAGAATTAGCTGGG - Intronic
1153273921 18:3349829-3349851 AAAAATACAAAAAATCAGCTGGG - Intergenic
1153306099 18:3632460-3632482 AAAAATACACAAAATTAGCTGGG - Intronic
1153899810 18:9607941-9607963 AAAAATACAAAGAATTAGCTGGG - Intronic
1153958430 18:10119079-10119101 AAAAATACTAAAAATTAGCTGGG + Intergenic
1154090906 18:11362228-11362250 AAAAATACAAAGAATTAGCTGGG - Intergenic
1154157409 18:11954686-11954708 AAAATTACACTGAGGCAGCTGGG - Intergenic
1154225818 18:12502946-12502968 AAAAATACAAAAAAGTAGCTGGG + Intronic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1154409024 18:14125843-14125865 AAAAATACTAAAAATTAGCTGGG - Intronic
1154457157 18:14541049-14541071 AAAAATACAAAGAATTAGCTGGG - Intronic
1154488251 18:14896290-14896312 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1154943872 18:21141380-21141402 AAAAATACAAAAAATCAGCTGGG + Intergenic
1154994533 18:21627106-21627128 AAAAATACAAAAAAGTAGCTGGG + Intronic
1155219108 18:23668526-23668548 AAAAATACACAAAATTAGCTGGG + Intergenic
1155220847 18:23684282-23684304 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1155295639 18:24382091-24382113 AAAAATACAAAAAATCAGCTAGG + Intronic
1155479402 18:26268981-26269003 AAAAATACAAAAAATCAGCTGGG - Intronic
1155952279 18:31926593-31926615 AAAAATACAGAAAATCAGCTGGG - Intronic
1156100734 18:33591800-33591822 AAAAATACAAAAAAGTAGCTGGG - Intronic
1156263107 18:35462854-35462876 AAAAATACAAAAAATCAGCTGGG - Intronic
1156276518 18:35588692-35588714 AAAAAGACTCAGCAGCAGAAAGG - Intronic
1156739800 18:40310427-40310449 AAAAATACAAAAAATCAGCTGGG + Intergenic
1156795132 18:41035400-41035422 AAAACTACTCAGCTGCGGCTGGG - Intergenic
1156946046 18:42832891-42832913 AAAAATACAAAAAAGTAGCTGGG + Intronic
1156969037 18:43132805-43132827 AAAAATACAAAAAATCAGCTGGG + Intergenic
1157053853 18:44201325-44201347 AAAAATAATCAAAATCAGCCAGG + Intergenic
1157110715 18:44817522-44817544 AAAAATACAAAGAATTAGCTGGG + Intronic
1157257985 18:46155356-46155378 AAAAATACTAAAAATTAGCTGGG - Intergenic
1157938611 18:51900741-51900763 AAAAATACAAAAAATCAGCTGGG + Intergenic
1158144901 18:54301116-54301138 AAAAATACCAAAAAGTAGCTGGG + Intronic
1158344334 18:56500287-56500309 AAAAATACAAAAAATCAGCTGGG - Intergenic
1158513551 18:58112647-58112669 AAAAATACAAAAAATCAGCTGGG - Intronic
1159080472 18:63730419-63730441 AAAAATACACAAAATTAGCTGGG + Intergenic
1159125596 18:64220548-64220570 AAAAATACAAAAAATCAGCTGGG + Intergenic
1159383646 18:67693801-67693823 AAATATAATGAGAACCAGCTTGG - Intergenic
1159487082 18:69075813-69075835 AAAAATACAAAAAATCAGCTGGG + Intergenic
1159677140 18:71299305-71299327 AAAAATACAAAAAATCAGCTGGG - Intergenic
1159734381 18:72075827-72075849 AAAATTAATCAGAAGAATCTTGG - Intergenic
1159783464 18:72686704-72686726 AAAAATACACAAAATTAGCTGGG - Intergenic
1159916315 18:74191182-74191204 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1159957319 18:74528828-74528850 ATAAATACACAGAAGCAACAAGG - Intergenic
1160079795 18:75714640-75714662 AAAAATACCCACAAGCAGATGGG + Intergenic
1160783307 19:888041-888063 AAAAATACAAAAAAGCAGCCGGG + Intronic
1160834598 19:1118709-1118731 AAAAATACACAAAATTAGCTGGG + Intronic
1161189913 19:2948399-2948421 AAAAATACAAAAAATCAGCTGGG + Intergenic
1161315772 19:3616826-3616848 AAAAATTTTCAGAAGTGGCTGGG + Intronic
1161469735 19:4450595-4450617 AAAAATACAAAGAATCAGCTGGG + Intronic
1161475746 19:4483948-4483970 AAAAATACAAAGAATTAGCTGGG - Intronic
1161676061 19:5650570-5650592 AAAAATACAAAAAATCAGCTGGG - Intronic
1161686459 19:5704999-5705021 AAAAATACTAAAAATTAGCTGGG + Intronic
1161830841 19:6603102-6603124 AAAAATACAAAAAAGTAGCTGGG - Intronic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1162077767 19:8199888-8199910 AAAAATACAAAAAAGTAGCTGGG + Intronic
1162211738 19:9097300-9097322 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1162218116 19:9153320-9153342 AAAAATACAAAGAATTAGCTGGG - Intronic
1162243895 19:9382864-9382886 AAAAATACAAAAAAGTAGCTAGG - Intergenic
1162414399 19:10526301-10526323 AAAAATACGAAAAATCAGCTGGG - Intergenic
1162447501 19:10732437-10732459 AAAAATACAAAGAATTAGCTGGG + Intronic
1162492550 19:11002316-11002338 AAAAATACTAAAAATTAGCTGGG + Intronic
1162517389 19:11156961-11156983 AAAAATACAAAAAATCAGCTGGG - Intergenic
1162641198 19:12011749-12011771 AAAAATACAAAAAATCAGCTGGG - Intergenic
1162680432 19:12336429-12336451 AAAAATACTAAAAATTAGCTGGG + Intergenic
1162682568 19:12357510-12357532 AAAAATACACAAAATTAGCTGGG - Intronic
1162741575 19:12776518-12776540 AAAAATACTAAAAATTAGCTGGG + Intronic
1162751359 19:12831543-12831565 AAAAATAATCAAAAATAGCTGGG + Intronic
1162945475 19:14040659-14040681 AAAAATACAAAAAAGTAGCTGGG + Intronic
1163111422 19:15163062-15163084 AAAAATACAAAAAATCAGCTGGG - Intronic
1163146454 19:15382360-15382382 AAAAATACAAAAAAGTAGCTGGG - Intronic
1163305806 19:16478031-16478053 AAAAATACTAAAAATTAGCTGGG - Intergenic
1163313684 19:16528790-16528812 AAAAATACAAAAAAGTAGCTGGG + Intronic
1163674406 19:18648207-18648229 AAAAATACACAAAACTAGCTGGG + Intronic
1163901973 19:20110437-20110459 AAAAATACAAAAAATCAGCTAGG - Intronic
1163970984 19:20795030-20795052 AAAAATACAAAAAAGTAGCTGGG - Intronic
1164027799 19:21368895-21368917 AAAAATACAAAAAATCAGCTGGG - Intronic
1164080131 19:21855032-21855054 AAAAATACAAAGAATTAGCTGGG - Intergenic
1164096509 19:22014848-22014870 AAAAATAAACAGCATCAGCTGGG - Intergenic
1164341458 19:24405163-24405185 AAAAATACACAGAAGCATTCTGG + Intergenic
1164465913 19:28487504-28487526 AAAAATACTAAAAATTAGCTGGG - Intergenic
1164659641 19:29951705-29951727 AAAAATACAAAAAAGTAGCTGGG - Intronic
1164827872 19:31297623-31297645 AAAAATATTAAAAATCAGCTAGG - Intronic
1165010811 19:32845001-32845023 AAAAATACAAAAAATCAGCTGGG + Intronic
1165236651 19:34427512-34427534 AAAAAAACACCGAAACAGCTGGG - Intergenic
1165413099 19:35674405-35674427 AAAAATACAAAAAATCAGCTGGG - Intronic
1165653383 19:37510855-37510877 AAAAATACAAAAAAGTAGCTGGG - Intronic
1165721178 19:38081109-38081131 AAACATACTCAAAAGCAGAGAGG - Intronic
1165779651 19:38425022-38425044 AAAAATACAAAAAAGTAGCTGGG + Intronic
1165929886 19:39350646-39350668 AAAAATACAAAAAATCAGCTGGG - Intronic
1166222234 19:41373097-41373119 AAAAATAAACAAAATCAGCTGGG - Intronic
1166362405 19:42258923-42258945 AAAAATACACAAAATTAGCTGGG - Intergenic
1166523396 19:43495971-43495993 AAAAAGATCCAGAAGCAGGTGGG + Intronic
1166600228 19:44087578-44087600 AAAAAAAAGCAGAAGCAGCATGG - Exonic
1166605502 19:44139439-44139461 AAAAATACAAAAAATCAGCTGGG - Intergenic
1166609148 19:44173598-44173620 AAAAATACAAAAAATCAGCTGGG + Intronic
1166628369 19:44382457-44382479 AAAAATACACAAAATTAGCTGGG - Exonic
1166694064 19:44842417-44842439 AAAAATACAAAAAATCAGCTGGG + Intergenic
1166793986 19:45415172-45415194 AAAAATACAAAAAAGTAGCTGGG + Intronic
1166834700 19:45660209-45660231 AAAAATACAAAGAATTAGCTAGG + Intergenic
1166958613 19:46483991-46484013 AAAAATACTTGGAAGTGGCTGGG + Intronic
1167056602 19:47114983-47115005 AAAAATACAAAAAATCAGCTGGG - Intronic
1167085232 19:47305079-47305101 AAAAATACAAAAAAGTAGCTGGG - Intronic
1167150337 19:47705332-47705354 AAAAATACAAAAAATCAGCTGGG - Intergenic
1167193478 19:48008838-48008860 CAAAAATCTCAGAAGAAGCTGGG + Intronic
1167541419 19:50090312-50090334 AAAAATACAAAGAATTAGCTAGG + Intergenic
1167628671 19:50609201-50609223 AAAAATACAAAGAATTAGCTAGG - Intergenic
1167957507 19:53078247-53078269 AAAAATACACAAAATTAGCTGGG + Intronic
1168039877 19:53749639-53749661 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1168079201 19:53997027-53997049 AAAAATACAAAAAATCAGCTGGG - Intronic
1168396377 19:56052427-56052449 AAAAATACAAAAAAGTAGCTGGG - Intronic
1168501697 19:56898598-56898620 AAAAATACAAAAAATCAGCTGGG - Intergenic
1168525556 19:57085897-57085919 AAAAATACACAAAATTAGCTGGG - Intergenic
1168537476 19:57183125-57183147 AAAAATACTAAAAAGTAGCCAGG - Intergenic
1168678728 19:58298188-58298210 AAAAATACAAAAAAGTAGCTGGG - Exonic
925753527 2:7111001-7111023 AAAAATACACAAAATTAGCTGGG - Intergenic
925955131 2:8955922-8955944 AAAAATACTAAGGATCATCTGGG - Intronic
925966356 2:9070526-9070548 AAAAATACAAAGAATTAGCTGGG + Intergenic
926209035 2:10855288-10855310 AAAAATAGTCACAAGGAGCAGGG - Intergenic
926529700 2:14028812-14028834 AAAAATACAAAAAATCAGCTGGG - Intergenic
926562571 2:14434233-14434255 AAAAATACTGAGAAGAAGGAAGG + Intergenic
927158749 2:20238528-20238550 AAAAATACTAAAAATTAGCTGGG + Intergenic
927549520 2:23985674-23985696 AAAAATACCCATTATCAGCTGGG - Intronic
927654212 2:24931777-24931799 AAAAATACAAAAAATCAGCTGGG - Intergenic
