ID: 1173554090

View in Genome Browser
Species Human (GRCh38)
Location 20:43953367-43953389
Sequence CCCCTTCCTCCTGTCTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 313}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173554088_1173554090 2 Left 1173554088 20:43953342-43953364 CCTCTGTCTGCTCAGACAGAACT 0: 1
1: 0
2: 1
3: 19
4: 172
Right 1173554090 20:43953367-43953389 CCCCTTCCTCCTGTCTGTTGTGG 0: 1
1: 0
2: 1
3: 32
4: 313
1173554087_1173554090 5 Left 1173554087 20:43953339-43953361 CCGCCTCTGTCTGCTCAGACAGA 0: 1
1: 0
2: 5
3: 19
4: 259
Right 1173554090 20:43953367-43953389 CCCCTTCCTCCTGTCTGTTGTGG 0: 1
1: 0
2: 1
3: 32
4: 313
1173554085_1173554090 20 Left 1173554085 20:43953324-43953346 CCCAGTGCATAGAAGCCGCCTCT No data
Right 1173554090 20:43953367-43953389 CCCCTTCCTCCTGTCTGTTGTGG 0: 1
1: 0
2: 1
3: 32
4: 313
1173554086_1173554090 19 Left 1173554086 20:43953325-43953347 CCAGTGCATAGAAGCCGCCTCTG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1173554090 20:43953367-43953389 CCCCTTCCTCCTGTCTGTTGTGG 0: 1
1: 0
2: 1
3: 32
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173554090 Original CRISPR CCCCTTCCTCCTGTCTGTTG TGG Intronic
900636256 1:3667216-3667238 CCCCCTCTTCCTGTCTTTGGGGG - Intronic
901058755 1:6461941-6461963 CCCCATTCTCCTGTCTGCGGTGG - Intronic
902202826 1:14846404-14846426 CCCCTGCCTCCTCTCTGTTATGG - Intronic
902363968 1:15958835-15958857 CCCCTCCCTCCTGTGTGCTGGGG - Intronic
902627915 1:17687731-17687753 CACCTTCCTCCTGCCAGGTGAGG + Exonic
903574204 1:24328061-24328083 CGCCTTCCTCCTGCCTTGTGTGG + Intronic
904210694 1:28885210-28885232 CCCCATCCACCTGACTGCTGGGG + Intergenic
904295398 1:29516957-29516979 CTCCTTCCTCCTTCCTGGTGTGG + Intergenic
905508979 1:38503425-38503447 CCCCTTACTCCTGGCTGGTCAGG - Intergenic
906062350 1:42957429-42957451 GCCCTTCCTACTGGCTGTGGAGG - Intronic
907441958 1:54484400-54484422 CCCCTTCCTCCTATGTGTCCTGG - Intergenic
911371994 1:97004782-97004804 ATCCTTCCACCTGTCTATTGGGG + Intergenic
911745514 1:101437675-101437697 CCCCTTCCTCCTATGGGGTGGGG - Intergenic
912421989 1:109548780-109548802 CCCCGTCCTCCCGTAAGTTGCGG - Exonic
916339768 1:163718934-163718956 ACCCTTCCTTCTGTTTGTTGTGG + Intergenic
916701472 1:167300263-167300285 CTCCTTCCTCCTGACCGTTTTGG - Intronic
917708350 1:177657741-177657763 ACCCTTCCACCTGTGTGATGTGG + Intergenic
917907164 1:179597249-179597271 TTCCTTAATCCTGTCTGTTGTGG + Intronic
920106020 1:203554262-203554284 CCACTTCCTGCTGGCTGTGGTGG - Intergenic
920378759 1:205523537-205523559 CTCCTCCCCGCTGTCTGTTGGGG - Exonic
920700344 1:208213578-208213600 CCCCTTCTTCCTCTCTTTTCTGG + Intronic
921839757 1:219815811-219815833 CCCCTTCATCCTGTGTTTGGAGG + Intronic
924260980 1:242231231-242231253 CCTCTTCCTCCTCCCTGTTGAGG + Intronic
924286933 1:242497020-242497042 CCCCTTCCAACTGTCTGCTTGGG - Intronic
1062901892 10:1152811-1152833 CCCCTGCCTCCTGTGTGCCGTGG - Intergenic
