ID: 1173553517

View in Genome Browser
Species Human (GRCh38)
Location 20:43949497-43949519
Sequence GGTGCCCAGCTCCCCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173553517 Original CRISPR GGTGCCCAGCTCCCCCAGGT GGG (reversed) Intronic
900074525 1:802427-802449 GGTGCCCAGCAAACCCAGGACGG - Intergenic
900126838 1:1072476-1072498 GATGCCCAGGTCCCCCAGCTCGG - Exonic
900628146 1:3618897-3618919 CGGCACCAGCTCCCCCAGGTTGG - Intergenic
900994564 1:6113522-6113544 GGTGTCCAGGGGCCCCAGGTTGG + Intronic
901026140 1:6279674-6279696 GGTGCCGGCCTCTCCCAGGTCGG - Intronic
901218834 1:7570715-7570737 GGACCCCTGCTTCCCCAGGTGGG + Intronic
901315212 1:8302498-8302520 GGTCCCCAGCTCGCCCTTGTTGG + Intergenic
901760159 1:11465760-11465782 GGTCCCCAGGTCCCCCAGTCAGG - Intergenic
903049342 1:20589247-20589269 GCTGCCCTGCTCACCCAGGAGGG + Exonic
903669663 1:25028038-25028060 GGTGCCCACCGCCTCCAGCTGGG + Intergenic
903958004 1:27038397-27038419 GCTGTCCAGCTGCCCCAGCTAGG - Intergenic
904004793 1:27358090-27358112 GGTGCCCAGGTCCCCAGGGAGGG + Intronic
904120414 1:28194232-28194254 TGTCCCCATCTCCCCCAGGCTGG - Intergenic
904120444 1:28194320-28194342 TGTCCCCATCTCCCCCAGGCTGG - Intergenic
904419146 1:30380214-30380236 AGTGCCCAGCTCCCGCAGTGCGG - Intergenic
904613456 1:31737577-31737599 GGTGGCCAGCCACACCAGGTCGG - Intronic
905149415 1:35915525-35915547 GAAGGCCAGCTACCCCAGGTAGG + Exonic
905732492 1:40306279-40306301 GTTGTTCAGCTCCCACAGGTGGG - Intronic
906511749 1:46413975-46413997 GGTGCCCATCACCCACAGGAGGG + Intergenic
907298307 1:53469677-53469699 AATGCCCAGCTCCTCCAGGCAGG + Intergenic
910261616 1:85298704-85298726 TCTGCTCAGCTCCTCCAGGTAGG + Intergenic
910838091 1:91535675-91535697 GGCGCCCGCCTCGCCCAGGTTGG - Intergenic
912708006 1:111929191-111929213 GGTGCCCAGGTACCAGAGGTGGG - Intronic
913045298 1:115068953-115068975 GCTTCCCAGCTCCTCCTGGTGGG - Intronic
914902529 1:151718666-151718688 GATGCCCGGGTCCCCCAAGTAGG + Intronic
915279910 1:154815264-154815286 GCTGCCCAAACCCCCCAGGTAGG - Intronic
915557887 1:156670248-156670270 GTCCCCCACCTCCCCCAGGTGGG - Exonic
916084581 1:161259131-161259153 GTTTCCCAGCGCCCCGAGGTGGG - Intronic
916172205 1:162009780-162009802 GAGGGCCAGCACCCCCAGGTTGG - Intronic
916806042 1:168262158-168262180 GGTGCCCACCTCCCCCATGTGGG - Intergenic
918321952 1:183372984-183373006 AGGGGCCAGCTCCCCCAGGGAGG + Intronic
919739264 1:200972496-200972518 TGTGCCCAGCGCCCCCGGGAAGG - Intronic
920211693 1:204333131-204333153 GGCCCCCAGCTCCACCAGGCGGG + Intronic
920531211 1:206703947-206703969 GATGCTCACCTCCCCCAGGATGG - Intronic
922270372 1:224027329-224027351 GGTGCCCAGCAAACCCAGGATGG - Intergenic