927775228 2:25897587-25897609 AAAAATATCCAGAAGCAGGCAGG - Intergenic
927791474 2:26013277-26013299 AAAAATACACAAAATTAGCTGGG + Intergenic
928345406 2:30489511-30489533 AAAAATACAAAAAATCAGCTGGG - Intronic
928536106 2:32243247-32243269 AAAAATACAAAAAATCAGCTGGG + Intronic
928553103 2:32393678-32393700 AAAAATAAACAGAATTAGCTGGG - Intronic
928577382 2:32668916-32668938 AAAAATACAAAGAATTAGCTGGG + Intronic
928705063 2:33940786-33940808 AAAAATACAAAAAAGTAGCTGGG - Intergenic
928816374 2:35299595-35299617 GAAAATGCTCACAAGCATCTTGG + Intergenic
928833437 2:35516980-35517002 AAAAATACTAAAAATGAGCTGGG + Intergenic
929120677 2:38481613-38481635 AAAAATACAAAAAATCAGCTGGG + Intergenic
929143453 2:38686424-38686446 AAAAATACAAAAAAGTAGCTGGG - Intronic
929394501 2:41507397-41507419 AAAAATACAAAAAAGTAGCTGGG + Intergenic
929479737 2:42293768-42293790 AAAAATACAAAAAAGTAGCTGGG - Intronic
929717910 2:44332105-44332127 AAAAATACACAAAATTAGCTGGG - Intronic
929767273 2:44856379-44856401 AAAAATACAAAAAATCAGCTGGG - Intergenic
930056095 2:47253126-47253148 AAAAATACTAAAAATTAGCTAGG + Intergenic
930319471 2:49836064-49836086 AAAAATACAAAGAATTAGCTGGG + Intergenic
930404562 2:50939048-50939070 AAAAATACTAAAAATTAGCTGGG + Intronic
930722109 2:54647678-54647700 AAAAATACAAAAAATCAGCTGGG + Intronic
930740398 2:54826437-54826459 AAAAATACACAAAACTAGCTGGG + Intronic
930764644 2:55072388-55072410 AAAAATACAAAAAATCAGCTGGG - Intronic
931286981 2:60840435-60840457 AAAAATACAAAAAATCAGCTGGG - Intergenic
931327339 2:61240437-61240459 AAAAATACAAAGAATTAGCTGGG - Intronic
931374794 2:61697276-61697298 AAAAATACAAAAAATCAGCTGGG + Intergenic
931379184 2:61736303-61736325 AAAAATACAAAGAATTAGCTGGG - Intergenic
931387186 2:61808431-61808453 AAAAATACAAAGAATTAGCTAGG - Intergenic
931523443 2:63125904-63125926 AAAAAAACTGAAAAGCAGCCTGG - Intronic
931561057 2:63561315-63561337 AAAAATACAAAAAACCAGCTGGG + Intronic
931794128 2:65693233-65693255 AAAAATACAAAGAATTAGCTGGG - Intergenic
932749824 2:74364327-74364349 GACAAGACTCAGGAGCAGCTGGG + Intronic
932835683 2:75034247-75034269 AAAAATACAAAAAATCAGCTGGG + Intergenic
933030228 2:77319224-77319246 AAAAATACAAAAAATCAGCTGGG + Intronic
933676167 2:85059762-85059784 AAAAATACAAAAAAGTAGCTGGG - Intergenic
934075937 2:88428832-88428854 AAAAATACTAAAAATTAGCTGGG + Intergenic
934544317 2:95202030-95202052 ACAAATTCTCAGAATCACCTCGG + Intergenic
934544515 2:95203660-95203682 AAAAATACAAAAAAGTAGCTGGG + Intergenic
934554373 2:95279588-95279610 AAAAATATGCAGAAGCGGCCGGG - Intronic
934688548 2:96339429-96339451 AAAAATACAAAAAAGTAGCTGGG + Intronic
934732259 2:96666809-96666831 AAAAATACAAAAAATCAGCTGGG - Intergenic
934846791 2:97666374-97666396 AAAAATACAAAAAAGTAGCTGGG + Intergenic
935228289 2:101073453-101073475 AAAAATACAAAAAAGTAGCTGGG - Intronic
935298338 2:101670265-101670287 AAAAATATCAATAAGCAGCTAGG - Intergenic
935514004 2:104011766-104011788 AAAAATGCTCAGAATCCGCTGGG - Intergenic
935556638 2:104517236-104517258 AAAGACACTCAGAAAAAGCTTGG - Intergenic
935616977 2:105096173-105096195 TAAAATAATCACAAGCAGATGGG - Intronic
935695927 2:105771081-105771103 AAAAATACAAAAAAGTAGCTGGG - Intronic
935700894 2:105811012-105811034 AAAAATACAAAAAAGTAGCTGGG + Intronic
935818763 2:106872760-106872782 AAAAATACAAAAAATCAGCTGGG - Intronic
936034976 2:109103952-109103974 AAAAATACAAAAAATCAGCTGGG - Intergenic
936149229 2:110003651-110003673 AAAAATACGAAGAATTAGCTGGG - Intergenic
936195451 2:110367718-110367740 AAAAATACGAAGAATTAGCTGGG + Intergenic
936341463 2:111637200-111637222 AAAAAAACTAAGAAGAAGCCAGG + Intergenic
936432672 2:112478537-112478559 AAAAATACAAAAAATCAGCTGGG - Intergenic
936546816 2:113397733-113397755 AAAAATACAAAAAATCAGCTGGG + Intergenic
936717144 2:115200832-115200854 CAAGATACTCAGTAGCACCTCGG - Intronic
936796785 2:116215654-116215676 AAAAATACAAAGAACTAGCTGGG - Intergenic
937179519 2:119978714-119978736 AGAAATATTCAGAAACTGCTAGG - Exonic
937196752 2:120164141-120164163 AAAAATACACAAAATTAGCTGGG - Intronic
937492002 2:122379576-122379598 AAAAATTCTCAGAATCTTCTAGG - Intergenic
937613414 2:123891664-123891686 AAAAATCCTAAAAAGCAGCAAGG - Intergenic
937774761 2:125763129-125763151 AAAAATACAAAAAATCAGCTGGG + Intergenic
938724317 2:134093353-134093375 AAAAATACAAAAAAGTAGCTGGG + Intergenic
938835192 2:135095207-135095229 AAAAATACAAAAAATCAGCTGGG - Intronic
939099881 2:137883629-137883651 AAAAATACAAAAAATCAGCTGGG - Intergenic
939146761 2:138425025-138425047 AAGCAGGCTCAGAAGCAGCTGGG + Intergenic
939340170 2:140884871-140884893 AAAAATACAAAGAATTAGCTGGG - Intronic
939467110 2:142571769-142571791 TAAAATATTCCGAAGCAGATTGG - Intergenic
939657376 2:144845015-144845037 AAAAATCCTCTGGAGCTGCTAGG + Intergenic
939736610 2:145854908-145854930 AAAAATACAAAGAATTAGCTGGG - Intergenic
939788040 2:146540399-146540421 GAAACTACTCAGAAGGTGCTAGG - Intergenic
939880394 2:147624395-147624417 AAAAATACTAAAAATTAGCTGGG - Intergenic
939975713 2:148715192-148715214 AAAAATACAAAGAAGTAGCCGGG - Intronic
940182470 2:150950662-150950684 AAAAATACTGAAAAGAAACTTGG + Intergenic
940267029 2:151849568-151849590 CAAAATACTCACAAAGAGCTGGG - Intronic
940291208 2:152079247-152079269 AAAAATACAAAAAATCAGCTGGG - Intronic
940362836 2:152814213-152814235 AAAAATACTAAGAATTAGCTGGG + Intergenic
940473224 2:154126472-154126494 AAAAATACAAAAAATCAGCTGGG + Intronic
940577027 2:155521845-155521867 TAAAATACTCAGAGGCAAATCGG - Intergenic
940684930 2:156836222-156836244 AACAAGACTCAGAAGAAACTTGG + Intergenic
941073305 2:160979132-160979154 AAAAATCCCAAGAAGCAGTTAGG - Intergenic
941113264 2:161441425-161441447 AAAAATACAAAGAATTAGCTGGG - Intronic
941275857 2:163489893-163489915 AAAAATACAAAAAAGTAGCTGGG + Intergenic
941338818 2:164279756-164279778 AAAAATACTAAAAATTAGCTGGG - Intergenic
941655788 2:168143551-168143573 AAAAATACAAAAAATCAGCTGGG + Intronic
942174840 2:173323377-173323399 AAAAATACAAAAAAGTAGCTGGG - Intergenic
942204587 2:173607572-173607594 AAAAATACTTAGAAGCCCCAGGG + Intergenic
942332748 2:174844902-174844924 AAAAATAATGAAAACCAGCTTGG - Intronic
942811018 2:180001487-180001509 AAAAATACACAAAATTAGCTGGG - Intronic
943072460 2:183156498-183156520 AAAAATACAAAAAATCAGCTGGG - Intronic
943121101 2:183737174-183737196 AAAAATACAAAAAATCAGCTGGG - Intergenic
943879661 2:193125218-193125240 AAAAATAGTCTGAAGGAGCAGGG + Intergenic
944002680 2:194859933-194859955 GAAAATACTAAGTAGCAGTTAGG + Intergenic
944154788 2:196597931-196597953 AAAAATACGAAAAATCAGCTGGG + Intergenic
944184267 2:196929684-196929706 AAAAATACAAAGAATTAGCTGGG + Intergenic
944732247 2:202528346-202528368 AAAAATACAAAAAATCAGCTCGG - Intronic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
944864361 2:203846430-203846452 AAAAATACAAAAAATCAGCTGGG - Intergenic
945412701 2:209530895-209530917 ATAAATACTGAGAAGCAACTAGG - Intronic
945513590 2:210733396-210733418 AAAAATACAAAAAATCAGCTGGG + Intergenic
945541130 2:211088094-211088116 AAAGGTACTCAGAAGCAAGTGGG + Intergenic
945869866 2:215215418-215215440 AAGATTTCTCAGAAGCAGTTTGG + Intergenic
946105995 2:217370175-217370197 AAAAATACACAAAATTAGCTGGG - Intronic
946244156 2:218376561-218376583 AAAAATACAAAAAATCAGCTGGG - Intergenic
947214479 2:227737414-227737436 AAAAATACTAAAAATTAGCTGGG - Intergenic
947619270 2:231578194-231578216 AAAAATACAAAAAAGTAGCTGGG - Intergenic
947630227 2:231647883-231647905 AAAAATACAAAAAAGTAGCTGGG - Intergenic
947635381 2:231678099-231678121 AAAAAAACTCTGGAACAGCTTGG - Intergenic
947645421 2:231735457-231735479 AAAAATACAAAAAATCAGCTGGG - Intronic
947675984 2:231980535-231980557 AAAAATACAAAAAATCAGCTGGG + Intronic
947850008 2:233279015-233279037 AAAAATATTAAAAAGTAGCTGGG + Intronic
947882963 2:233536488-233536510 AAAAATACAAAGAATTAGCTGGG + Intronic
948102503 2:235386060-235386082 GAAAAAATTAAGAAGCAGCTAGG - Intergenic
948426870 2:237894128-237894150 AAAAATACACAAAATTAGCTGGG - Intronic
948494849 2:238341016-238341038 AAAAATACACATAAGAAGCCGGG - Intronic
1168992721 20:2108347-2108369 AAAAATACAAAAAATCAGCTGGG + Intronic
1169027595 20:2383665-2383687 AAAAACACTCTGAAGCTGTTGGG + Intronic
1169390032 20:5182960-5182982 AAAACTGCTGAGAAGCAGGTAGG - Intronic
1169608570 20:7352318-7352340 AAATATAATCAGAAGGAGCCTGG - Intergenic
1169823911 20:9744902-9744924 AACTATACTGAGAAGCATCTTGG + Intronic
1170598271 20:17821669-17821691 AAAAATACAAAAAATCAGCTGGG + Intergenic
1171022327 20:21597180-21597202 AAAAAAACTCAGAAGAAGTTTGG - Intergenic
1171964748 20:31521135-31521157 AAAAATACTAAAAAGTTGCTAGG - Intronic
