ID: 1173553621

View in Genome Browser
Species Human (GRCh38)
Location 20:43950226-43950248
Sequence TGCATCTCAGGTTGCCCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173553621_1173553626 9 Left 1173553621 20:43950226-43950248 CCATCGGGGCAACCTGAGATGCA No data
Right 1173553626 20:43950258-43950280 GGAAGAAGCCGCAGGCCAAGCGG No data
1173553621_1173553628 19 Left 1173553621 20:43950226-43950248 CCATCGGGGCAACCTGAGATGCA No data
Right 1173553628 20:43950268-43950290 GCAGGCCAAGCGGATGTCAGCGG No data
1173553621_1173553630 27 Left 1173553621 20:43950226-43950248 CCATCGGGGCAACCTGAGATGCA No data
Right 1173553630 20:43950276-43950298 AGCGGATGTCAGCGGCTCTGAGG No data
1173553621_1173553624 1 Left 1173553621 20:43950226-43950248 CCATCGGGGCAACCTGAGATGCA No data
Right 1173553624 20:43950250-43950272 AAGCCACAGGAAGAAGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173553621 Original CRISPR TGCATCTCAGGTTGCCCCGA TGG (reversed) Intronic