ID: 1173553628

View in Genome Browser
Species Human (GRCh38)
Location 20:43950268-43950290
Sequence GCAGGCCAAGCGGATGTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173553623_1173553628 7 Left 1173553623 20:43950238-43950260 CCTGAGATGCAGAAGCCACAGGA No data
Right 1173553628 20:43950268-43950290 GCAGGCCAAGCGGATGTCAGCGG No data
1173553621_1173553628 19 Left 1173553621 20:43950226-43950248 CCATCGGGGCAACCTGAGATGCA No data
Right 1173553628 20:43950268-43950290 GCAGGCCAAGCGGATGTCAGCGG No data
1173553625_1173553628 -8 Left 1173553625 20:43950253-43950275 CCACAGGAAGAAGCCGCAGGCCA No data
Right 1173553628 20:43950268-43950290 GCAGGCCAAGCGGATGTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173553628 Original CRISPR GCAGGCCAAGCGGATGTCAG CGG Intronic