1172249506 20:33468953-33468975 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1172362856 20:34326306-34326328 AAAAATACAAAAAATCAGCTGGG + Intergenic
1172429571 20:34878092-34878114 AAAAATACAAAAAAGTAGCTGGG - Intronic
1172574754 20:35999836-35999858 AAAAATACACAAAATTAGCTGGG - Intronic
1172590478 20:36114164-36114186 AAAAGCACTGAGAAGTAGCTAGG - Intronic
1173300684 20:41799716-41799738 AAAAATACAAAATAGCAGCTGGG + Intergenic
1173358048 20:42313726-42313748 AAAAATTGGCAGAAGCATCTGGG - Intronic
1173550510 20:43930001-43930023 AAAAATACTCAGAAGCAGCTGGG - Intronic
1173580955 20:44146192-44146214 AAAAATACAAAAAATCAGCTGGG - Intronic
1173689312 20:44947657-44947679 AAAAATACAAAAAATCAGCTGGG - Intronic
1173696065 20:45014263-45014285 AAAAATACAAAAAATCAGCTGGG + Intronic
1174096179 20:48091376-48091398 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1174607898 20:51774321-51774343 AAAAATACAAAAAATCAGCTGGG + Intergenic
1174624321 20:51901742-51901764 AAAAATACAAAGAATTAGCTGGG - Intergenic
1174718180 20:52782973-52782995 AAGAAAACACAGAAGCAGCAGGG - Intergenic
1174805946 20:53604601-53604623 AAAAATACAAAAAATCAGCTGGG - Intronic
1175137110 20:56832494-56832516 AAAAATACTAAGAATTAGCCAGG - Intergenic
1175196321 20:57245797-57245819 AAAAATACAAAAAATCAGCTGGG - Intronic
1175558836 20:59899208-59899230 AAGAATAATCACAAGCACCTTGG + Intronic
1175698888 20:61123335-61123357 AAAAACACACAGAAGCATCAGGG + Intergenic
1176149452 20:63582030-63582052 AAAAATACAAAAAATCAGCTGGG - Intergenic
1176183378 20:63764273-63764295 AAAAATACAAAAAATCAGCTGGG + Intronic
1176221638 20:63971983-63972005 AAAAATACAAAAAATCAGCTGGG - Intronic
1176817001 21:13612307-13612329 AAAAATACAAAGAATTAGCTGGG + Intronic
1176859803 21:14003794-14003816 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1176864187 21:14034044-14034066 AAAAATACTAAAAATTAGCTGGG + Intergenic
1176891216 21:14321795-14321817 AAAAATACAAAGAATTAGCTGGG - Intergenic
1177012748 21:15748439-15748461 AAAAAAACTAAAAAGTAGCTGGG - Intronic
1177150799 21:17453847-17453869 AAAAATACAAAAAATCAGCTGGG + Intergenic
1177350162 21:19928726-19928748 AAAAATACACAAAATTAGCTGGG - Intergenic
1177759252 21:25384171-25384193 AAAAATACAAAGAATCAGCCGGG - Intergenic
1177845245 21:26281121-26281143 AAAAGTAGGCAGAAGCTGCTCGG - Intergenic
1177935418 21:27339084-27339106 AAAAATACAAAAAAACAGCTGGG + Intergenic
1177969456 21:27770372-27770394 AAAATTTCACTGAAGCAGCTGGG + Intergenic
1178348250 21:31850689-31850711 AAAAATACAAAAAATCAGCTGGG + Intergenic
1178373398 21:32046720-32046742 AAAAATACACAAAATCAGCCGGG - Intergenic
1178529872 21:33366963-33366985 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1178543608 21:33475791-33475813 AAAAATACAAAAAATCAGCTGGG + Intronic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1178985814 21:37301983-37302005 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1179220765 21:39404990-39405012 AAAAATACAAAAAATCAGCTGGG - Intronic
1179222082 21:39417333-39417355 AAAAAAACTAAAAAGCAGCTGGG - Intronic
1180126577 21:45794766-45794788 AAAAATACACAGAATGAGCCGGG + Intronic
1180583525 22:16864699-16864721 AAAAATACGAAGAATTAGCTGGG + Intergenic
1180664501 22:17499148-17499170 AAAAATACAAAAAATCAGCTGGG - Intronic
1180878259 22:19185485-19185507 AAAAATACAAAAAAGTAGCTGGG - Intronic
1181123519 22:20688733-20688755 AAAAATACAAAAAAGCAGCCGGG + Intergenic
1181279901 22:21712012-21712034 AAAAATACACAAAATTAGCTGGG + Intronic
1181281475 22:21723824-21723846 AAAAATACAAAAAATCAGCTGGG - Intronic
1181317457 22:21979778-21979800 AAAAATACTAAAAATTAGCTGGG + Intronic
1181721100 22:24774990-24775012 AAAAATACAAAAAATCAGCTGGG + Intergenic
1182482199 22:30616320-30616342 AAAAATACAAAAAAGTAGCTGGG + Intronic
1182637852 22:31743139-31743161 AAAAATACAAAAAATCAGCTGGG + Intronic
1182809313 22:33102648-33102670 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1183145758 22:35990020-35990042 AAAAATACAAAAAATCAGCTGGG + Intronic
1183159815 22:36105050-36105072 AAAAATACACAAAATTAGCTGGG - Intergenic
1183580047 22:38719164-38719186 AAAAATACTAAAAATTAGCTGGG - Intronic
1183621623 22:38976579-38976601 AAAAATACAAAAAATCAGCTGGG + Intronic
1183888558 22:40905950-40905972 AAAAATACAAAAAATCAGCTGGG - Intronic
1183912201 22:41088352-41088374 AAAAATACACAAAATTAGCTGGG + Intergenic
1184131954 22:42521946-42521968 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1184511651 22:44937023-44937045 AAAAATACAAAAAAGTAGCTGGG - Intronic
1184614827 22:45630916-45630938 AAAAATACAAAGAATCAGCCAGG + Intergenic
1184628082 22:45753564-45753586 AAAAATACAAAGAATTAGCTGGG - Intronic
1184935892 22:47720150-47720172 AAAAATACACAAAATTAGCTGGG + Intergenic
1185358652 22:50391270-50391292 AAAAATACAAAAAATCAGCTGGG + Intronic
949187801 3:1214727-1214749 AAGAAAACTCAGAATAAGCTGGG - Intronic
949461486 3:4299647-4299669 AAAAATACAAAAAAGTAGCTGGG + Intronic
949852840 3:8436249-8436271 AAAAATACAAAAAATCAGCTGGG + Intergenic
949984998 3:9533619-9533641 AAAAATACACAAAATTAGCTGGG + Intronic
949999546 3:9646338-9646360 AAAAATACAAAAAAACAGCTGGG - Intergenic
950501488 3:13366676-13366698 AAAAATACAAAGAATTAGCTGGG - Intronic
951336146 3:21424472-21424494 AAAAATACAAAGAATTAGCTGGG - Intronic
951366245 3:21786709-21786731 AAAATTACTTAGATGCAACTTGG - Intronic
952376516 3:32772187-32772209 AAAAATACACAAAATTAGCTGGG + Intronic
952379522 3:32793873-32793895 AAAAATACACAAAATTAGCTGGG + Intergenic
952397279 3:32931987-32932009 AAAAATACAAAAAATCAGCTGGG - Intergenic
952615863 3:35273338-35273360 AAAAATACAAAAAATCAGCTGGG - Intergenic
953071764 3:39527616-39527638 AAAAATACAAAGAATTAGCTGGG - Intronic
953327832 3:42028008-42028030 AAAAATACAAAAAATCAGCTGGG - Intronic
953454366 3:43030164-43030186 AAAAATACAAAAAAGTAGCTGGG - Intronic
953646745 3:44762255-44762277 AGAAATACGCAGAAGCTGGTGGG - Intronic
954037886 3:47862636-47862658 AAAAATACAAAAAATCAGCTGGG - Intronic
954084147 3:48230827-48230849 AAAAATACAAAAAATCAGCTGGG - Intergenic
954115092 3:48462540-48462562 AAAAATACAAAAAAGTAGCTGGG + Intronic
954473131 3:50716365-50716387 AAAAATACAAAAAATCAGCTGGG + Intronic
954770440 3:52963152-52963174 AAAAATACAAAAAATCAGCTGGG - Intronic
955076001 3:55613820-55613842 AAAAATACAAAAAATCAGCTGGG + Intronic
955305699 3:57828939-57828961 AAAAATACAAAAAATCAGCTGGG - Intronic
955309779 3:57873959-57873981 AAAAATACACAAAATTAGCTGGG + Intronic
955312809 3:57906474-57906496 AAAAATACTAAAAATTAGCTGGG - Intronic
955342312 3:58134544-58134566 AAGAAAAGTCAGATGCAGCTGGG + Intronic
955598734 3:60621307-60621329 AAAAATACAAAAAAGTAGCTAGG - Intronic
956037698 3:65113139-65113161 AAAAATGCTGAGCAGGAGCTAGG - Intergenic
956383689 3:68693608-68693630 AAAAATACAAAGAATTAGCTGGG + Intergenic
956612368 3:71137140-71137162 AAAAGAACTCAGAGGCCGCTAGG - Intronic
956632918 3:71333662-71333684 AAAAATACAAAGAAATAGCTGGG + Intronic
956668600 3:71664712-71664734 AAAAATACAAAAAAGTAGCTGGG + Intergenic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
957799594 3:85059076-85059098 AAAAATACAAAGAATTAGCTGGG + Intronic
958140370 3:89554955-89554977 AAAAATACAAAAAAGTAGCTGGG - Intergenic
958504698 3:94959795-94959817 AAAAATACAAAGAATTAGCTGGG - Intergenic
958797036 3:98717018-98717040 AAAAATACAAAAAAGTAGCTGGG - Intergenic
959359838 3:105374675-105374697 AAAAATACACAAAATTAGCTGGG - Intronic
959652538 3:108765067-108765089 AAAAATACAAAAAAGTAGCTGGG + Intergenic
960194562 3:114749390-114749412 AAAAATACAAAAAAGTAGCTGGG + Intronic
960658745 3:120034930-120034952 AAAAATACACAAAATTAGCTAGG + Intronic
960781249 3:121320858-121320880 AAAAATACAAAAAATCAGCTGGG - Intronic
960801407 3:121544190-121544212 AAAAATACAAAAAAGTAGCTGGG + Intronic
960904278 3:122583958-122583980 AAAGAAACTCAGAAGAAGCCTGG - Intronic
961052857 3:123761864-123761886 AAAAATACAAAAAATCAGCTGGG + Intronic
961102215 3:124209343-124209365 AAAAATACAAAAAATCAGCTGGG + Intronic
961138543 3:124535600-124535622 AAGAAAATTCAAAAGCAGCTTGG - Intronic
961602856 3:128074545-128074567 AAAAATAACCATAAGCAGCCGGG + Intronic
961836615 3:129666577-129666599 AAAAATACAAAAAAGTAGCTGGG + Intronic
961849478 3:129801082-129801104 AAAAATACAAAAAATCAGCTGGG - Intronic
961943325 3:130659157-130659179 AAAAATATTCCTAAGCAGGTAGG - Intronic
961974312 3:131006821-131006843 AAAAATACACAAAATTAGCTAGG - Intronic
962336587 3:134537286-134537308 TAAAATAATGAGAAGCAGATAGG + Intronic
963103176 3:141624396-141624418 AAAAATACAAAAAAGTAGCTGGG + Intergenic
963383553 3:144561220-144561242 AGAAATTCTCATAAGCTGCTTGG - Intergenic
964111697 3:153094795-153094817 AGAAATCCTCCCAAGCAGCTGGG - Intergenic
964169594 3:153753996-153754018 AAAAATACAAAGAATTAGCTGGG + Intergenic
