ID: 1173553621

View in Genome Browser
Species Human (GRCh38)
Location 20:43950226-43950248
Sequence TGCATCTCAGGTTGCCCCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173553621_1173553628 19 Left 1173553621 20:43950226-43950248 CCATCGGGGCAACCTGAGATGCA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1173553628 20:43950268-43950290 GCAGGCCAAGCGGATGTCAGCGG 0: 1
1: 0
2: 1
3: 15
4: 154
1173553621_1173553630 27 Left 1173553621 20:43950226-43950248 CCATCGGGGCAACCTGAGATGCA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1173553630 20:43950276-43950298 AGCGGATGTCAGCGGCTCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
1173553621_1173553624 1 Left 1173553621 20:43950226-43950248 CCATCGGGGCAACCTGAGATGCA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1173553624 20:43950250-43950272 AAGCCACAGGAAGAAGCCGCAGG 0: 1
1: 1
2: 1
3: 31
4: 288
1173553621_1173553626 9 Left 1173553621 20:43950226-43950248 CCATCGGGGCAACCTGAGATGCA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1173553626 20:43950258-43950280 GGAAGAAGCCGCAGGCCAAGCGG 0: 1
1: 0
2: 1
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173553621 Original CRISPR TGCATCTCAGGTTGCCCCGA TGG (reversed) Intronic
908404177 1:63797676-63797698 TGTATCTCAGGTTGCTGTGAGGG + Intronic
908899246 1:68937026-68937048 TGCATCTCAGTTTCCCTCAAAGG - Intergenic
912234643 1:107835909-107835931 TTCAGCTCAGGCTGCCCCTAAGG + Intronic
917919646 1:179740574-179740596 TGCAACTCAGGTTGCTGCGTGGG + Intergenic
919759032 1:201085478-201085500 TCCAGCTCATGTAGCCCCGAAGG + Exonic
1063114436 10:3064002-3064024 TGCAGCTCAGGTAGCCCTGGTGG + Intergenic
1066721354 10:38343406-38343428 TGGAAGTCAGGGTGCCCCGACGG + Intergenic
1070243307 10:74705296-74705318 AGCAGCTCAGGTTTCCCCTAAGG + Intronic
1075088502 10:119429901-119429923 TGCATCTCAGTCTGCCCAGCAGG - Intronic
1075214254 10:120518131-120518153 TGCAGCACAGATTGTCCCGAAGG - Intronic
1081771366 11:45652176-45652198 TGCCTCACAGTCTGCCCCGAGGG + Intronic
1084956027 11:72692130-72692152 TGCATCTCATGATGCCCCCATGG - Intronic
1085458106 11:76676864-76676886 TGCATCTCATGTTGCCTCTGAGG - Intergenic
1090632800 11:128664935-128664957 TGAATCACAGGTGGCCCCAATGG - Intergenic
1094211929 12:27902054-27902076 TGCATCTCATGTGGCTCAGATGG + Intergenic
1102172235 12:110851168-110851190 TGCATCTCAGGTTGCTTTAATGG + Intronic
1102592639 12:113968567-113968589 TGGATCTAAGGATGCCCCTATGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG + Intronic
1117520499 14:56546709-56546731 TTCATCTGATTTTGCCCCGAAGG + Intronic
1119325735 14:73758887-73758909 TGTGTGTCAGGTTGCCCCCAAGG - Intronic
1120583214 14:86279756-86279778 TACATCTCAGGTTGCTCCAGAGG + Intergenic
1121643998 14:95505243-95505265 TGCTTCTCAGGCTGACCCTATGG + Intergenic
1125477114 15:40054910-40054932 AGCCTCTCAGGTTCCCTCGAAGG - Intergenic
1127671278 15:61197456-61197478 TGCACCTCAGGTTTGCCAGATGG + Intronic
1128656885 15:69469161-69469183 TGTATCTCAGGCTGTCCCCAGGG - Intergenic
1131206834 15:90456415-90456437 TGAATCTAAGGGTGCCCAGAAGG - Intronic
1132559273 16:585779-585801 TGCTTCTGAGGGTGCCCTGAGGG - Intergenic
