ID: 1173552258

View in Genome Browser
Species Human (GRCh38)
Location 20:43940672-43940694
Sequence CAGAGGATGAGGCAGCTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173552254_1173552258 13 Left 1173552254 20:43940636-43940658 CCAGAGTCGCAGGGATGGAGGGA 0: 1
1: 0
2: 2
3: 40
4: 318
Right 1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG 0: 1
1: 1
2: 0
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173552258 Original CRISPR CAGAGGATGAGGCAGCTATC AGG Intronic
900410211 1:2509199-2509221 CCCAGGCTGAGGCAGCTACCAGG - Intronic
900854717 1:5171635-5171657 CAGATGAGGAGGAGGCTATCTGG + Intergenic
900917184 1:5647065-5647087 CACAGGTTGAAGCAGCTATCAGG + Intergenic
901410352 1:9078711-9078733 AAATGGGTGAGGCAGCTATCAGG + Intronic
901834485 1:11915262-11915284 AAGAGGGTGAGGCAGCTCTGTGG + Intergenic
901952034 1:12756979-12757001 CTGAGGATGAGGGAGTCATCTGG - Intronic
905279714 1:36841371-36841393 CAGAGGATGCCCCAGCTATGGGG - Intronic
905304239 1:37006544-37006566 GAGAGGAGGAGGCAGCTAATGGG + Intronic
905471027 1:38191807-38191829 CTGGGGATGAGGCAGGGATCTGG - Intergenic
905484363 1:38285055-38285077 CAGAGGATGAGGAGGCTTTGGGG - Intergenic
905994712 1:42371570-42371592 AAGAGGATGAGGCTGATATCTGG + Intergenic
906575783 1:46888161-46888183 TAGAGGAAGAGGAGGCTATCTGG - Intergenic
906596193 1:47079733-47079755 TAGAGGAAGAGGAGGCTATCTGG + Intronic
907517678 1:55003118-55003140 CAGAGGAAGAGGCAGCTTCTAGG + Intronic
908529775 1:65023444-65023466 AAGAGGATGAGACAACTTTCTGG - Intergenic
909346930 1:74601012-74601034 CAGAGGATGAGGGAGATGTAAGG + Intronic
911370724 1:96991963-96991985 AAGAGGATAAGGCAGCGATGAGG + Intergenic
913044366 1:115061510-115061532 CAGTGGGTGAGGCAGCTAAAAGG - Intronic
913141368 1:115944564-115944586 CAGAAGATGAGGAAGCCATTTGG + Intergenic
913353149 1:117885204-117885226 AAGAAGATGAAGCAGCAATCTGG - Intronic
916163126 1:161939658-161939680 CAGGGGCTGAAGCAGCCATCTGG - Intronic
916267607 1:162906291-162906313 GAAAGGATGAGGCAGCTCTCTGG - Intergenic
916490532 1:165298366-165298388 CTGGGGCTGAGGCAGCCATCAGG + Intronic
917220925 1:172727769-172727791 CAGAGCAGCAGGCAGCTGTCAGG - Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
920556206 1:206906847-206906869 CAGAGGATGGTGCAGCAACCAGG - Intronic
920597556 1:207288050-207288072 CAAGGGCTGAGGCAGCTAGCTGG + Intergenic
922253936 1:223875106-223875128 CAGAGGATGCGGCAGCAACACGG + Intergenic
922794275 1:228332302-228332324 AAGAGGATGAGGGAGCTCTCTGG + Intronic
923048352 1:230371937-230371959 CAGAGGATGAGGAGGCTAGTTGG + Intronic
1064413070 10:15125023-15125045 CAGAGGCAGAGGGAGCTAACAGG + Intronic
1064742126 10:18444239-18444261 GAAAGGATGAGGAAGCTCTCTGG - Intronic
1069746813 10:70720345-70720367 TGGAGGATGAGGCTGCTCTCAGG - Intronic
1070302000 10:75210597-75210619 CCTTGGATCAGGCAGCTATCCGG - Intronic
1070638744 10:78150507-78150529 CAGAGCCTGAGGCAGGTATTTGG + Intergenic
1071880417 10:89890858-89890880 GAGAGGAGGAGGCAGATATAGGG - Intergenic