964354435 3:155837193-155837215 AAAAATACACAAAATTAGCTGGG + Intronic
964417114 3:156459120-156459142 CAACATTGTCAGAAGCAGCTGGG - Intronic
964436954 3:156663526-156663548 AAAAATACTCAAAAAAAGTTGGG - Intergenic
964797802 3:160518698-160518720 AAAAATACAAAAAATCAGCTGGG + Intronic
964956440 3:162363730-162363752 AATAATACTAAAAAGCAGCTTGG + Intergenic
965039966 3:163494115-163494137 AAAAATACAAAAAATCAGCTGGG + Intergenic
965472302 3:169109709-169109731 AAAAATACTTAGAAGAGGCCGGG - Intronic
965924815 3:173965059-173965081 AAAAATACCTATAAGCAACTCGG - Intronic
966052864 3:175642659-175642681 AAAAATACACAAAATTAGCTGGG - Intronic
966080386 3:175992970-175992992 AAAATTACTCAGAGGTTGCTGGG - Intergenic
966105951 3:176334263-176334285 AAAAATTCTTGAAAGCAGCTAGG + Intergenic
966162438 3:176982840-176982862 AAAAATACTAAAAATTAGCTGGG - Intergenic
966378034 3:179317049-179317071 AAAAATACAAAGAAGTAGCTGGG - Intergenic
966579633 3:181545794-181545816 AAAAATACAAAAAATCAGCTGGG + Intergenic
967047142 3:185748014-185748036 AAAAATACAAAAAAGTAGCTGGG - Intronic
967064008 3:185898064-185898086 AAAAATACTAAAAATTAGCTGGG + Intergenic
967369487 3:188728052-188728074 ATAAAGACTCAGAATCACCTGGG + Intronic
967579299 3:191133599-191133621 AAAAATAAGAAGAATCAGCTTGG - Intergenic
967638288 3:191831206-191831228 AAAAAGAAGCAGCAGCAGCTAGG + Intergenic
967723372 3:192838587-192838609 AAAAATACAAAAAAGTAGCTGGG - Intronic
967742038 3:193014348-193014370 AAAAATACAAAAAATCAGCTGGG - Intergenic
968176212 3:196551499-196551521 AAAAATAATCTGAAGAGGCTGGG + Intergenic
968406426 4:343562-343584 AAAAATACAAAAAATCAGCTGGG + Intronic
968542292 4:1173722-1173744 AAAAATAAATAGAAGCAACTAGG + Intronic
969915728 4:10489825-10489847 AAAAATACAAAAAATCAGCTGGG - Exonic
970190776 4:13514499-13514521 AAATATACTCAAAAGTGGCTAGG + Intergenic
970400906 4:15716934-15716956 AAAAATACAAAAAATCAGCTGGG - Intronic
970497047 4:16636793-16636815 CAAAAAGCTCTGAAGCAGCTGGG + Intronic
970843127 4:20499647-20499669 AAAAATACAAAGAACTAGCTGGG - Intronic
970994580 4:22250642-22250664 AAGAATAACCAGAAGCAGGTTGG - Intergenic
971121980 4:23714700-23714722 AAAAATACAAAAAAGTAGCTGGG - Intergenic
971154939 4:24071701-24071723 AAAAATCCTGAGAAGCAGTACGG + Intergenic
971318575 4:25587140-25587162 AAAAATACAAAAAACCAGCTGGG - Intergenic
971401067 4:26275789-26275811 AAAAATACAAAAAAGTAGCTGGG - Intronic
971702537 4:29997297-29997319 AAAAATACTCTGAAACATATTGG + Intergenic
972288637 4:37670729-37670751 AAAAATACAAAAAATCAGCTGGG - Intronic
972382333 4:38530907-38530929 AAAAATTTTAAAAAGCAGCTGGG + Intergenic
972449973 4:39187257-39187279 AAAAATACAAAAAAGTAGCTGGG + Intronic
972548350 4:40104111-40104133 AAAAATACAAAAAAGTAGCTGGG - Intronic
972574457 4:40339116-40339138 AAAAATACAAAAAATCAGCTGGG + Intronic
972678353 4:41281961-41281983 AAAAATACTTAAAATTAGCTGGG - Intergenic
972792387 4:42385405-42385427 AAAAATACAAAAAATCAGCTGGG + Intergenic
972803880 4:42507566-42507588 AAAAATACAAGAAAGCAGCTGGG + Intronic
972809211 4:42563932-42563954 AAAAATACTTAAAATTAGCTGGG + Intronic
973204274 4:47542636-47542658 AAAAATACACAAAATTAGCTGGG - Intronic
974006671 4:56564297-56564319 AAAAATACAAAGAATTAGCTAGG - Intronic
974396436 4:61342155-61342177 AAAAACCCTCAGCAGCAGCAAGG - Intronic
974532052 4:63121460-63121482 AAAAATACAAAGAATTAGCTGGG - Intergenic
975130581 4:70828896-70828918 AAAAATACAAAAAATCAGCTGGG - Intronic
975603157 4:76125128-76125150 AAAAATACAAAGAAGTAGCTGGG + Intronic
976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG + Exonic
976231299 4:82846162-82846184 AAAAATACTAAAAATTAGCTGGG - Intronic
976308660 4:83587585-83587607 AAAAATACAAAGAATTAGCTGGG - Intronic
976718917 4:88151575-88151597 AAAAATACAAAAAAGTAGCTGGG + Intronic
976819081 4:89184633-89184655 AAAATTACCCAGAAGCAAGTTGG + Intergenic
976861067 4:89666976-89666998 AAAAATACTAAAAATTAGCTTGG + Intergenic
976930968 4:90566761-90566783 AAAAATACACAAAATTAGCTGGG - Intronic
977144512 4:93420912-93420934 AAAAATACAAAAAAGTAGCTGGG - Intronic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
977529499 4:98183400-98183422 AAAAATACACAAAATTAGCTGGG - Intergenic
977876374 4:102155204-102155226 AAACATAAGCAGAAGTAGCTGGG + Intergenic
977895138 4:102355756-102355778 AAAAATACTCAGAAAAATCTTGG + Intronic
978038015 4:104020442-104020464 AATAATTCTCAGAAACAGCCGGG - Intergenic
978062940 4:104360571-104360593 AAAAATGCTCAGAAACAGAAAGG + Intergenic
978100708 4:104837482-104837504 GAAAATGCTCAGAAGAAGATGGG + Intergenic
978468534 4:109036086-109036108 AAAAATACCAAAAAGTAGCTGGG - Intronic
978577964 4:110204910-110204932 AAAAATACAAAAAATCAGCTGGG + Intergenic
978789522 4:112646136-112646158 AAAAATACAAAGAATTAGCTGGG - Intronic
978799379 4:112740541-112740563 AAAAATACAAAAAAGTAGCTGGG + Intergenic
978817210 4:112921318-112921340 AATAATACACAGAATCAGCCGGG - Intronic
979127607 4:116995425-116995447 AAAAATACGCAAGAGAAGCTTGG - Intergenic
979376908 4:119957160-119957182 AAAAATACAAAAAATCAGCTGGG - Intergenic
979693943 4:123590581-123590603 AAAAATACTAAGAATTAGCTGGG - Intergenic
979715302 4:123830443-123830465 AAAAATACAAAAAATCAGCTGGG - Intergenic
979886254 4:126031242-126031264 AAAAATACAAAAAAGTAGCTGGG + Intergenic
980268551 4:130553033-130553055 AAAAATACAAAGAATTAGCTGGG - Intergenic
980380018 4:132001301-132001323 AAAAATACAAAAAAGTAGCTGGG + Intergenic
980906486 4:138953199-138953221 AAAAATACAAAAAATCAGCTGGG + Intergenic
980982302 4:139665106-139665128 AAAAATACAAAAAATCAGCTGGG - Intergenic
981308358 4:143269893-143269915 AAAAATACATAAAAGTAGCTGGG - Intergenic
981980647 4:150786934-150786956 AAAAATACTCAGATTCGGCCAGG + Intronic
982019469 4:151189272-151189294 AAAAATACAAAAAATCAGCTGGG - Intronic
982041678 4:151403446-151403468 AAAAATACACAAAATTAGCTGGG + Intergenic
982106461 4:152015737-152015759 AAAAACACAAAGGAGCAGCTGGG - Intergenic
982450793 4:155550267-155550289 AAAAATACACAAAATTAGCTGGG + Intergenic
982459829 4:155655290-155655312 AAAAATACAAAAAATCAGCTGGG + Intergenic
982475694 4:155847559-155847581 AAAAATACAAAAAATCAGCTGGG + Intronic
982751358 4:159166151-159166173 AAAAATACACAAAATTAGCTGGG + Intronic
983035154 4:162855147-162855169 AAAAATACAAAAAATCAGCTGGG - Intergenic
983053756 4:163078509-163078531 AATAAGCCTCAGAACCAGCTGGG - Intergenic
983079152 4:163364176-163364198 AAAAATAGGCAGATGCGGCTGGG + Intergenic
983095186 4:163552870-163552892 AAAAATACAAAAAATCAGCTGGG + Intronic
983285664 4:165736122-165736144 AAAAATACTAAAAATTAGCTGGG + Intergenic
983724956 4:170909896-170909918 AAAAATACACAAAATTAGCTGGG - Intergenic
984077823 4:175205555-175205577 AAAAATACACAGACTCTGCTGGG + Intergenic
984450085 4:179888615-179888637 AAAAATACCAAAAATCAGCTGGG + Intergenic
984459196 4:180011480-180011502 AAAAATATTCAGAAGCAATGAGG - Intergenic
984473107 4:180202440-180202462 AAAAATACTAAAAATTAGCTGGG - Intergenic
984665977 4:182430385-182430407 AAAAATACACAAAATTAGCTGGG + Intronic
984812450 4:183807131-183807153 AAAAATACTAAAAATTAGCTGGG - Intergenic
984830065 4:183964741-183964763 AAAAATACAAAAAATCAGCTGGG - Intronic
984871791 4:184332122-184332144 AAAAATACAAAGAATTAGCTTGG - Intergenic
984890863 4:184491547-184491569 AAAATAACTCAGAAACAGCAAGG + Intergenic
985104065 4:186484636-186484658 AAAAATACAAAAAATCAGCTAGG - Intronic
985215789 4:187652130-187652152 AAAAATACAAAGAATTAGCTGGG + Intergenic
986145707 5:5075408-5075430 AAAAATACAAAAAAGTAGCTGGG - Intergenic
987154913 5:15079296-15079318 AAAAATACAAAGAATTAGCTGGG + Intergenic
987202554 5:15591869-15591891 AAAAATACAAAGAATTAGCTGGG - Intronic
987308306 5:16658905-16658927 AAAAATACAAAGAATTAGCTGGG + Intergenic
987377855 5:17253369-17253391 AAAAATACAAAGAATTAGCTGGG - Intronic
988069970 5:26275414-26275436 AAAAATACAAAGAATTAGCTGGG + Intergenic
988371321 5:30371609-30371631 AAAAATACAAAAAATCAGCTGGG + Intergenic
988483952 5:31652849-31652871 AAAAATACAGAAAAGTAGCTGGG + Intronic
988487850 5:31681405-31681427 AAAAATACAAAGAATTAGCTGGG - Intronic
988586406 5:32511313-32511335 AAAAATACACAGAAGGATATGGG + Intergenic
988788373 5:34584792-34584814 TAAAATACTTAGAAGAAGTTTGG + Intergenic
988889240 5:35596853-35596875 AAAAATTATTAGAAGAAGCTGGG + Intergenic
989051272 5:37322544-37322566 AAAAATACAAAGAATTAGCTGGG + Intronic
989051518 5:37324988-37325010 AAAAATACAAAAAATCAGCTGGG + Intronic
989059724 5:37398247-37398269 AAAAATACGAAAAATCAGCTGGG - Intronic
989213807 5:38883152-38883174 AAAAATACAAAAAATCAGCTGGG + Intronic
989283986 5:39678116-39678138 AAAAAAAAACAGAAACAGCTGGG - Intergenic
989303681 5:39926457-39926479 AAAAATACAAAAAATCAGCTGGG + Intergenic