1062901914 10:1152891-1152913 CCCCTGCCTCCTGTGTGCCGTGG - Intergenic
1063167872 10:3480153-3480175 CCGCTGCCTCCAGCCTGTTGGGG + Intergenic
1064191361 10:13208691-13208713 CCCCTTCCTCCTCTTTTTTTTGG - Intronic
1064438590 10:15333034-15333056 GCCATTCCTCCTGTCTCATGGGG - Intronic
1064968251 10:21036849-21036871 CCCCTACCTGGTGTCTGATGTGG - Intronic
1065186382 10:23173988-23174010 CCACTGCCACCTGTCTTTTGCGG - Intergenic
1065535176 10:26709041-26709063 CCACCTCCTGCTGTCTCTTGGGG + Intronic
1066179994 10:32952028-32952050 CCTCTCCATCCTGTCTGTGGTGG + Intronic
1066616520 10:37300463-37300485 CCCCTTTCTCTTGTCTATTTGGG + Intronic
1067928130 10:50531684-50531706 CTTCTTCCTCCTCTCTGCTGCGG + Intronic
1070962862 10:80511220-80511242 CCCCTTCCTCGCATCTGGTGTGG - Intronic
1070981088 10:80648369-80648391 ACACTTTCTCCTGTATGTTGTGG - Intergenic
1072905514 10:99449665-99449687 CCACTTGCTCCTGTGTTTTGAGG - Intergenic
1073027023 10:100495447-100495469 CCCCTTCCCCCGGATTGTTGTGG - Exonic
1074021796 10:109592261-109592283 CCAATTCCTCGTGTCTTTTGAGG - Intergenic
1074500720 10:114021495-114021517 ACCCTACATCCTGTCTGCTGAGG - Intergenic
1074925741 10:118068559-118068581 CCCCTTCCCCCTATTTGCTGTGG + Intergenic
1075580255 10:123612107-123612129 CCCCTGCCTCCTGTTAGGTGTGG + Intergenic
1077337247 11:2010900-2010922 GCCCTTCCTGCTGTCTGTGCCGG + Intergenic
1077514697 11:2994465-2994487 CCCCCTGCTCCTGGATGTTGGGG + Intergenic
1077532646 11:3104409-3104431 CCCCTTCCTCCCGGCTCTTCCGG - Intronic
1077985754 11:7349486-7349508 CCCCTGCCTCCAGCCAGTTGAGG + Intronic
1078931383 11:15914370-15914392 CCTCTTCCTCCTCTCGGTTAAGG - Intergenic
1080411022 11:32024971-32024993 CACCTTCCTGCTGTCTCATGAGG - Intronic
1080446513 11:32342856-32342878 CTCCTGCCTCCTCTCTGTTTGGG + Intergenic
1081964071 11:47158922-47158944 CCCCTTCCTTTTGCCAGTTGAGG + Intronic
1083485721 11:62981918-62981940 CCAGTTCCTCCTGGCTGGTGTGG - Exonic
1083695162 11:64437772-64437794 CCCCTTCCTCCTGCCTCCCGAGG + Intergenic
1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG + Intergenic
1086659511 11:89397351-89397373 ACCTTTCCTCCTTTCTCTTGTGG - Intronic
1088648311 11:111935884-111935906 CCTCTGCCCCCTGCCTGTTGTGG + Intronic
1089617204 11:119701627-119701649 TCCCTTCCTCCTGGCTCTAGGGG + Intronic
1090382141 11:126334972-126334994 CTCCTCCCTCCTGGGTGTTGTGG + Intronic
1090445349 11:126760167-126760189 TTCCTTCCTCCTGTCTGTCTGGG + Intronic
1090619714 11:128549744-128549766 CTCCTTCCTCGGGGCTGTTGGGG + Intronic
1091319915 11:134642067-134642089 CCAGCTCCTCCTGTCAGTTGGGG + Intergenic
1202820231 11_KI270721v1_random:66082-66104 GCCCTTCCTGCTGTCTGTGCCGG + Intergenic
1091393358 12:139067-139089 CCTCTTCCTCCTCTGTTTTGGGG - Exonic
1091690252 12:2591363-2591385 CCCCTTCCTTCTGACCGGTGTGG + Intronic
1093025292 12:14240276-14240298 CCCCTCCCTCCTGTCTGGCGTGG + Intergenic