1072430946 10:95369959-95369981 CAGAGCATGAGGAAGCCAGCAGG - Intronic
1072501669 10:96024003-96024025 CTGAGGAAGAGGCAGCTGTAGGG - Intronic
1072562208 10:96586819-96586841 CGGAGGATGAGGCCGCTGCCTGG - Exonic
1073651434 10:105363667-105363689 CACAGGCTGAGGCAGTTAGCAGG - Intergenic
1074697302 10:116061150-116061172 CAAAGGCTGAGGCAGCTCTGGGG + Intronic
1074713741 10:116199312-116199334 CAGAGGAGGAGGCAGGTTTGGGG - Intronic
1074887550 10:117705832-117705854 TAAAGGAGGAGGCAGCTCTCAGG - Intergenic
1075828073 10:125377639-125377661 CAGTGGATGAAGCTGCTTTCTGG + Intergenic
1076325331 10:129616373-129616395 CAGAGCAGGAGGCAGCCATGTGG + Intronic
1077280241 11:1741381-1741403 TAGAGGATGAGGCAGCCATGTGG + Intronic
1077542163 11:3151859-3151881 CGGAGGAACAGGCAGCTGTCGGG - Intronic
1082755471 11:57071528-57071550 CAGAGACTGAGGCAGTTATAGGG + Intergenic
1083679027 11:64342850-64342872 CAGAGGATGGGGCAGGTGTAGGG + Intronic
1084075110 11:66768885-66768907 CAGAGAATGAGCCAGCTCCCAGG - Intronic
1084463557 11:69309286-69309308 CAGGGGTGGTGGCAGCTATCTGG + Intronic
1086744993 11:90413908-90413930 TAGAAGATGAGGGAGTTATCTGG + Intergenic
1088692233 11:112337932-112337954 CAAAGGATGTCCCAGCTATCAGG + Intergenic
1088729468 11:112668150-112668172 CAGAGGAGGATGCTGCTAACAGG - Intergenic
1092879893 12:12879955-12879977 GAGAGAATGAGGAAGCTCTCTGG + Intergenic
1094639081 12:32255725-32255747 ATGAGAATGAGCCAGCTATCTGG - Intronic
1094666138 12:32523001-32523023 CAGTGAAGGAGGTAGCTATCTGG + Intronic
1099384851 12:82001834-82001856 CAGAGGAGGAGGTAGGTATCAGG + Intergenic
1100529846 12:95453087-95453109 CAGAGGATGGGGAACCAATCGGG - Intergenic
1101051815 12:100871755-100871777 CAAAGGATGAGGGAGCTCTCTGG + Intronic
1102444048 12:112987727-112987749 AAGAGGATGAGGCAGACATCTGG + Intronic
1102486752 12:113263699-113263721 CAGAGGATGAGTGAGTTAACAGG - Intronic
1103347756 12:120262699-120262721 CAGAGGAAGAGCAAGCAATCGGG + Intronic
1103741490 12:123094551-123094573 CAGAGTTGGAGGCAGCTATTTGG - Intronic
1107156202 13:37169870-37169892 GAGAGGATGAGACAGTTAGCAGG + Intergenic
1107619841 13:42215785-42215807 CAGGTGAAGAGGCAGCTCTCAGG - Intronic
1111807307 13:93053638-93053660 TAGAGTATAAGGCAGCTCTCTGG - Intergenic
1112557932 13:100486113-100486135 CAGAGAATGAGGCAGTTTTCAGG - Intronic
1112566794 13:100558814-100558836 CAGAGGCTGAGGTAGCTAGGGGG + Intronic
1112981759 13:105393657-105393679 CAGGGGATCAGGCATCTACCTGG - Intergenic
1113121020 13:106924065-106924087 CAGAGGATGAGGCAGCTCTCTGG + Intergenic
1113546247 13:111153531-111153553 CAGAGGAGGTGGCAGCTCGCCGG + Intronic
1113674630 13:112198785-112198807 CAGAGGCTGGGGCAGCTCCCCGG + Intergenic
1114895655 14:26987810-26987832 CACAGAATGAGGCATCCATCAGG - Intergenic
1117498836 14:56331825-56331847 CAGAGGAGGAGGTAGCTGACAGG + Intergenic
1120153892 14:81069588-81069610 CAGAGGTTTAGGCATCTATTAGG + Intronic
1120840156 14:89078498-89078520 CAGGGAAGGAGGCAGCTGTCGGG - Intergenic
1125170156 15:36757663-36757685 CAGAAGATGTGGCTGCTAACAGG - Intronic