989382164 5:40820392-40820414 AAAAATACCCAAAATTAGCTGGG - Intergenic
989436203 5:41416500-41416522 AACTGTACTCAGAAGCAGATGGG + Intronic
989593569 5:43134855-43134877 AAAAATACAAAGAATTAGCTGGG - Intronic
990415221 5:55579851-55579873 AAAAATACACAAAATTAGCTGGG - Intergenic
990470382 5:56109855-56109877 AAAAATACAAAGAATTAGCTGGG + Intronic
990534569 5:56707529-56707551 AAAAATACAAATAAGCAGCTGGG - Intergenic
990549902 5:56864533-56864555 AAAAATACAAAAAATCAGCTGGG - Intronic
990644307 5:57826489-57826511 AAAAATGGCAAGAAGCAGCTGGG - Intergenic
990752197 5:59029115-59029137 AAAAATACTTAGGAGCAGCCAGG + Intronic
990782157 5:59377254-59377276 AAAAATACAAAAAATCAGCTGGG + Intronic
990835521 5:60014980-60015002 AAAAATTCTGAGATCCAGCTGGG - Intronic
991267304 5:64736620-64736642 AAAAATACAAAAAAGTAGCTGGG - Intronic
991327314 5:65449453-65449475 AAAAATACAAAAAATCAGCTGGG + Intronic
991344574 5:65650015-65650037 AAAAATACAAAAAATCAGCTGGG - Intronic
991389198 5:66124234-66124256 AAAAAATCTCAAAATCAGCTAGG + Intergenic
991404393 5:66287872-66287894 AAAAATATACAAAAGTAGCTGGG + Intergenic
991643863 5:68781078-68781100 AAAAATACAAAAAATCAGCTGGG - Intergenic
991691658 5:69231215-69231237 AAAAATACAAAAAATCAGCTGGG + Intergenic
991734655 5:69620726-69620748 AAAAATACAAAAAAGTAGCTGGG - Intergenic
991780323 5:70125995-70126017 AAAAATACAAAAAAGTAGCTGGG + Intergenic
991811089 5:70475867-70475889 AAAAATACAAAAAAGTAGCTGGG - Intergenic
991859610 5:71001409-71001431 AAAAATACAAAAAAGTAGCTGGG + Intronic
991872770 5:71126306-71126328 AAAAATACAAAAAAGTAGCTGGG + Intergenic
991930037 5:71745282-71745304 AAAAATACAAAAAATCAGCTGGG - Intergenic
992014986 5:72566627-72566649 AAAAATACAAAAAAGTAGCTGGG + Intergenic
992108108 5:73467160-73467182 AAAAATACAAAAAAGTAGCTAGG + Intergenic
992233875 5:74688493-74688515 AAAAATACAAACAATCAGCTGGG - Intronic
992513374 5:77464404-77464426 AAAAATACTAGAAATCAGCTGGG - Intronic
992703660 5:79365596-79365618 AATAATACTCTGAAGGAGTTCGG + Intergenic
993495146 5:88600526-88600548 AAAAATACAAAAAAGTAGCTGGG - Intergenic
993601954 5:89937182-89937204 AAAAATATTCAAAACCAGATTGG + Intergenic
993956260 5:94236812-94236834 TAAAATACTAAGGAGCATCTGGG - Intronic
994199501 5:96956575-96956597 AGAAATACTCAAAATCAGCTAGG - Intronic
994761252 5:103856960-103856982 AAAAATACAAAAAAGCAGCCAGG - Intergenic
995041463 5:107592912-107592934 AAAATTAGTCAAAAGAAGCTTGG - Intronic
995799040 5:115973087-115973109 AAAAATACAAAAAATCAGCTAGG - Intronic
996352108 5:122555681-122555703 AAAAATACTTACAATCATCTGGG - Intergenic
996723400 5:126651775-126651797 AAAAATACAAAGAATTAGCTGGG + Intergenic
996742591 5:126814697-126814719 AAAAATACAAAGAATTAGCTGGG - Intronic
997029575 5:130110108-130110130 AAAAAATTTCAGAAGCAGCCAGG - Intronic
997029712 5:130112240-130112262 GAAAATATTCAGAAGTAGCAAGG - Intronic
997044860 5:130302716-130302738 AAAAATACAAAAAATCAGCTGGG + Intergenic
997461834 5:134058181-134058203 CAAAATAGTGAGAAGCAACTGGG - Intergenic
997553040 5:134770369-134770391 AAATATACTAAGAATTAGCTGGG - Intronic
998306442 5:141082137-141082159 AAAAATACAAAAAATCAGCTGGG - Intergenic
998408537 5:141889101-141889123 AAATATAGTCAGAAGGAGTTTGG - Intergenic
998439917 5:142150018-142150040 AAAAATACAAAAAATCAGCTGGG + Intronic
999161182 5:149500436-149500458 AAAAATACAAAAAAGTAGCTGGG - Intronic
999181467 5:149672634-149672656 AAAAATACAAAAAAGTAGCTGGG + Intergenic
999290639 5:150423441-150423463 AATAATACTCAGCATGAGCTGGG + Intergenic
999396146 5:151229716-151229738 AAAGATGCTCAGAATAAGCTGGG - Intronic
999648942 5:153746766-153746788 AAAAATACACAGAAGGAAATGGG + Intronic
999974053 5:156893372-156893394 AAAAATACAAAAAATCAGCTGGG - Intergenic
1000084405 5:157876855-157876877 AAAAATACAAAGAATTAGCTGGG - Intergenic
1000176639 5:158762694-158762716 AAAAATACAAAAAAGTAGCTGGG - Intronic
1000488258 5:161876265-161876287 GAAAATATTCAGAAACACCTTGG + Intronic
1000712252 5:164595342-164595364 AAAAATACACAAAATTAGCTGGG + Intergenic
1001053327 5:168429772-168429794 AAAAATACACAAAATTAGCTGGG + Intronic
1001165345 5:169360589-169360611 AAAAATACACAAAATTAGCTGGG + Intergenic
1001343283 5:170866512-170866534 AAAAATACACAAAATTAGCTGGG + Intronic
1001458775 5:171889725-171889747 AAAAATACAAAAAAGTAGCTGGG + Intronic
1001620315 5:173078682-173078704 AAAAATACTCACCAGCACTTTGG - Intronic
1001730624 5:173953163-173953185 TAAAATACCCAAAAGGAGCTGGG + Exonic
1001909642 5:175504887-175504909 AAAAATACAAAAAATCAGCTGGG - Intronic
1001990557 5:176112685-176112707 CCAAATATTCAGAAGCTGCTGGG + Intronic
1001997983 5:176177294-176177316 AAAAATACAAAAAATCAGCTGGG - Intergenic
1002012093 5:176291495-176291517 AAAAATACAAAAAATCAGCTGGG - Intronic
1002053842 5:176587150-176587172 AATAATTCTCAGAGCCAGCTGGG + Intronic
1002226316 5:177725455-177725477 CCAAATATTCAGAAGCTGCTGGG - Intronic
1002257423 5:177968491-177968513 AAAAATACACAAAATTAGCTGGG - Intergenic
1002267535 5:178045758-178045780 CCAAATATTCAGAAGCTGCTGGG + Intronic
1002468206 5:179418480-179418502 AAAAATACAAAGAAGTAGCTGGG + Intergenic
1002528885 5:179831942-179831964 AAAAATACAAAAAATCAGCTGGG - Intronic
1002616601 5:180460088-180460110 AAAAATACAAAAAATCAGCTGGG + Intergenic
1003007563 6:2395990-2396012 TAAAATACTCATAGGTAGCTGGG + Intergenic
1003082184 6:3030068-3030090 GCAAATACTCAAAAGCAGGTAGG + Intergenic
1003264366 6:4552500-4552522 AAAAATCCTCAGCAGCTTCTTGG - Intergenic
1003301644 6:4889382-4889404 AAAAATACACAAAATTAGCTGGG - Intronic
1003372956 6:5546409-5546431 AAAAATACACAAAATTAGCTGGG - Intronic
1003617174 6:7665999-7666021 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1003658562 6:8038643-8038665 AAAAATACAAAGAAGTAGCCAGG - Intronic
1003900533 6:10651109-10651131 AAAAATACACAAAATTAGCTGGG - Intergenic
1003944045 6:11057441-11057463 AAAAATACTAAAAATTAGCTGGG - Intergenic
1003962215 6:11219393-11219415 AAAAATAATCAGAGGAAGCCGGG - Intronic
1004128304 6:12895476-12895498 AAAAATAGAAAGAATCAGCTGGG - Intronic
1004174136 6:13324286-13324308 AAAAATACAAAAAATCAGCTGGG - Intronic
1004210038 6:13630968-13630990 AAAAATACAAAAAAGTAGCTGGG - Intronic
1004232320 6:13844743-13844765 AAAAATACTCAGGGGCGGCCCGG + Intergenic
1004268601 6:14173216-14173238 AAATATACTAAAAACCAGCTGGG + Intergenic
1004351561 6:14894562-14894584 AAGAATGCTCAGGAACAGCTGGG + Intergenic
1004698954 6:18060750-18060772 AAAAATACAAAGAATTAGCTGGG - Intergenic
1004706665 6:18130841-18130863 AAAAATACTCAAAATTGGCTGGG + Intronic
1004777789 6:18868051-18868073 AAAAATACAAAAAAGGAGCTGGG + Intergenic
1004870878 6:19902672-19902694 AATAACACTCTGAAGCAGCATGG + Intergenic
1004967813 6:20874660-20874682 AAAAATACAGAAAATCAGCTGGG - Intronic
1004977228 6:20981678-20981700 AAAAATACGAAGAATTAGCTGGG + Intronic
1004997035 6:21203535-21203557 AAAAATAAACAGTATCAGCTGGG - Intronic
1005026871 6:21471224-21471246 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1005111046 6:22282433-22282455 CAAAATGCTCAGGAGCAGCCAGG - Intergenic
1005143703 6:22663593-22663615 AAAAATACAAAAAATCAGCTGGG - Intergenic
1005567450 6:27111152-27111174 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1005569912 6:27134772-27134794 AAAAATACAAAAAAGTAGCTGGG - Exonic
1005662477 6:28013203-28013225 AAGAACAATCAGAAGCAGTTTGG - Intergenic
1005750080 6:28874069-28874091 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1005827991 6:29647114-29647136 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1005977269 6:30809331-30809353 AAAAATAATAAAAATCAGCTGGG + Intergenic
1005980960 6:30836091-30836113 AAAAATACAAAGAATTAGCTGGG + Intergenic
1006266359 6:32928054-32928076 AAAAATACTAAAAATTAGCTGGG + Intergenic
1006269215 6:32950993-32951015 AAAAATACAAAAAAGTAGCTGGG + Intronic
1006381858 6:33703322-33703344 AAAAATACACAAAATTAGCTGGG - Intronic
1006548966 6:34804543-34804565 AATGATACTGAGAAGCAGCAGGG + Intronic
1006700676 6:35970671-35970693 AAAAATAATCAGAAGAATTTTGG - Intronic
1006785009 6:36660595-36660617 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1006937345 6:37727785-37727807 AAAAAAACAGACAAGCAGCTGGG - Intergenic
1006948296 6:37800341-37800363 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1007205034 6:40142692-40142714 CTTAATACTCAGAAGCACCTAGG + Intergenic
1007221263 6:40280762-40280784 AAAAATACGCAAAATTAGCTGGG + Intergenic
1007566405 6:42854341-42854363 AAAAATACAAAAAAACAGCTGGG - Intronic
1007653094 6:43435201-43435223 AAAAAGACTCAAAATGAGCTAGG + Intronic
1007913066 6:45535441-45535463 AAAAATACAAAGAATTAGCTGGG + Intronic
1008011128 6:46468960-46468982 AAAAGTAACCTGAAGCAGCTGGG - Intronic