922473157 1:225888908-225888930 GATGACCAGCTCCTCCATGTCGG + Exonic
922535220 1:226374683-226374705 GCTGCCCAGCACTTCCAGGTTGG - Intronic
923007985 1:230067315-230067337 GATGCCCAGCACCCACAGGAAGG - Exonic
923224041 1:231922775-231922797 TGAGCCCAGCTCCCCCAGGAAGG + Intronic
924230450 1:241958011-241958033 GGCGCCAAGCTCCCCCAGCAGGG - Intergenic
1062875677 10:941165-941187 AGTCCCCAGCACCCACAGGTGGG - Intergenic
1062895399 10:1099274-1099296 CGTGCTCAGCCCCCCCAGTTCGG + Intronic
1063258845 10:4360410-4360432 GGTTCCCAGGTTCGCCAGGTTGG - Intergenic
1063448341 10:6134353-6134375 AGTGCCCAGGACCCACAGGTCGG - Intergenic
1063557920 10:7097994-7098016 GGAGCCCAGCTCCTCCAGCGGGG + Intergenic
1063577514 10:7275116-7275138 GGTGCCCTGGTCCCGCAGGGAGG + Intronic
1064867277 10:19895256-19895278 GGTGCCCAGCTCTACCATGCTGG - Intronic
1066623129 10:37379398-37379420 GCTGCCAAGCTCCACCAGGCAGG - Intronic
1067040658 10:42951699-42951721 GGCGCCTACCTCCCCCAGTTGGG + Intergenic
1067049017 10:43001382-43001404 AGTGCCCTGCACCCCCTGGTAGG + Intergenic
1067312473 10:45127016-45127038 GTTGCCCAGCTTGCCCAGGCTGG - Intergenic
1067755248 10:49000173-49000195 GGGGCCCAGCTCCCTCAGTAGGG + Intergenic
1070156670 10:73839710-73839732 GGCGCTCCGCTCCCCCAGCTCGG - Intronic
1070332880 10:75430890-75430912 CGTGGCCAGCTCTTCCAGGTGGG + Intergenic
1070606062 10:77899212-77899234 GGTGCTGAGCTCCCCCAGTCTGG - Intronic
1071334426 10:84589540-84589562 AGTGCTCTGTTCCCCCAGGTGGG + Intergenic
1072453233 10:95555760-95555782 GGTGCCCACCCTCCCAAGGTGGG + Intronic
1074469618 10:113715278-113715300 AGTGGCCAGCTCCACCGGGTGGG + Intronic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1077232075 11:1462262-1462284 TGTGCCCAGCCCTCCCAGGCGGG + Intronic
1078507399 11:11962426-11962448 GGTGCCAAGCTGACCCAGATAGG - Intergenic
1081572672 11:44301419-44301441 TCTGCCCAGCTCCCCAAGCTGGG - Intronic
1081680000 11:44995434-44995456 AGTGCCCAGAGCCCCCAGCTGGG + Intergenic
1082002419 11:47400362-47400384 GGGGCCCAGCCCCCCCAGGTGGG + Intergenic
1083808080 11:65087000-65087022 GGCCCCCAGCTTCCCCAGGCCGG + Exonic
1083881544 11:65551388-65551410 AGTGCCCAGCTCACCGGGGTAGG + Exonic
1084050945 11:66599480-66599502 GGTGCCAGGCCCCCCCAGGATGG - Exonic
1084934502 11:72579633-72579655 GGAGCCCATCTGCCCCAGCTGGG - Intronic
1086218521 11:84412641-84412663 GGTGCTCAGCTCCCTCACCTAGG - Intronic
1087626751 11:100604244-100604266 GGTGGCCAGGTGCCTCAGGTGGG - Intergenic
1089094312 11:115906185-115906207 GCTGCCCAGCTCCCCCAAACTGG + Intergenic
1089374320 11:117983762-117983784 GGTTCCCCGCTCCCACAGTTGGG - Intergenic