1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG + Intergenic
1127056189 15:55134485-55134507 AAGATAAGGAGGCAGCTATCAGG - Intergenic
1128879557 15:71230863-71230885 CAGAGGAAGAGGCATCTTTTTGG - Intronic
1129919017 15:79302628-79302650 CTGGGGATGAGTGAGCTATCTGG + Intergenic
1134248414 16:12557086-12557108 CGGAGGTTGAGGCAGCTAGATGG - Intronic
1134443463 16:14313267-14313289 CATAGGAGGAGCCTGCTATCTGG - Intergenic
1136230184 16:28881109-28881131 CAGAGGAAGAGGCAAGTATGGGG - Intronic
1138150349 16:54650785-54650807 CAGAGGCAGAGGCAGCTGTCTGG + Intergenic
1139206572 16:65034837-65034859 CAGAGGCTGAGGGGCCTATCTGG - Intronic
1139550270 16:67668939-67668961 CTGAGGGTCAGGCAGCTAACTGG + Intergenic
1139657379 16:68397253-68397275 CAGAGGAGGAGGCAGGTAAGAGG - Intronic
1140657210 16:77153058-77153080 CAGAGAAAGAGGCAGCTTCCAGG + Intergenic
1141201571 16:81902447-81902469 GAAAGGGTGAGGCAGCTCTCTGG + Intronic
1142024716 16:87806266-87806288 CGGAGGAGGAGGCAGCTTTAGGG + Intergenic
1142358209 16:89613945-89613967 CAGGGGACGAGGCAGCTTCCTGG + Intronic
1143193769 17:5059736-5059758 GAGAGGATGAGAGAGCTCTCTGG + Intergenic
1143528371 17:7485194-7485216 CAGAAGAGGAGGAAGCTACCCGG - Intronic
1144029036 17:11303660-11303682 CAGAGGACAAGGGAGCCATCAGG + Intronic
1144078486 17:11740472-11740494 AAGAGGATGAGCTAGCTCTCTGG + Intronic
1145010968 17:19367744-19367766 CAGAGGAAGGGGCATTTATCGGG - Intronic
1145985800 17:29045374-29045396 TAGAGGAGGAGGCTGCTTTCAGG + Intronic
1147402490 17:40189350-40189372 CAGAGGAGGACACAGCTACCAGG - Exonic
1148202277 17:45757087-45757109 CAGAGGATGCAGCAGATATCAGG - Intergenic
1149383652 17:56120566-56120588 CAGAGGAGGCGGCAGTAATCAGG - Intronic
1152318278 17:79593537-79593559 CAGAGAATGGGGCAGAGATCTGG + Intergenic
1155978060 18:32153138-32153160 CTGAGGATGAGACAGTTTTCAGG - Intronic
1156458870 18:37310191-37310213 AATAGGATGATGCAGCTCTCGGG + Intronic
1158866097 18:61638960-61638982 CAGAGTGTGAGGCAGCTAGGAGG + Intergenic
1159294899 18:66472368-66472390 AAGAGGATGAGGCAGCTCCCTGG + Intergenic
1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG + Intronic
1163327754 19:16616066-16616088 GAGAGGAAGGGGCAGCTCTCAGG + Intronic
1164530796 19:29046714-29046736 CAGAGGGAGAGGGAGATATCCGG + Intergenic
1164858806 19:31546185-31546207 AAGAGAATGAGGCAGGTAGCTGG - Intergenic
925304517 2:2838797-2838819 CAGGGGATGAAGCAGTCATCAGG + Intergenic
928426251 2:31180612-31180634 ATGAGGATGAGGCAGCTAGAAGG - Intronic
928430941 2:31217969-31217991 CAGAGTCTGAGGCAGCCCTCAGG + Intronic
931127619 2:59295362-59295384 CAGAGTGTGAGCCAGCTATAAGG + Intergenic
931647203 2:64435290-64435312 GAGAGGATGAGACAGCTATTTGG - Intergenic
932086398 2:68766378-68766400 CTGAGGAAGAGGCAGCTCTGGGG + Intronic
932268876 2:70391528-70391550 CAGAGGAGGAGCCAGCTAGAGGG + Intergenic
938441260 2:131335817-131335839 CAGGGGATGAAGGAGCTAGCAGG - Intronic
939470478 2:142614019-142614041 TAGAGGAAGAGGCAGATGTCAGG + Intergenic