1008652552 6:53577762-53577784 AAAAATACAAATAATCAGCTGGG + Intronic
1008803994 6:55405528-55405550 GTAAATATGCAGAAGCAGCTAGG - Intergenic
1008910605 6:56728513-56728535 AAAAATACTAAAAATTAGCTGGG + Intronic
1009638640 6:66300878-66300900 AAAAATACTCAGCAAAGGCTGGG - Intergenic
1010033095 6:71289577-71289599 AAAATTACTCAGAATAAGGTGGG + Intronic
1010092028 6:71994135-71994157 AAAAATAAACAAAAGTAGCTAGG - Intronic
1010276520 6:73973814-73973836 AAAAATACACAAAATTAGCTGGG - Intergenic
1010338665 6:74721784-74721806 AAAAATCCTCAGAAGATTCTAGG - Intergenic
1010344774 6:74799079-74799101 AAAAATACAAAAAATCAGCTGGG + Intergenic
1010465212 6:76159978-76160000 AAAAAGAATCAGAAACAGATTGG - Intergenic
1010488713 6:76449127-76449149 AAAAATACTAAAAAGTAGCAGGG - Intergenic
1010790298 6:80056119-80056141 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1011132377 6:84064646-84064668 AAAAATACAAAAAAGTAGCTGGG - Intronic
1011238355 6:85242824-85242846 TAAAATATTCAGAAACAGGTAGG + Intergenic
1011278635 6:85654717-85654739 AAAAATACACAGAATTAGCCGGG - Intergenic
1011441611 6:87392919-87392941 AAAAATACTAAGAAGGAAATTGG + Intronic
1011995739 6:93585543-93585565 AGAGATAATCAGAAGCAGTTAGG + Intergenic
1012130230 6:95481752-95481774 AAAAATACTGAAAATTAGCTGGG + Intergenic
1012651192 6:101755325-101755347 AAAAATACAAAAAATCAGCTGGG - Intronic
1012738625 6:102983270-102983292 AAAAATACTCAGTAACAGACAGG + Intergenic
1012867076 6:104631620-104631642 AAAAATAATAATATGCAGCTTGG + Intergenic
1013057123 6:106594346-106594368 AAAAATACAAAAAAGTAGCTGGG + Intronic
1013143039 6:107359169-107359191 AAAAATACAAAAAATCAGCTGGG - Intronic
1013225882 6:108119219-108119241 AAAAAAACTTAGAAGCAATTTGG - Intronic
1013248262 6:108308864-108308886 AAAAATACAAAAAAGCAGCTGGG - Intronic
1013314866 6:108931922-108931944 AAAAATACAAAGAATTAGCTGGG - Intronic
1013434239 6:110085732-110085754 AAAAAGAATCAAAAGGAGCTTGG + Intergenic
1013565597 6:111357530-111357552 AAAAATACAAAGAATTAGCTGGG + Intronic
1013790307 6:113828998-113829020 AAAGATTTTCAGGAGCAGCTTGG - Intergenic
1013997894 6:116329982-116330004 AAAAATACAAAAAATCAGCTGGG - Intronic
1014136767 6:117898405-117898427 GAAAAGACTCTGAAGCAGCTTGG + Intergenic
1014239072 6:118994523-118994545 AAAAATACAAAAAATCAGCTGGG + Intronic
1014435359 6:121415004-121415026 AAAAATACAAAAAATCAGCTGGG - Intergenic
1014439757 6:121460760-121460782 AAAAATACTAAAAATTAGCTGGG - Intergenic
1014530413 6:122552535-122552557 AAAAATACAAAAAAGTAGCTGGG - Intronic
1014538194 6:122641986-122642008 AAAATTAATCAGTAACAGCTGGG - Intronic
1014544659 6:122719906-122719928 AAAAATACACAGAAGGATATAGG + Intronic
1014617923 6:123627087-123627109 AAAAATACAAAAAATCAGCTGGG - Intronic
1014748587 6:125229924-125229946 AAAAATACAAAAAATCAGCTGGG + Intronic
1015109632 6:129577045-129577067 AAAAATACTCATAAACACATAGG + Exonic
1015741578 6:136460784-136460806 AAAAATCTTCAGATGCACCTTGG - Intronic
1015964455 6:138684049-138684071 AAAAATACAAAAAATCAGCTGGG + Intronic
1016049113 6:139511807-139511829 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1016073777 6:139772424-139772446 AAAAATACAAAAAATCAGCTGGG + Intergenic
1016425469 6:143932032-143932054 AAAAATACTAAAAATTAGCTGGG - Intronic
1016723264 6:147327600-147327622 AAAAATACAAAAAACCAGCTGGG - Intronic
1016741794 6:147536142-147536164 AAAAATACAAAAAATCAGCTGGG - Intronic
1017351824 6:153451666-153451688 AAAAAGTCTAAGAAGCAGCTGGG + Intergenic
1017507233 6:155079785-155079807 AAAAATACAAAAAATCAGCTGGG + Intronic
1017786034 6:157757932-157757954 AAGAAGACTAAGAAGCAGATGGG + Intronic
1018615233 6:165680606-165680628 AAAAATACTCATTACCAGCCAGG + Intronic
1018777956 6:167035725-167035747 AAAAATACAAAAAATCAGCTGGG - Intronic
1019364507 7:625845-625867 AAAAATACACAAAATTAGCTGGG + Intronic
1019555436 7:1627447-1627469 AAAAATACAAAAAATCAGCTGGG - Intergenic
1019935201 7:4250502-4250524 AAAAATACCAAAAATCAGCTGGG - Intronic
1019990273 7:4685373-4685395 AAAAATACAAAGAATTAGCTGGG - Intronic
1020033213 7:4947552-4947574 AAAAATACAAAAAAGTAGCTGGG - Intronic
1020081513 7:5288463-5288485 AAAAATACACAAAATTAGCTGGG - Intronic
1020175099 7:5875994-5876016 AAAAATAATAATAATCAGCTAGG - Intergenic
1020525086 7:9249449-9249471 AAAAATACTGAGAAACAGAAAGG + Intergenic
1021003180 7:15359126-15359148 AAAAATACACAAAATTAGCTGGG + Intronic
1021105874 7:16639013-16639035 AAAAATAATCTGAAACAGATTGG + Intronic
1021369589 7:19826610-19826632 AAAAATACAAAAAATCAGCTGGG + Intergenic
1021396294 7:20152624-20152646 ATAAACACTCAGAAGCAGAAAGG - Intronic
1021401446 7:20213927-20213949 ATAAAAACTCAAGAGCAGCTTGG + Intronic
1021417935 7:20409629-20409651 AAAAATATTCTCAAGTAGCTTGG - Exonic
1022147368 7:27558486-27558508 AAAAATACAAAAAAGTAGCTGGG - Intronic
1022321968 7:29296242-29296264 AAAAATACACAAAATTAGCTGGG - Intronic
1022746051 7:33173418-33173440 AAAAATACAAAAAATCAGCTGGG + Intronic
1022917103 7:34968473-34968495 AAAAATATTAAAAAGCAGCCAGG + Intronic
1023413814 7:39913777-39913799 AAAATTATTCAGGAGCAGATAGG - Intergenic
1023414055 7:39915895-39915917 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1023545991 7:41318076-41318098 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1023832720 7:44049315-44049337 AAAAATACAAAAAATCAGCTGGG - Intronic
1024259806 7:47565524-47565546 AAAAATACAAAAAATCAGCTGGG - Intronic
1024423107 7:49193128-49193150 AAAATTCCTCAGAACCAGCAAGG + Intergenic
1024629118 7:51232648-51232670 AAAAATACAAAAAATCAGCTGGG + Intronic
1024723970 7:52171198-52171220 AAAAATACAAAAAATCAGCTAGG + Intergenic
1024925667 7:54611938-54611960 AAAAAACCTTAAAAGCAGCTGGG - Intergenic
1025055040 7:55758411-55758433 AAAAATACACAAAATTAGCTGGG - Intergenic
1025061197 7:55809991-55810013 AAAAATACACAAAATCAGCCTGG - Intronic
1025076438 7:55947759-55947781 AAAAATACACAAAAGTAGCTGGG - Intergenic
1025084594 7:56012627-56012649 AAAAAGACTCAAAGGCGGCTGGG + Intronic
1025627724 7:63236804-63236826 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1025865695 7:65378579-65378601 AAAAATACAAAAAAGTAGCTGGG + Intronic
1025935783 7:66035696-66035718 AAAAATACACAAAATTAGCTGGG + Intergenic
1025936624 7:66043169-66043191 AAAAAAACTCAAAAGGAGCCAGG + Intergenic
1025942625 7:66085315-66085337 AAAAATACACAAAATTAGCTGGG + Intronic
1025974912 7:66362057-66362079 AAAAATACAAAAAATCAGCTGGG + Intronic
1025999692 7:66551315-66551337 AAAAATACAAAGAATTAGCTGGG - Intergenic
1026042634 7:66881023-66881045 AAAAATACAAAGAATTAGCTGGG + Intergenic
1026176948 7:68006365-68006387 AAAAATACAAAAAATCAGCTGGG - Intergenic
1026194380 7:68160090-68160112 AAAAATACAAAAAATCAGCTGGG + Intergenic
1026369114 7:69680963-69680985 TAAAATACTCAAATTCAGCTGGG - Intronic
1026489704 7:70852138-70852160 AAAAATGCTCACAATCATCTGGG + Intergenic
1026605820 7:71814992-71815014 AAAAATACAAAAAATCAGCTGGG - Intronic
1026617649 7:71920494-71920516 AAAAATACAAAAAATCAGCTGGG - Intronic
1026666681 7:72346674-72346696 AAAAATACACAAAATTAGCTGGG - Intronic
1026718430 7:72810010-72810032 AAAAAAACACAGAAGAGGCTGGG + Intronic
1026732037 7:72920513-72920535 AAAAATACAAAAAATCAGCTGGG - Intronic
1026768737 7:73178819-73178841 AAAAATACAAAGAATTAGCTGGG + Intergenic
1026831097 7:73610632-73610654 AAAAATACAAAAAACCAGCTGGG - Intronic
1026861855 7:73795706-73795728 AAAAATACAAAAAATCAGCTGGG - Intergenic
1026934582 7:74246033-74246055 AAAAATACAAAAAATCAGCTGGG + Intronic
1026967154 7:74447537-74447559 AAAAATACAGAAAATCAGCTGGG + Intergenic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027024876 7:74844026-74844048 AAAAATACAAAGAATTAGCTGGG - Intronic
1027062888 7:75100093-75100115 AAAAATACAAAGAATTAGCTGGG + Intronic
1027078436 7:75213835-75213857 AAAAATACAAAGAATTAGCTGGG - Intergenic
1027225175 7:76239191-76239213 AAAAATACAAAGAATTAGCTGGG - Intronic
1027305633 7:76893286-76893308 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1027380487 7:77604046-77604068 AAAAATACCCAAAATTAGCTGGG - Intronic
1027430659 7:78109469-78109491 AAAAATACACAAAATTAGCTGGG + Intronic
1027635665 7:80669654-80669676 AAAAATACACAAAATTAGCTGGG - Intronic
1027986947 7:85305136-85305158 AAGAATATTCAGAAGAAGCGTGG + Intergenic
1028416926 7:90590313-90590335 AAAAATACAAAAAATCAGCTGGG + Intronic
1028546559 7:92008524-92008546 AAAAATACAAAAAATCAGCTAGG + Intronic
1028995622 7:97096625-97096647 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1029018595 7:97340344-97340366 AAAGATACACAGAAGCCTCTGGG - Intergenic
1029266072 7:99341446-99341468 AAAAATACACAAAATTAGCTGGG + Intronic
1029270195 7:99373045-99373067 GAAAATACGCAGGAGCAGCAAGG + Intronic