1089921524 11:122213558-122213580 GGTTCCCAGCCACCCCAGGGAGG - Intergenic
1091062522 11:132477098-132477120 GGTTCCCAGGTTTCCCAGGTTGG + Intronic
1092253176 12:6912744-6912766 CTTGGCCAGCTCCCCCAGGTTGG - Exonic
1092894473 12:12999764-12999786 AGTGCCCAACTCCCCAAGTTGGG + Intronic
1095640459 12:44480268-44480290 GTTCCCCAGCTCCCTCAGGTAGG - Intergenic
1102035503 12:109768634-109768656 AGTGCCCAGCTTCCCCAGCATGG + Exonic
1103921266 12:124400487-124400509 GGCCCCCAGCTCACCCAGCTCGG + Exonic
1103933164 12:124461118-124461140 GTTTCCCTTCTCCCCCAGGTTGG - Intronic
1106009431 13:25804735-25804757 GGTGCCGAGCTGCCACAGGCTGG + Intronic
1119421035 14:74508235-74508257 GGTGCCCACCTCCCACAGCCTGG - Intronic
1119626208 14:76178581-76178603 GTTTCCCATCACCCCCAGGTGGG - Intronic
1121044141 14:90775604-90775626 GGAGCCCAGCTCCTCCACCTGGG + Intronic
1122301686 14:100734685-100734707 AGTGCCCAGCACCACCAGGCTGG - Exonic
1122339227 14:101017242-101017264 GGTGCCCAGCACCAACAGCTTGG - Intergenic
1122366645 14:101198427-101198449 GCTGCCCAGCTCCTCCATGAGGG + Intergenic
1122946187 14:105011231-105011253 GTGGTCCAGCTCGCCCAGGTCGG + Exonic
1123062778 14:105601788-105601810 GGTCCCCAGCTCCCCCATCCAGG - Intergenic
1124167184 15:27338616-27338638 GGTGCTCAGTGCCCCCAGGGAGG + Intronic
1127225263 15:56920143-56920165 GGAGTCCAGCTCCCCCAAGTTGG + Intronic
1127833211 15:62769044-62769066 GGAGCCCGGCTCCCCCATGGAGG - Intronic
1128156673 15:65395858-65395880 GCTGCCCAGCGCCCCCACGCGGG - Exonic
1128310881 15:66631254-66631276 GGAGCCCAGCTCAGCCGGGTGGG - Intronic
1128321417 15:66697354-66697376 GGTGCCCAACTCTCCCATTTGGG + Intergenic
1128760874 15:70215238-70215260 GGTGACCAGCTCTCCCGGTTTGG + Intergenic
1129675835 15:77632204-77632226 GGTGCCCTGCAACCCCAGGAGGG + Intronic
1130029178 15:80296224-80296246 GGTGCCCCGCTCTCCTGGGTGGG - Intergenic
1132725841 16:1338045-1338067 GGTACCCAGCTCTCCTATGTAGG - Intronic
1132751044 16:1457879-1457901 GGGGGCCAGCACCCCCAGGCTGG + Intronic
1132787336 16:1664946-1664968 GGTGCCCAGCATAGCCAGGTGGG - Intronic
1133064421 16:3195916-3195938 GGTGCGCAGCCCCACCAGGTGGG + Intergenic
1133226037 16:4340830-4340852 GCTGGCCAGCTCCCCCAACTAGG + Intronic
1133708624 16:8379576-8379598 GGTGACCCTCTCCCCCAGGATGG - Intergenic
1134012867 16:10868278-10868300 CTTGCCCAGGTCCCCCAGGTGGG + Intergenic
1135415727 16:22266788-22266810 GGCCTCCAGCTCGCCCAGGTTGG - Exonic
1137556325 16:49472699-49472721 GGTGCCCAGCCCATCCAGGGTGG - Intergenic
1138565730 16:57831482-57831504 TGTGCCCACATCACCCAGGTTGG - Intronic
1139940454 16:70601737-70601759 GTTTCCCAGCAGCCCCAGGTGGG + Intronic
1140213695 16:72990569-72990591 GGTGCTCAGCTCCTCCAGGGTGG - Intronic