940031057 2:149261718-149261740 CAGTGCATGAGGCAGGTGTCAGG - Intergenic
942014325 2:171795783-171795805 AAGAGGAGGAGGCAGCTGTGGGG - Intronic
945257007 2:207811314-207811336 CTGGGGATGGGGCAGCCATCCGG - Intergenic
946052339 2:216873930-216873952 GACAGGAGGAGGCAGCTATTGGG + Intergenic
946234730 2:218316928-218316950 CAGGGGATCAGGAAGCTAACAGG + Intronic
946478682 2:220033286-220033308 CCTTGGATGAGGCAGCTCTCTGG - Intergenic
946817616 2:223595005-223595027 CAGCAGATGAGGCTCCTATCTGG - Intergenic
1169749399 20:8976265-8976287 GAGAGGATGAGGCAACTCTTTGG - Intergenic
1170742396 20:19069470-19069492 AAGAGGGTGAGACAGCTCTCTGG - Intergenic
1171128176 20:22623134-22623156 CCTTGGATGAGGCAGCTTTCTGG + Intergenic
1171150682 20:22824221-22824243 CAGAGTCTGAGGCTGCTTTCTGG - Intergenic
1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG + Intronic
1173599513 20:44283353-44283375 CTGAGGAAGAGGCAGCAATGTGG + Intergenic
1173806853 20:45931713-45931735 GAGAAGATGAGGCATGTATCAGG + Intergenic
1173869581 20:46332914-46332936 CAGAGCATGAGGGAGGCATCGGG + Intergenic
1174088177 20:48025195-48025217 CAGAGGCTGACGCAGCTGGCTGG + Intergenic
1176008036 20:62876779-62876801 CAGAGGCCGAGGCAGCTGTCGGG - Intergenic
1177415410 21:20787233-20787255 AAGAGGAGTAGGCAGGTATCAGG - Intergenic
1178395404 21:32238415-32238437 CAGGGGATGAGACAGCTACAGGG + Intergenic
1179457957 21:41512603-41512625 CAGATGATCAGGCAGCAACCTGG - Intronic
1182061431 22:27401054-27401076 CTGAGGAGGAAGCAGCTGTCTGG - Intergenic
1182612751 22:31562960-31562982 AAGATGATGATGCAGCTTTCTGG - Intronic
1183520646 22:38294455-38294477 GAGAGGATGGGGCAGCTACGGGG - Exonic
951341206 3:21489710-21489732 CACAGGATGGGGCAGATATGAGG - Intronic
951664598 3:25108383-25108405 CAAAGGATGATTCAGCTATCCGG + Intergenic
952155462 3:30638906-30638928 CAGATACTGAGGCAGCCATCTGG - Intronic
952198840 3:31103866-31103888 CAGAGGATAAGGCAGGGAACTGG + Intergenic
952425217 3:33168605-33168627 CATAGCATGATGCAGATATCAGG + Intronic
953166160 3:40466634-40466656 CACAATATGAGGCAGGTATCAGG - Intergenic
953538507 3:43794012-43794034 CAGAAGATGAGACGGCTTTCAGG + Intergenic
953743284 3:45554976-45554998 CAGAGGGTGAGGGGGCTTTCAGG + Intergenic
953746726 3:45580041-45580063 CAGAGGATGATGCAGCAAGAAGG + Intronic
954196343 3:48999275-48999297 CAGAGGAAGAGGCGGGCATCGGG + Intronic
954335149 3:49911929-49911951 CAGAGGATGGGGCAGCTTCTGGG - Exonic
954970148 3:54645305-54645327 CAGATGTTGAGGGAGCTACCTGG - Intronic
955418055 3:58711112-58711134 CAGAGCAGGTGGCAGCTAACAGG - Intergenic
961115970 3:124330289-124330311 CACAGGATGAGGCAGGTGTATGG - Intronic
967653065 3:192010104-192010126 CAGAGGATGAGGAAACTTTAAGG + Intergenic
968863321 4:3190375-3190397 CACAGGAGGAGGAAGCTCTCAGG - Intronic
968975765 4:3821371-3821393 CGGAGGGTGAGGCAGATTTCTGG + Intergenic
969972148 4:11058868-11058890 CAGAGGCTGAGGCAATTAGCTGG + Intergenic
970150595 4:13085550-13085572 CAGATGATGAGGCAGGAAGCAGG - Intergenic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