1029287395 7:99475231-99475253 AAAAATACAAAAAAGTAGCTGGG + Intronic
1029431611 7:100534768-100534790 AAAAATACACAAAATTAGCTGGG - Intergenic
1029478390 7:100798771-100798793 AAAATTTCTCAGAATCACCTTGG - Intergenic
1029614375 7:101646960-101646982 AAAAATACACAAAATTAGCTGGG + Intergenic
1029794515 7:102879865-102879887 AAAAATACACAGAATTAGCCAGG - Intronic
1029839044 7:103343158-103343180 AAAAATACAAAAAAGTAGCTGGG - Intronic
1030328730 7:108250263-108250285 AAAAATACACAAAATAAGCTGGG + Intronic
1030415864 7:109241555-109241577 AAAAATACTAAAAATTAGCTGGG - Intergenic
1031032310 7:116748081-116748103 AAAAATACTAAAAATTAGCTGGG + Intronic
1031038391 7:116813370-116813392 AAAAATACACAAAATTAGCTGGG - Intronic
1031191478 7:118557561-118557583 AAAAATACAAAAAAGTAGCTTGG + Intergenic
1031320276 7:120316994-120317016 AAAAATACAAAAAATCAGCTGGG - Intronic
1031333491 7:120496583-120496605 AAAAATACGAAAAAGCAGCCAGG - Intronic
1031608728 7:123799999-123800021 AAAAATACAAAGCATCAGCTAGG + Intergenic
1032072023 7:128813819-128813841 AAAAATACACAAAATTAGCTGGG + Intronic
1032135470 7:129273059-129273081 AAAAATACAAAAAAACAGCTGGG - Intronic
1032200535 7:129819476-129819498 AAAAATACAAAAAATCAGCTGGG + Intergenic
1032643758 7:133798099-133798121 AAAAATACTCATAATTTGCTTGG - Intronic
1032836588 7:135680807-135680829 AAAAATACAGAAAACCAGCTGGG + Intronic
1032921122 7:136549383-136549405 AAGAATCCTCAGAGGCAGATAGG - Intergenic
1033204590 7:139407055-139407077 AAAAATACACAAAAGTGGCTGGG - Intronic
1033376803 7:140769235-140769257 AAAAATACAAAAAATCAGCTGGG - Intronic
1033503059 7:141973246-141973268 AATAATACCCAGGAGCATCTGGG + Exonic
1033720443 7:144053626-144053648 AAAGCTGCTAAGAAGCAGCTTGG - Intergenic
1033902181 7:146156895-146156917 AAAAATGCTGTAAAGCAGCTGGG - Intronic
1034006318 7:147476264-147476286 AAAAATACAAAAAAGTAGCTGGG - Intronic
1034049672 7:147969208-147969230 AAAAATACTAAAAATTAGCTGGG - Intronic
1034082072 7:148288258-148288280 AAAAATACAAAAAAGTAGCTGGG - Intronic
1034095258 7:148401757-148401779 AAAAATACAAAAAAGTAGCTGGG - Intronic
1034117956 7:148600961-148600983 AAAAATACAAAAAATCAGCTGGG - Intronic
1034322009 7:150194202-150194224 AAAAATTATCAGAAGCAAATAGG - Intergenic
1034389561 7:150774560-150774582 AAAAATACAAAAAATCAGCTGGG + Intergenic
1034586507 7:152098320-152098342 AACAATCCTCATAAGTAGCTGGG - Intronic
1034657472 7:152741020-152741042 AAAAATACAAAAAACCAGCTGGG + Intergenic
1035154953 7:156904899-156904921 AAAAATACAAAAAATCAGCTGGG - Intergenic
1035576638 8:711656-711678 AAAAATACAAAAAATCAGCTGGG - Intronic
1035935217 8:3829475-3829497 AAAAATACTCAAGAACAGCAGGG - Intronic
1036076259 8:5504502-5504524 AAAAATACACAAAAGTAGCTCGG - Intergenic
1036458881 8:8934426-8934448 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1036797230 8:11765003-11765025 AAAAATACACAAAATTAGCTGGG + Intergenic
1037087158 8:14866647-14866669 AAAAATACAAAGAATGAGCTGGG + Intronic
1037138702 8:15494476-15494498 AAAAATACAAAAAATCAGCTGGG - Intronic
1037314833 8:17591175-17591197 CAAAATAATCAGAAGCAGCCAGG - Intronic
1038287928 8:26222671-26222693 AAAAATCCTCAGAGGAGGCTGGG + Intergenic
1038568215 8:28637415-28637437 AAACTTACTCAGATGCACCTGGG - Intronic
1038689537 8:29748677-29748699 AAAAATACTAATCATCAGCTGGG + Intergenic
1038996072 8:32924913-32924935 AAAAATACTAAAAATTAGCTGGG + Intergenic
1039106798 8:33998927-33998949 AAAAATACACAAAATTAGCTGGG - Intergenic
1039634287 8:39146025-39146047 AAAAATACTCTGAAGCAGCCAGG - Intronic
1039688902 8:39840700-39840722 AAAAATAATTAGAATCTGCTTGG + Intergenic
1039696196 8:39914924-39914946 AAAAATACAAAAAAGTAGCTGGG - Intronic
1039697251 8:39926024-39926046 AAAAATACAAAAAAGTAGCTGGG + Intronic
1039731520 8:40284002-40284024 AAAAATACAAAAAATCAGCTGGG + Intergenic
1039737005 8:40343686-40343708 AAAAATACAAAAAATCAGCTGGG - Intergenic
1039818087 8:41112416-41112438 AAAAATACACAAAATTAGCTAGG - Intergenic
1040009829 8:42652223-42652245 AAAAATACAAAAAATCAGCTGGG - Intergenic
1040082127 8:43296736-43296758 AAAAAGACTAAGCAACAGCTAGG + Intergenic
1040507960 8:48068737-48068759 AAAAATACACAAAATTAGCTGGG - Intergenic
1040563710 8:48547167-48547189 CAGAAAACTCAGAAGTAGCTAGG + Intergenic
1040786213 8:51166731-51166753 AAACATATTCAGAAGATGCTTGG - Intergenic
1040975629 8:53191175-53191197 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1041129625 8:54683980-54684002 AAAAAAACTCTCAAGCAACTAGG - Intergenic
1041693437 8:60712888-60712910 AAAAATACAAAAAAGTAGCTGGG + Intronic
1042225138 8:66509347-66509369 AAAAGTACTCAGAATTAGGTTGG + Intronic
1042455479 8:68997335-68997357 AAAAATACAAAGAATCAGCTGGG + Intergenic
1042863797 8:73339151-73339173 AAAAATACAAAAAATCAGCTGGG + Intergenic
1042911820 8:73835581-73835603 AAAAATACAAAAAATCAGCTGGG + Intronic
1043281618 8:78474528-78474550 AAAAATACAAAGAATTAGCTAGG + Intergenic
1043474489 8:80592980-80593002 AAAAATACTAAAAATTAGCTGGG - Intergenic
1043805637 8:84669334-84669356 AAAAATGCTCAGAAGCACATGGG - Intronic
1044434901 8:92150665-92150687 AAAAATACAAAAAATCAGCTGGG + Intergenic
1044672862 8:94700766-94700788 AAAAATACAAAAAATCAGCTGGG + Intronic
1044776444 8:95693742-95693764 AAAAAGTCTCAGAAGCTGCCAGG + Intergenic
1045142622 8:99303117-99303139 AAAAATACACAAAATTAGCTGGG + Intronic
1045290943 8:100832180-100832202 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1045305878 8:100956264-100956286 AAAAATACACAAAATTAGCTGGG + Intergenic
1045477173 8:102563144-102563166 AAAAATACTAAAAATTAGCTGGG - Intergenic
1045518683 8:102883957-102883979 AAAAAGACGAAGAAGCAGCCAGG + Intronic
1045660503 8:104432626-104432648 GCAAATACATAGAAGCAGCTTGG + Intronic
1045859392 8:106798466-106798488 AAAAATACAGAAAATCAGCTGGG - Intergenic
1045941497 8:107744267-107744289 AAAAATACAAAAAATCAGCTGGG - Intergenic
1045987354 8:108264238-108264260 AAATAAACTTAGAAGCTGCTAGG - Intronic
1046426755 8:114062396-114062418 AAAAACACTAAAAAGCAGTTAGG - Intergenic
1046488674 8:114918674-114918696 AAAAATACTAAAAATTAGCTGGG + Intergenic
1046861057 8:119092228-119092250 AAAAATACAAAAAATCAGCTGGG - Intronic
1046950324 8:120013996-120014018 AAAAATACACAAAATTAGCTGGG - Intronic
1047141725 8:122148249-122148271 AAACATACTTAGAAGCAACTTGG + Intergenic
1047171745 8:122500442-122500464 AAAAATACACAAAATTAGCTGGG + Intergenic
1047375717 8:124294216-124294238 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1047478302 8:125256762-125256784 AAAAATACAAAAAATCAGCTGGG + Intronic
1048336985 8:133509896-133509918 AAAAATACAAAAAATCAGCTGGG + Intronic
1048449430 8:134520446-134520468 AAAAAAACAAAAAAGCAGCTAGG + Intronic
1048490709 8:134890638-134890660 AAAAATACAAAAAATCAGCTGGG - Intergenic
1049128560 8:140814933-140814955 AAAAATACAAAAAATCAGCTGGG - Intronic
1049478164 8:142806474-142806496 GCACATACTCAGAAGCAGCGGGG - Intergenic
1049609318 8:143546281-143546303 AAAAATACCAAAAATCAGCTGGG + Intergenic
1050102732 9:2135700-2135722 AAAAATACAAAGAAGTAGCCAGG - Intronic
1050319508 9:4436643-4436665 AAAAATACAAAAAATCAGCTGGG + Intergenic
1050773851 9:9236102-9236124 AAAAATACAAAAAAGTAGCTGGG + Intronic
1050784946 9:9389213-9389235 AAAAATAGTAAAACGCAGCTGGG + Intronic
1050913735 9:11105881-11105903 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1050931395 9:11331273-11331295 AATAATAATCAGAAGCAGTTTGG - Intergenic
1052005752 9:23346415-23346437 AAAAATACAAAAAATCAGCTAGG + Intergenic
1052477156 9:28974243-28974265 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052905977 9:33834370-33834392 AAAAATACAAAAAATCAGCTGGG - Intronic
1052934074 9:34078579-34078601 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1053085893 9:35221227-35221249 AAAAATACACAAAATCAGCTGGG - Intronic
1053399951 9:37809989-37810011 AAAAATACAAAAAAGTAGCTGGG + Intronic
1053481725 9:38421131-38421153 AAAAATTCTAAAAATCAGCTGGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053806512 9:41807456-41807478 AAAAATACAAAAAATCAGCTGGG - Intergenic
1054944765 9:70784104-70784126 ATAAATACTCAGAAGAAGGCGGG - Exonic
1055055334 9:72018399-72018421 AAAAATACAAAGAATTAGCTGGG + Intergenic
1055073559 9:72191744-72191766 AAAAATACAAAAAATCAGCTGGG - Intronic
1055294900 9:74824309-74824331 AAAAATACAAAAAAGCAGCCGGG - Intronic
1055298559 9:74859422-74859444 AGAACTACTCACAAGTAGCTGGG - Intronic
1055316363 9:75038302-75038324 AAAAATACGCAAAATTAGCTGGG - Intergenic
1055407949 9:75994581-75994603 AAAAATACAAAAAAGTAGCTGGG - Intronic
1055541510 9:77311083-77311105 AAAAATACAAAAAAGTAGCTGGG - Intronic
1055546997 9:77388013-77388035 GAAAATACGCAGTAACAGCTGGG - Intronic
1055863856 9:80788477-80788499 AAAAATACGAAAAATCAGCTGGG + Intergenic