1140533224 16:75684581-75684603 GGTGCCCAACTGCCAAAGGTTGG + Intronic
1141189650 16:81815249-81815271 GGTTCCCAGCTCTCCCTGGTGGG + Intronic
1141734008 16:85840308-85840330 GGGGCCCAGCTCCTCCAGACTGG - Intergenic
1141815675 16:86407999-86408021 GGTGCCCAGCTCTGCAGGGTGGG + Intergenic
1142284051 16:89164483-89164505 GGAGCCCTGATCCCCCAGGACGG + Intergenic
1143449498 17:7027413-7027435 GCCGTCCAGCTCTCCCAGGTGGG - Intronic
1143913796 17:10274198-10274220 CTTTCCCAGTTCCCCCAGGTGGG + Intergenic
1144780580 17:17806475-17806497 GATGCCCAGCTTCCCCATGAAGG + Intronic
1146022268 17:29290069-29290091 GATGCCCAGTTCCGCCACGTTGG + Intronic
1146055268 17:29577775-29577797 GGTGGCCAGGCCCCCAAGGTGGG + Intronic
1147140112 17:38455873-38455895 GGTGCCCTGCACCCCCATGGGGG - Intronic
1147741243 17:42672111-42672133 CCCGCACAGCTCCCCCAGGTCGG + Exonic
1147967892 17:44203623-44203645 GGTGCCAAGACCCCGCAGGTAGG + Intergenic
1147978893 17:44262801-44262823 GGTCCCCAGAGCCTCCAGGTGGG + Intronic
1149505119 17:57187873-57187895 GGTGAGCATCTCCCCCAGGTTGG - Intergenic
1149654340 17:58302403-58302425 GGTCCCCAGGGCCCCCAGGTGGG - Exonic
1149676426 17:58467516-58467538 GGAGCCCAGCTCCACCAGCCTGG + Intronic
1150283274 17:63941596-63941618 GGTGCCCGGGTTCTCCAGGTTGG + Exonic
1151698511 17:75730509-75730531 GGGGCCCAGGTCCCACGGGTGGG + Intronic
1152401796 17:80070910-80070932 AGTGTCCAGCTCCCACAGGCAGG - Intronic
1152558492 17:81066480-81066502 AGGCCCCAGCTCTCCCAGGTGGG - Intronic
1152560381 17:81075710-81075732 TGTGCCCTTCTCCCCCAGGTAGG + Intronic
1152742928 17:82026282-82026304 GGTGGCCAGATGCCCCAGGATGG + Intronic
1152820139 17:82433683-82433705 GGAGCCCACCTCCCGCAGGTGGG - Exonic
1153620688 18:6974974-6974996 GGAGCCCAGGTCCCACAGGAAGG + Exonic
1154980319 18:21498325-21498347 GCTGCCCTGCTCCCCCAGCCAGG + Intronic
1157422600 18:47559185-47559207 AGTGTCCAGCTCCTCCAGGAAGG + Intergenic
1158625792 18:59070511-59070533 GGCGCCCCACTCCCTCAGGTTGG - Intergenic
1160976659 19:1796216-1796238 GGTGACCAGCGCCCCCTCGTCGG + Exonic
1161068761 19:2250377-2250399 GGGGGCCAGCTCCTCCAGGCGGG - Exonic
1161154043 19:2723076-2723098 GGTGCCCAGCAGCCCCGTGTAGG - Intronic
1161264521 19:3358323-3358345 GGTTCCCTGCTCCCCCAGGGAGG - Intergenic
1161410152 19:4112583-4112605 GGTGCCCACCTCCCCCCGCCCGG + Intronic
1162002114 19:7751807-7751829 GGTGCCCAGGTTTCCCAGCTTGG - Intergenic
1162016986 19:7851366-7851388 GAGGCCCAGCACCCCCCGGTGGG + Intronic
1162966327 19:14157848-14157870 GGTGCTCTGCTCCTCCAGGCAGG - Intronic
1163613129 19:18311153-18311175 GGCGCCCAGCTCTCCCAGGCAGG + Intronic
1163784279 19:19266646-19266668 GATGAGCAGCTACCCCAGGTGGG + Intronic