972447787 4:39162565-39162587 CAGAAAATGAGGCAGTAATCAGG + Intergenic
973657298 4:53061930-53061952 CAGAGGGTGAGAGAGCTAGCTGG + Intronic
974181911 4:58395426-58395448 GAAGGGATGAGGCAGCTCTCTGG + Intergenic
979899834 4:126202009-126202031 CAGAGGATGAGCGGGCTATAGGG + Intergenic
980701394 4:136436397-136436419 CAGAATATGCTGCAGCTATCAGG - Intergenic
981016770 4:139981744-139981766 GAGAGGATGGGCCAGCTATTTGG + Intronic
981798610 4:148629521-148629543 AAGAAGATCAGGAAGCTATCAGG - Intergenic
981903613 4:149894195-149894217 AGGAGGCTGAGGCAGCTACCCGG + Intergenic
981938385 4:150257126-150257148 CAGATGAGGAAGCAGCTACCGGG - Exonic
982105391 4:152007610-152007632 TAGAGGTTGAGGCTGCTATGGGG + Intergenic
983021556 4:162683027-162683049 CATAGGATGATGCAGCAATAAGG - Intergenic
983051106 4:163048641-163048663 CAGAAGATGAAGCAGCCACCTGG - Intergenic
985754169 5:1703398-1703420 TGGAGGCTGAGGCAGCCATCGGG - Intergenic
985833263 5:2251605-2251627 GAGAGGCTGAGGGAGCTCTCTGG + Intergenic
986633252 5:9795568-9795590 CAGAAGATGAAGCTGCTATAGGG + Intergenic
986660660 5:10057154-10057176 GTGAAGATGAGGCAGCGATCAGG + Intergenic
987837564 5:23180940-23180962 GAGAGGCTGAGGCAGGAATCTGG - Intergenic
989477562 5:41891638-41891660 CAGAGGAAGAGGCAGCTGTGGGG + Intergenic
990447548 5:55906554-55906576 CATGGGATGACCCAGCTATCCGG - Intronic
992462127 5:76971013-76971035 AAAAGGATGGGGCAGCTTTCTGG + Intronic
993611586 5:90060869-90060891 CAGAGGAAGAGGCAGGTAGCAGG - Intergenic
993991178 5:94660518-94660540 CAGAGGCTGCAGGAGCTATCGGG - Intronic
995179333 5:109215540-109215562 CAGAGGCTGAGGCAGGTTACAGG + Intergenic
995443991 5:112222719-112222741 CAGCAGATGAGTCAGTTATCTGG - Intronic
997072611 5:130637578-130637600 CAGAGGATGAGGAACCAATCAGG + Intergenic
997418658 5:133749045-133749067 CAGAGGCAGAGGAAGCTCTCTGG + Intergenic
998136632 5:139677473-139677495 GAGAAGATGAGCCAGGTATCAGG + Intronic
1000004705 5:157172668-157172690 CAGAAGATAAGGCAGAAATCAGG - Intronic
1001139705 5:169134472-169134494 AAAAGAATGAGGCAGCTATGGGG - Intronic
1001763402 5:174225583-174225605 AAGAGGAGGATGTAGCTATCTGG + Intronic
1002398443 5:178976210-178976232 CAGAGAATGGGGCAGCTGGCGGG - Intergenic
1003899452 6:10640527-10640549 AAGGGGATCAGTCAGCTATCAGG - Intergenic
1007667278 6:43522499-43522521 GACAGGAATAGGCAGCTATCAGG + Exonic
1008535560 6:52504158-52504180 CAGAGGAGGAGCCAGCAAGCTGG + Intronic
1008890383 6:56482071-56482093 CAGATGATGAGGATGCTCTCCGG - Exonic
1010290044 6:74125109-74125131 CAGAGGAGGAATCAGTTATCTGG + Intergenic
1010326284 6:74566456-74566478 CAGATGCTGAGGCAGACATCTGG + Intergenic
1010823069 6:80439016-80439038 CAGAGGATGAGGGAGCAATTAGG - Intergenic
1012438801 6:99242697-99242719 CAAATGATGTGGCAGCTAACAGG - Intergenic
1013026779 6:106282857-106282879 CAGAGGTTGAGGCTGCAATAAGG - Intronic
1013084972 6:106848804-106848826 CAGAGGATGAGGCAGGAGTGAGG + Intergenic
1013351614 6:109311064-109311086 AAGAGGATGAGGGAGCTCTAGGG - Intergenic
1015022944 6:128498547-128498569 TAGAGGATCAGACAGTTATCTGG - Intronic