1056123383 9:83511523-83511545 AAAAATACTCACAAGCACCAAGG + Intronic
1056291262 9:85145932-85145954 AAAAATACAAAAAAACAGCTGGG + Intergenic
1056394181 9:86166531-86166553 AAAAATACAAAAAAGCAGGTTGG + Intergenic
1056429773 9:86515588-86515610 AAAAATACACAAAAGAAGCTTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056638674 9:88351790-88351812 AAAAATACACAAAATTAGCTGGG + Intergenic
1056781039 9:89551337-89551359 AAAAATACAAAAAATCAGCTGGG - Intergenic
1057105481 9:92411131-92411153 AAAAATACAAAAAAGTAGCTGGG - Intronic
1057228099 9:93303077-93303099 AAAAATACAAAAAAGTAGCTGGG - Intronic
1057338581 9:94178357-94178379 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1057339373 9:94185777-94185799 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057940310 9:99276283-99276305 AAAAATACAAAGAATTAGCTGGG + Intergenic
1058203706 9:102075002-102075024 AAAAATACTAAAAATTAGCTGGG + Intergenic
1058430511 9:104914315-104914337 AAAAATACAAAAAAGTAGCTGGG + Intronic
1058553653 9:106142420-106142442 ACAAAGAAACAGAAGCAGCTCGG + Intergenic
1058682233 9:107450138-107450160 AAAAATACTAAAAATTAGCTGGG - Intergenic
1058797784 9:108515382-108515404 AAATATTTTCAGAAGCAGCAGGG + Intergenic
1058825327 9:108770810-108770832 AAAAATACTCAGAAGAAAAATGG + Intergenic
1058968318 9:110057351-110057373 AAAAAAACAGAGAAGGAGCTGGG - Intronic
1059079950 9:111238105-111238127 AAAAATACACAAAATTAGCTGGG - Intergenic
1059092724 9:111377983-111378005 AAAAATACAAAAAATCAGCTGGG + Intronic
1059334628 9:113561182-113561204 AAAAATACAAAAAAGTAGCTGGG - Intronic
1059373947 9:113867036-113867058 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1059965277 9:119607894-119607916 AAAATTAGACAGAAGCAGCTTGG - Intergenic
1060093796 9:120768659-120768681 AAAAATACACAAAATTAGCTGGG + Intronic
1060107639 9:120883597-120883619 AAAAATACAAAGAATTAGCTGGG + Intronic
1060127299 9:121060674-121060696 AAAATTACTTAGAGTCAGCTGGG - Intergenic
1060643043 9:125255209-125255231 AAAAATACAAAAAATCAGCTGGG - Intergenic
1060839561 9:126782970-126782992 AAAAATACACAAAATTAGCTGGG - Intergenic
1060986383 9:127821568-127821590 AAAAATACAAAAAAGTAGCTAGG + Intronic
1061041114 9:128141111-128141133 AAAAATACAAAAAATCAGCTGGG - Intergenic
1061148423 9:128814657-128814679 AAAACATCTCAGTAGCAGCTGGG + Intergenic
1061210896 9:129192303-129192325 AAAAATTCTGAGAACCAGCTGGG - Intergenic
1061239281 9:129359870-129359892 AAAAATACAAAGAATTAGCTGGG - Intergenic
1061314299 9:129784922-129784944 AAAAATACTAAAAAGTAGCCGGG - Intergenic
1061324350 9:129853986-129854008 TAAAATACTCAGAAAGAGCAAGG + Intronic
1061332906 9:129908137-129908159 AAAAATAAACAAAAGTAGCTGGG - Intronic
1061349402 9:130052816-130052838 AAAAGTACTCCAAAGCAGGTTGG + Intergenic
1061469565 9:130813398-130813420 AAAAATACAAAAAATCAGCTGGG + Intronic
1061550766 9:131333502-131333524 AAAAATACAAAAAATCAGCTGGG - Intergenic
1062652777 9:137586842-137586864 CAAAATACACAGAAGCATCAGGG + Intronic
1203530361 Un_GL000213v1:137185-137207 AAAAATACAAAGAATTAGCTGGG - Intergenic
1203357188 Un_KI270442v1:166804-166826 AAAAATACACAGAAGCATTCTGG + Intergenic
1185659802 X:1718579-1718601 AAAAATACACAAAATTAGCTAGG + Intergenic
1185923043 X:4115118-4115140 AAAAATACAAAAAAGCAGCTGGG - Intergenic
1186207249 X:7213707-7213729 AAAAACAGTCAGGAGCAGCCTGG - Intergenic
1186461191 X:9749923-9749945 AAAAATACAAAGAAATAGCTGGG - Intronic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1187171926 X:16860525-16860547 AAAAATACAAAAAATCAGCTAGG + Intronic
1187446952 X:19368826-19368848 AAAAAAACTCAGAATCAGAGAGG - Intronic
1187495819 X:19794540-19794562 AAAAATACAAAGAATTAGCTGGG + Intronic
1188007805 X:25028721-25028743 AAAAATACAAAGAATTAGCTGGG - Intergenic
1188058122 X:25564948-25564970 AAAAATACAAAAAATCAGCTGGG + Intergenic
1188300423 X:28501276-28501298 AAAAATACACAAAATTAGCTGGG + Intergenic
1188374795 X:29414558-29414580 AAAAATACAAAGAATTAGCTGGG + Intronic
1188379946 X:29479112-29479134 AAGAATATTCAGCATCAGCTGGG + Intronic
1188435697 X:30155866-30155888 AAAAATACAAAAAACCAGCTGGG - Intergenic
1188951485 X:36380602-36380624 AAAAATACAAAAAAGTAGCTGGG - Intronic
1189095031 X:38129463-38129485 AAAAATACTCAGAAGTGGAATGG - Intronic
1189315429 X:40052723-40052745 AAAAATACTAAAAAGTAGCCGGG - Intronic
1189448695 X:41106688-41106710 AAAAATACAAAAAAGTAGCTGGG - Intronic
1189457447 X:41206049-41206071 AAAAATACAAAAAATCAGCTAGG - Intronic
1189627591 X:42915766-42915788 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1189634092 X:42986537-42986559 AAAAATACTTAGAAGTTACTAGG + Intergenic
1189822805 X:44886648-44886670 AAAAATACACAAAATCAGCAGGG - Intronic
1189977744 X:46479266-46479288 AAAAATACACAAAATCAGCTGGG + Intronic
1190017004 X:46836012-46836034 AAGAAAACACAGAAGCAGCCTGG + Intergenic
1190090466 X:47432739-47432761 AAAAATACAAAGAATTAGCTGGG + Intergenic
1190235640 X:48613227-48613249 AAAAATACAAAAAAGTAGCTAGG - Intergenic
1190269213 X:48849580-48849602 AAAAATACAAAAAACCAGCTGGG - Intergenic
1190300061 X:49052289-49052311 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1190405623 X:50084540-50084562 AAAAATTCACAAAATCAGCTGGG - Intronic
1190749788 X:53351893-53351915 AAAAATACACAAAATTAGCTGGG - Intergenic
1190819992 X:53964704-53964726 AAAAATACAAAAAAGTAGCTGGG + Intronic
1190830686 X:54056691-54056713 AAAAATACTACAAAGCGGCTGGG + Intergenic
1190899324 X:54653781-54653803 AAAAATACAAAAAATCAGCTGGG + Intergenic
1191568513 X:62573417-62573439 AAAACTACACAGAAGCATTTTGG + Intergenic
1191667457 X:63718073-63718095 AACAATACTCAGAAGTGGGTTGG - Intronic
1191689618 X:63926391-63926413 AACCATACTCAGAAGCAGCTAGG - Intergenic
1192008119 X:67239126-67239148 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1192063087 X:67851092-67851114 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1192325173 X:70125693-70125715 AAAAATACAAAAAATCAGCTGGG - Intergenic
1192400059 X:70826148-70826170 AAAAATACAAAAAAGTAGCTGGG + Intronic
1193133105 X:77939134-77939156 AAAAATACAAAGAATTAGCTGGG + Intronic
1193186323 X:78517454-78517476 AACAGTACTCAGAAGGAACTGGG - Intergenic
1193600029 X:83500624-83500646 AGAAATACTAAGAAGAAGATAGG + Intergenic
1193864941 X:86720096-86720118 AAAAATACAAAAAAGTAGCTGGG - Intronic
1193990448 X:88300235-88300257 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1194049463 X:89051525-89051547 TCAGATATTCAGAAGCAGCTTGG - Intergenic
1194116284 X:89902521-89902543 AAAAATAATCAGAAACAGGAGGG + Intergenic
1194221112 X:91192685-91192707 AAAAATACAAAAAATCAGCTGGG - Intergenic
1194378367 X:93163964-93163986 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1194880358 X:99243112-99243134 AAACCTACTCAGATGGAGCTGGG - Intergenic
1195492431 X:105486929-105486951 AAAAATACAAAAAAGCAGCCAGG + Intronic
1195729466 X:107951504-107951526 AAAAATACAAAAAATCAGCTGGG - Intergenic
1195891632 X:109701703-109701725 AAAAATACACAAAATTAGCTAGG - Intronic
1196601427 X:117605497-117605519 AAAAGGTCTCAGAAACAGCTTGG + Intergenic
1196667135 X:118328608-118328630 AAAAATACTAAAAAGTAGCCAGG + Intergenic
1196704013 X:118700880-118700902 AAAAATACTAAAAATTAGCTGGG + Intergenic
1196704161 X:118702210-118702232 AAAAATACTAAAAATTAGCTGGG + Intergenic
1196924910 X:120623961-120623983 AAAAATACTCAGTATCGGCCGGG + Intergenic
1196935306 X:120724658-120724680 AAAAATACAAAAAATCAGCTGGG + Intergenic
1197538467 X:127723494-127723516 AAAAATACACAAAATTAGCTGGG - Intergenic
1197551186 X:127894648-127894670 AAGAATTCTCTGAAGCAGCAAGG - Intergenic
1197761792 X:130033240-130033262 AAAAATACAAAAAATCAGCTGGG - Intronic
1198539115 X:137618207-137618229 AAAAATACAAAAAAACAGCTGGG - Intergenic
1198804996 X:140485325-140485347 AAAAATTCTAAGTGGCAGCTGGG + Intergenic
1198892223 X:141410555-141410577 AAAAATACACAGAATTAGCCGGG + Intergenic
1198905526 X:141556326-141556348 AAAAATACAAAAAATCAGCTGGG + Intergenic
1199597628 X:149519729-149519751 AAAAATACAAAAAATCAGCTGGG + Intronic
1199839470 X:151629921-151629943 AAAAATATTCTGATGCAGCAAGG + Intronic
1200226848 X:154422393-154422415 AAATATAGATAGAAGCAGCTGGG + Intergenic
1200557617 Y:4656439-4656461 AAAAATACAAAAAATCAGCTGGG - Intergenic
1200853173 Y:7906924-7906946 AAAAATACAAAGAATTAGCTGGG + Intergenic
1201228733 Y:11843310-11843332 AAAAATACAAAAAACCAGCTGGG - Intergenic
1201277123 Y:12309636-12309658 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1201421693 Y:13806546-13806568 AAAAATACTAAAAATTAGCTGGG + Intergenic
1201589437 Y:15598589-15598611 AAAAAAAATCAGAATTAGCTGGG - Intergenic
1201965483 Y:19729050-19729072 AAAAATACACAAAATTAGCTGGG + Intronic