1163844256 19:19629537-19629559 GCTGCCCACCTCCTCCAGGAAGG + Exonic
1165309769 19:35022988-35023010 GCCCCCCAGCTCCCCCAGGGAGG + Intronic
1165992716 19:39825650-39825672 GGAGCCCAGGGCCCCCAGATGGG + Exonic
1166348117 19:42179376-42179398 TGTGCCCACCTTCCCCTGGTCGG - Intronic
1166694871 19:44846669-44846691 GGTGCTCGGCTTCCCCAGCTCGG - Intronic
1167017375 19:46849967-46849989 AGTGCCCCTATCCCCCAGGTTGG - Intronic
1168488330 19:56784979-56785001 GCTGCCCAGCTCCTTCAGATGGG + Intronic
1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG + Intronic
926008488 2:9390615-9390637 TGTGCCCAGCTGGCACAGGTTGG - Intronic
927193320 2:20531791-20531813 GGTTCCCAGATCCCCCAGGTTGG - Intergenic
927503179 2:23595817-23595839 GGATCCCAGCTCTCCCAGGGTGG + Intronic
927865307 2:26584029-26584051 AGAGCCCAACTCTCCCAGGTGGG + Intronic
929788069 2:45006173-45006195 GGAGCCCAGGTCCACGAGGTTGG + Exonic
930022390 2:47009243-47009265 GGTGACCAGCTCCTGCAGGCTGG - Intronic
934664969 2:96163666-96163688 GGCTCCCGGCTCCCCCAGGGAGG - Intergenic
935187513 2:100747491-100747513 AGTGCCCATCTCCCCCTGGGTGG + Intergenic
936507375 2:113118162-113118184 CGTGCCCAGATCCCCCAGACAGG - Intronic
937337627 2:121071580-121071602 GGTGCCCATCAGCACCAGGTGGG + Intergenic
937444213 2:121943157-121943179 GGTTCCCAGCACCCCCACCTTGG + Intergenic
938090051 2:128425558-128425580 GCTGGCCAGCTCCCCGAGATGGG + Intergenic
938493331 2:131777131-131777153 AGTGCCCAGCTCCCCCAGGAGGG + Intergenic
942947675 2:181687333-181687355 GGTGCCCAGTTCCCTCTGGGAGG - Intergenic
944168663 2:196750714-196750736 GCTGCCAAGCTCCTTCAGGTGGG - Intronic
946168460 2:217879491-217879513 GGGGCCCAGCACCCTCAGATTGG - Intronic
947525374 2:230874048-230874070 TGTGCCCAGGTCCCCCGGGGAGG - Intronic
948641444 2:239378238-239378260 GGTGCTCGTCTCCCCCAGGAAGG - Intronic
948663079 2:239518653-239518675 GGTGGGCAGCTCCTCCAGGTGGG + Intergenic
948784465 2:240345024-240345046 GGTGCTCAGCTCCACCTGCTGGG - Intergenic
948992349 2:241561485-241561507 GGGGCCCAGCCAGCCCAGGTGGG + Intronic
948992383 2:241561587-241561609 GGGGCCCAGCCAGCCCAGGTGGG + Intronic
948992417 2:241561689-241561711 GGGGCCCAGCCAGCCCAGGTGGG + Intronic
1170741602 20:19063416-19063438 TGTGCCCAGCTACCCCAGAATGG - Intergenic
1171459989 20:25292815-25292837 GCAGCCCAGCACCCCCACGTGGG - Intronic
1172626699 20:36351486-36351508 GTTGCCCATCACCCCCAGATGGG + Intronic
1173553517 20:43949497-43949519 GGTGCCCAGCTCCCCCAGGTGGG - Intronic
1174008754 20:47431788-47431810 GGTGCCCAGCTTGCCCAGGCTGG + Intergenic
1175973778 20:62700017-62700039 GGTGCCCGGCTCACCGAGGGTGG - Intergenic
1176140666 20:63543374-63543396 GGTGAGCAGCTCCTCCAGGCCGG + Exonic