1015315471 6:131811661-131811683 TAGTGGGTGAGGCAGCTGTCAGG + Intronic
1016262495 6:142188816-142188838 TAGAAGAAGAGGCAGCTAACAGG + Intronic
1016739637 6:147513625-147513647 CAGAGGAAGAGGAAGCTCTAAGG + Intronic
1018059220 6:160077705-160077727 AAAAAGATGAGGCAGCTCTCAGG - Intronic
1018195886 6:161356020-161356042 CTGGGGATGGGGCAGCTCTCAGG + Intronic
1019258056 7:64246-64268 CAGAGGCTGAGGCATCTTGCTGG + Intergenic
1021729943 7:23586341-23586363 TCGAGGATGAGGCATCTTTCTGG + Intergenic
1023743572 7:43302257-43302279 CCATGGATGAGGCAGCTAACTGG + Intronic
1029878455 7:103779690-103779712 CAGAGGAAGAGCCTGCTTTCAGG + Intronic
1030794465 7:113770543-113770565 CAGAGACAGAGGCAGCTAGCTGG - Intergenic
1031002927 7:116438351-116438373 CTGAGGATGAGGCAGACATCTGG + Intronic
1032484224 7:132271535-132271557 CAGAGGCTGAGGCACCTCTTTGG + Intronic
1033030959 7:137826258-137826280 CAGAGCGTGAGCCAGCTCTCAGG + Intronic
1033704845 7:143876446-143876468 CATAGGAGGAGGCAGCAATGAGG + Exonic
1037541869 8:19879887-19879909 AAGAGGATGAGTGAGCTCTCTGG - Intergenic
1038646248 8:29364934-29364956 CAGAGGATGGGGCAGAGATCTGG + Intergenic
1039722034 8:40174529-40174551 CAGAGGATTGGGCAGCAAGCTGG - Intergenic
1040409453 8:47139456-47139478 CAGAGGCTGAGGTAGCTCACTGG - Intergenic
1041416189 8:57611010-57611032 CAGAGGTTGAGACAGAGATCAGG + Intergenic
1042132932 8:65606912-65606934 CAGAGGTGGAGGGAGCTATGAGG - Intronic
1042372841 8:68012018-68012040 CAGAAGATGAAGCAGAAATCAGG - Intronic
1045838302 8:106549730-106549752 CAAGGGATGAGGAAGCTCTCTGG + Intronic
1047217493 8:122888163-122888185 CAGAGGCAGAGGCAGCTCTGTGG - Intronic
1053489024 9:38486214-38486236 CACAGGAGGAGACAGCTTTCAGG - Intergenic
1054855089 9:69890888-69890910 CAGAGGATTAGGAAGCCATGGGG + Intronic
1056605113 9:88078991-88079013 CAGAGGACCAGGGAGCTTTCTGG - Intergenic
1057052410 9:91935703-91935725 GAGCAGATGAGGCAGCTCTCCGG - Intronic
1057777279 9:98021240-98021262 CTGGGGGTGAGGCAGCTAACAGG + Intergenic
1059449691 9:114362599-114362621 CAGTGGATGAGACAGCTTGCGGG + Intronic
1060158092 9:121334268-121334290 TACAGGATGTGGCAGCTATGAGG - Intergenic
1060653917 9:125355208-125355230 GGGAGGCTGAGGCAGCTACCAGG - Intronic
1061145282 9:128794117-128794139 AAGAGGAGGAGGCAGCAAGCTGG + Intronic
1061223552 9:129266857-129266879 CAGAGGGTGTGGCACCTGTCTGG + Intergenic
1061881460 9:133571231-133571253 CAGAGGTTCAGGGAGCTCTCTGG + Intronic
1188519222 X:31019234-31019256 CAGAAGGTGAGGGAGCTCTCTGG - Intergenic
1189758845 X:44300311-44300333 CAGAGGATGAGGCAGCAAGAGGG + Intronic
1195625461 X:107001845-107001867 AAGAGGATGAGAGAGCTTTCTGG - Intergenic
1195783637 X:108491863-108491885 CCAAGGTTGAGGCAGCTATGGGG + Intronic
1196389383 X:115191877-115191899 CAGAGGAGGAGGCCGCTACGAGG + Exonic
1198315830 X:135465068-135465090 GTGAGGATGAAGCAGTTATCAGG + Intergenic
1198366433 X:135944948-135944970 GATAGGATGAGGCAGAAATCTGG - Intergenic
1199621639 X:149706561-149706583 CAGAAGATGAGGTAGCCATTTGG - Intronic