1152276550 17:79361303-79361325 AGCGTCTCAGATAGCCCCGATGG - Intronic
1152845146 17:82595121-82595143 TGCATCCCACGTTGCCCCCATGG - Intronic
1153531727 18:6053682-6053704 TGCTTCTCTGGTTGCGCCTATGG + Intronic
1157320610 18:46631191-46631213 TGAAGCTCAGGTTGCTCTGAGGG - Intronic
1162796319 19:13089388-13089410 TTCCTCTCAGGTTGTCCAGATGG - Intronic
925387956 2:3475838-3475860 TGCATCCCAGGCTGTCGCGAGGG + Intronic
927681287 2:25141179-25141201 AGCTTCTCAGGCTGCCCTGAGGG + Intronic
930405551 2:50951175-50951197 TGTCCCTCAGGTTGCCCCCAAGG - Intronic
932252672 2:70258222-70258244 TGCAGCTGCGGATGCCCCGAGGG + Exonic
947592350 2:231392996-231393018 TGCACCTCAGGTTGCTCCCTTGG - Intergenic
947636487 2:231683077-231683099 TGCCCCTCTGGTTGCCCCCAGGG - Intergenic
947885577 2:233566803-233566825 TGCTTCCCAGGATGCCCCGCTGG + Intergenic
948290269 2:236819302-236819324 TGCAGGGCAGGTGGCCCCGAGGG + Intergenic
948436642 2:237958160-237958182 TCCATCTCAGGCTGCCCCCCCGG - Intergenic
1173553621 20:43950226-43950248 TGCATCTCAGGTTGCCCCGATGG - Intronic
1180165094 21:46021540-46021562 TGGATCTGAGGTTTCCCCTAGGG + Intergenic
1183259866 22:36787751-36787773 TGCATCCCAGGCGGCCCCGCAGG + Intergenic
1184397130 22:44248950-44248972 TGCATCTCAGGCTGACCACAGGG - Exonic
953581436 3:44160741-44160763 TGCATCTCAGTTCACCCCCAAGG + Intergenic
967761107 3:193227274-193227296 TGAATCCCAGGTTGCCACGCAGG - Intergenic
976148182 4:82064709-82064731 TGCAGCTCTGGTTGCCCAGTTGG - Intergenic
977766318 4:100802382-100802404 TCCTTCTCAGGTTGCCCCTCAGG - Intronic
984822766 4:183897078-183897100 TGCATCTCAGGCTTGCCCCAGGG - Intronic
991955709 5:71994426-71994448 ACCATCACAGGTTCCCCCGATGG + Intergenic
992761556 5:79955218-79955240 TGCATCTCAGGGTGCCAAGGAGG - Intergenic
999300683 5:150488385-150488407 TGCATTTCAGCCTGCTCCGAGGG + Intronic
1003042108 6:2697976-2697998 TGCATCTGAGATGGCCCCCAGGG - Intronic
1012154150 6:95795367-95795389 GGCATCTCAGGTGGCATCGATGG + Intergenic
1012171757 6:96024976-96024998 TGGATCTAAGGTTGGCACGAAGG + Intronic
1020181511 7:5926230-5926252 TGCATCTCAGGTTTCCTACATGG - Exonic
1020301422 7:6798659-6798681 TGCATCTCAGGTTTCCTACATGG + Exonic
1024185754 7:46946432-46946454 TGCATCTCATGTTTCCCTTAAGG + Intergenic
1032683757 7:134210287-134210309 TGCTTCTCTGGTTGCTCAGATGG - Intronic
1034191003 7:149213492-149213514 TGCATTTCAAGTTGGCCAGAAGG - Intronic
1040985939 8:53294605-53294627 TGCAGCTGAGGCTGCCCTGAAGG - Intergenic
1050423346 9:5489884-5489906 TGCATCTAAGGTGGCCAGGAAGG + Intergenic
1056939703 9:90944807-90944829 GGAAACTCAGTTTGCCCCGAAGG + Intergenic
1058732585 9:107864531-107864553 TGCTTCTCAGGTTTTCCCTAGGG + Intergenic
1061552987 9:131348806-131348828 TCCATCTGAGGTTGGCCAGAAGG - Intergenic
1062009841 9:134261065-134261087 TCCTGCTCAGGGTGCCCCGAAGG + Intergenic
1062494441 9:136825160-136825182 GGCCTCTCAGGTGGCTCCGAAGG + Intronic
1194334613 X:92629915-92629937 TGCAGCTCTGGTTGCCCCACTGG - Intergenic
1199267805 X:145848698-145848720 TGCTTCTCAGCTTTCCCCCATGG + Intergenic
1200643093 Y:5746969-5746991 TGCAGCTCTGGTTGCCCCTCTGG - Intergenic
1201277376 Y:12312191-12312213 TGCATTTCTGGTGGCCCAGATGG + Intergenic