1176222203 20:63975057-63975079 GTTCCCCAGCACCTCCAGGTTGG - Exonic
1176853057 21:13936424-13936446 TCTGCCCAGCTGCCCCATGTGGG - Intergenic
1178247937 21:30972238-30972260 GGTTCCCAGCTCCCCCAAGATGG + Intergenic
1179270630 21:39847961-39847983 TGTGCTCACATCCCCCAGGTGGG + Intergenic
1179379608 21:40886369-40886391 GGTGCTCAGATCCCACTGGTGGG + Intergenic
1180161130 21:45999201-45999223 GGTCCCGAGGGCCCCCAGGTGGG + Exonic
1180704051 22:17797940-17797962 GGCTCCCAGCTCCCCCTGGTTGG + Intronic
1181039140 22:20183779-20183801 TGTGCCCAGGTGCCCCAGGCAGG - Intergenic
1183074440 22:35417889-35417911 GTTGCCCAGCTTCCCTGGGTGGG + Intronic
1183255228 22:36757662-36757684 GCTGCCCAGCTCCCCGAGGCAGG + Intergenic
1184675680 22:46041711-46041733 GGTGCCCAGCTCCCACCTGCAGG - Intergenic
1184779166 22:46637743-46637765 GGTGCCCAGGGGCCCCAGGATGG - Intronic
1185018994 22:48362615-48362637 TGGGCCCACCTGCCCCAGGTCGG + Intergenic
1185101006 22:48840783-48840805 GGGGCCTGGCTCCCCCAGGCTGG + Intronic
950702016 3:14757386-14757408 GGGGCGCAGCCCCACCAGGTGGG + Exonic
952418851 3:33113904-33113926 GGCGCCCAGATCCCCCGGCTGGG + Intergenic
953007439 3:38991338-38991360 GGTCCCCAGCTCCCTCTGGGCGG - Intergenic
954008193 3:47610147-47610169 GGTGCCCTGCTGCTCCAAGTGGG + Exonic
954130313 3:48557231-48557253 GGAGCCCAGGGCCCCCAGGAGGG + Intronic
954131797 3:48564746-48564768 AGTGCCCAGTTCCCCACGGTGGG + Intronic
954390942 3:50267642-50267664 GGTCCCCAGCGGCCCCAGGGTGG + Intronic
955321651 3:57978852-57978874 GCTGCCCTGCTCCCCAGGGTGGG - Intergenic
961365294 3:126395657-126395679 GAAGCCCAGCACCCCCAGCTGGG + Intronic
962462440 3:135627008-135627030 GGTGCTGAGCTCCTCCAGGCAGG - Intergenic
963200198 3:142578645-142578667 CCTGCCCAGCTCCCGCAGGGCGG + Exonic
967953922 3:194862710-194862732 CGTCCCCAGCTCCTCCAAGTTGG + Intergenic
968620703 4:1602238-1602260 GGGGCCCAGCTCCCCCGGCAGGG - Intergenic
969455808 4:7299053-7299075 GTCCCCCAGCTCCCCCAGCTGGG + Intronic
969678043 4:8625645-8625667 GGTGCCAAGCAGCCGCAGGTCGG + Intergenic
969678998 4:8631282-8631304 GGTGCCAAGCAGCCGCAGGTCGG + Intergenic
969706276 4:8793994-8794016 GATGCCCTGCTGCCCCAGGGTGG - Intergenic
977848177 4:101790933-101790955 GCGGCCCAGCGCCCCCAGGTGGG + Exonic
981454167 4:144934033-144934055 GGTGTCCAGTAGCCCCAGGTAGG + Intergenic
985054404 4:186023898-186023920 GGTGCCCAGCTGGGCCAGGGTGG - Intergenic
985513552 5:325359-325381 GGTTCCCAGCACCCCAAGGTGGG - Intronic
986821057 5:11467217-11467239 GGAGCTCAGCTCTCCCAGGCTGG + Intronic
986858384 5:11898987-11899009 AGTGCCCAGCTCTTCCAGGTTGG - Intronic
987858481 5:23452514-23452536 TGTGACCAGCGTCCCCAGGTTGG - Intergenic
992106028 5:73449186-73449208 GGTGTCCAGCCCCTCCAGATCGG + Intergenic
997101706 5:130976620-130976642 GTTGCACACCTCTCCCAGGTGGG - Intergenic
997986109 5:138502732-138502754 TGTGCCCAGCCTCCCCAGGCTGG - Intergenic
998498289 5:142610058-142610080 GGTGCCAAGCCCTCCCAGTTAGG + Intronic
998953201 5:147412650-147412672 GGCCCCCAGCTCTCCCAGGCAGG + Exonic
1002478904 5:179486394-179486416 GGGGCCCAGCTTCCCACGGTGGG - Intergenic
1002870179 6:1160053-1160075 GGTGCCCATTGCACCCAGGTGGG + Intergenic
1003307914 6:4946002-4946024 GCTGCCCAGCGCCCACAGGCGGG + Intronic
1004201749 6:13555101-13555123 CTTGCCCAGCTCCTCCAGGCGGG + Intergenic
1005670883 6:28105028-28105050 GGAGCCCAGCTCCCCCACGCGGG + Intergenic
1006299195 6:33184946-33184968 GGTGCCCACTGCCCCCAGATGGG + Intronic
1006414972 6:33898146-33898168 GGTGGCTAGCTTCTCCAGGTAGG + Intergenic
1006621802 6:35370531-35370553 GGTGCCCACCACCCTCAGATGGG - Intronic
1008556492 6:52677359-52677381 GAGGCCCAGAACCCCCAGGTTGG - Intronic
1011620471 6:89237702-89237724 GGTGTGCAGATCCCACAGGTGGG - Intergenic
1012592939 6:101005300-101005322 ACTGCTCAGCTGCCCCAGGTAGG - Intergenic
1014913884 6:127121244-127121266 TGTGCCCACCTCCCCCAGCGAGG + Intronic
1015910755 6:138165505-138165527 GATGCCCCTCTCCCCCATGTGGG - Intronic
1018434516 6:163748753-163748775 CATGCTCAGGTCCCCCAGGTGGG - Intergenic
1018797804 6:167200836-167200858 GGTGCCCAGCCCCTCCTGGAGGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019463197 7:1172408-1172430 GGTGCTCATCACCCCCAGGAGGG + Intergenic
1019485948 7:1289233-1289255 GGTGACCAGGGCCCCCGGGTGGG - Intergenic
1020012672 7:4815273-4815295 AGGGCCCAGCTCATCCAGGTAGG - Exonic
1020812541 7:12864466-12864488 GGAGCCCCGCTCCTGCAGGTGGG - Intergenic
1021868599 7:24981394-24981416 GGTGCCCAGCTCGGTGAGGTCGG - Intronic
1022666471 7:32415995-32416017 GGTGCCAGGCTCCACCAGGGTGG + Intergenic
1023870935 7:44262739-44262761 GGTGCCCAGCTCCACCCGACTGG - Intronic
1024585236 7:50836292-50836314 TGTGGCCAGCTCCCTGAGGTAGG + Intergenic
1026024421 7:66733271-66733293 GGTGGTCAACTCCCCCAGGCTGG - Intronic
1027221528 7:76217187-76217209 AGAGCCCAGCTCCCCCTGTTAGG + Intronic
1027233839 7:76286521-76286543 GGTGCCTAGCTCCCCAGGCTGGG - Exonic
1028251352 7:88543022-88543044 GTTTCCCAGCTCCCTCAGGGAGG + Intergenic
1034227784 7:149497053-149497075 CGTGCCCAGCTTCCCGGGGTCGG - Intronic
1034242959 7:149624101-149624123 CGTGCCCAGCTCCCCAGGGTCGG - Intergenic
1034432952 7:151050063-151050085 GATGGCCATCTCCCCCAGGCAGG - Intronic
1035050790 7:155998113-155998135 TGTGCCCTTCTCCCCCAGCTTGG + Intergenic
1035171630 7:157020706-157020728 GGTGCCCACCTGCCCCAGGAAGG - Intergenic
1035292595 7:157849250-157849272 GGTGCCTTTCTCCCCCAGGCTGG + Intronic
1035772214 8:2156603-2156625 CGTGACAAGCTCCACCAGGTGGG + Intronic
1036945391 8:13090119-13090141 GGTGCCCAGCTCTACAAGGGAGG + Intronic
1037717373 8:21411732-21411754 TGTCCCCAGCTCCTCCAGCTGGG - Intergenic
1038445847 8:27603743-27603765 GAAGCCCAGCTCGCCCATGTCGG + Intronic
1040616471 8:49042775-49042797 GAAGCTCATCTCCCCCAGGTAGG - Intergenic
1042858253 8:73288843-73288865 GGTGCCCAGACCCCTAAGGTTGG + Intergenic
1045344386 8:101281377-101281399 GGGGGACAGCTCCCCCAGGCAGG + Intergenic
1045573704 8:103396320-103396342 GGTGCACAGCTCCAGCAAGTTGG + Intergenic
1048326190 8:133441281-133441303 AATGCCCCCCTCCCCCAGGTGGG - Intergenic
1048498370 8:134954493-134954515 GGGGCCCATCTCCTTCAGGTGGG + Intergenic
1048925229 8:139265421-139265443 AGGGCCCAGCTTCCCCAGCTTGG + Intergenic
1050691503 9:8232436-8232458 GTTGCCCAGCTTCCCAATGTTGG + Intergenic
1056722838 9:89086337-89086359 GGTTCCCACCACCCCCAGCTTGG + Intronic
1057299055 9:93865914-93865936 GGTGCCCAGGCCCTCCAGGGAGG + Intergenic
1059914660 9:119085653-119085675 GGTGCACAGCTCCCCGGAGTGGG + Intergenic
1060348751 9:122839055-122839077 GGTGCCCATCTCCAGCTGGTAGG - Intergenic
1061211214 9:129194532-129194554 AGTGGCCAGCTCCTCCTGGTAGG + Intergenic
1061287822 9:129634196-129634218 CTTGCCCTCCTCCCCCAGGTAGG - Exonic
1062095681 9:134702008-134702030 GATCCCCAGCTGCCCCGGGTGGG + Intronic
1062309384 9:135927640-135927662 TGTGCCCAGCTCCCCAAGCAAGG - Intergenic
1062380937 9:136286225-136286247 GGTGCCCCTCTGCCCCAGTTGGG + Exonic
1062426568 9:136508797-136508819 CGTTCCCACCTCCCGCAGGTAGG + Intronic
1062435982 9:136546729-136546751 TGTGCCCCGCTCCCCCAAGGGGG + Intergenic
1062536919 9:137025134-137025156 GGAGCTCAGTTTCCCCAGGTCGG + Intronic
1062731666 9:138113517-138113539 GGTGCCCAACTCCTCCTTGTGGG + Intronic
1062731695 9:138113649-138113671 GGTGCCCAACTCCTCCTTGTGGG + Intronic
1062731715 9:138113737-138113759 GGTGCCCAACTCCTCCTTGTGGG + Intronic
1062731747 9:138113869-138113891 GGTGCCCAACTCCACCTTGTGGG + Intronic
1062731768 9:138113957-138113979 GGTGCCCAACTCCTCCTTGTGGG + Intronic
1062731778 9:138114001-138114023 GGTGCCCAACTCCTCCTTGTGGG + Intronic
1203792074 EBV:157143-157165 GGTGCCCAGCTGTCCCTCGTAGG + Intergenic
1192080639 X:68044792-68044814 GGTCCCCAGCTCTCCAAGATAGG + Exonic
1193715794 X:84934175-84934197 GGTGTCCAGCGCCCCGATGTGGG + Intergenic
1194889002 X:99354349-99354371 GGTGGCCAGCTCACACAGGTAGG - Intergenic
1196137732 X:112228141-112228163 GGTTCCCAGCATCCACAGGTAGG - Intergenic
1197355674 X:125435689-125435711 GTTCCCCAGCTCCCTCAGGGAGG + Intergenic