1095260865 12:40097944-40097966 CCTCTCCCTCTTGGCTGTTGTGG - Intronic
1096017731 12:48293797-48293819 CCCCTTCCTCTTGTTTCTTAGGG - Intergenic
1096244939 12:49979249-49979271 TCCCTTCCTCCTGTTTGTCAGGG + Intronic
1096251184 12:50033433-50033455 CCCCAGCCTCCTCCCTGTTGGGG - Intergenic
1098246265 12:68521434-68521456 CCCCTTCTTCCTGGCTCTGGAGG + Intergenic
1098689884 12:73473462-73473484 CCCCTTTCTTCTATCTTTTGAGG - Intergenic
1101409816 12:104458389-104458411 CCCATTCCTCCGGTCCCTTGTGG + Intronic
1101998971 12:109544911-109544933 CCACTTCCTCCTGCCTGTGAAGG + Intergenic
1103475855 12:121218186-121218208 GCCCTTCCTCCTGACTTTTATGG - Intronic
1103629780 12:122250916-122250938 CCCGTTCCTCCTCCCTTTTGGGG + Intronic
1103856238 12:123972887-123972909 CCCCTTCCGCCCGGCTGTGGCGG + Intronic
1104072302 12:125356437-125356459 CACCTTCCTCCTGGGTGTTCAGG + Intronic
1104847304 12:131852931-131852953 GACCTCCCTCCTGTCTGTCGGGG + Intergenic
1106555225 13:30803428-30803450 CTTGTTTCTCCTGTCTGTTGGGG + Intergenic
1106854931 13:33841207-33841229 CCCCTTCCTCCAGCCTTCTGGGG + Intronic
1107803303 13:44130896-44130918 CCCCTTCCTGCCGTGTGCTGGGG + Intergenic
1107853864 13:44595739-44595761 CCCTTTCCTCCTGCCCTTTGCGG - Intergenic
1108001626 13:45910039-45910061 CCCCTTCCTCGTGAGTGCTGTGG + Intergenic
1109172616 13:59115341-59115363 CCCTTTCCTCCTGTCTCTGTAGG + Intergenic
1109335667 13:60990813-60990835 CCTCTTCTTCCTGTGTGGTGGGG + Intergenic
1109709588 13:66144422-66144444 CCCTTGCCTCCTAACTGTTGTGG - Intergenic
1109798370 13:67344647-67344669 CTCCTTGATCCTGTCTCTTGAGG - Intergenic
1109877178 13:68420682-68420704 TCCCTTCCTCCTTCCTTTTGGGG + Intergenic
1113405844 13:110039288-110039310 TTCCTTCCTCCTGTCTGGTTTGG - Intergenic
1114277797 14:21163400-21163422 CCCTTTCCTCCTGCCTTTTGTGG - Intergenic
1115862416 14:37702054-37702076 CCCTTTTCTCCTTTCTTTTGAGG - Intronic
1116370280 14:44121771-44121793 CTGTTTCCTCCTGTCTGTTGAGG + Intergenic
1117641105 14:57800041-57800063 CCCATTCCTCCTGACTGGGGAGG + Intronic
1118676548 14:68191601-68191623 CCCTTTCTTCCTGTCTTCTGTGG + Intronic
1118822008 14:69351892-69351914 CCCCCTCCTCCTTTCTTTTTAGG - Intronic
1119267967 14:73276170-73276192 CACCTGCCTCCTGTCAGTAGTGG - Exonic
1119418986 14:74494804-74494826 TGCCTTCCTCCTGTCTTTTCAGG + Exonic
1119856688 14:77906359-77906381 CCCCTCCCTCCTGGCTGTGGGGG + Intronic
1122097543 14:99382514-99382536 CTCCTTCCTCCTGTTCTTTGAGG + Intergenic
1122703884 14:103608239-103608261 GCCCTGCCTCCTGTCTACTGAGG - Intronic
1123414804 15:20087530-20087552 TCCCTTCCCTCTGTCTCTTGTGG + Intergenic
1123524146 15:21094644-21094666 TCCCTTCCCTCTGTCTCTTGTGG + Intergenic
1124637387 15:31373788-31373810 TCCCTTCCTCCTGAGAGTTGAGG + Exonic
1126362636 15:47862101-47862123 GCCCTTCTTCCTCTCTGATGGGG + Intergenic
1127117257 15:55741662-55741684 CACCTTCCTCCTGATCGTTGTGG + Intronic
1127774313 15:62253529-62253551 CACCTTCCTCCAGCCTGCTGTGG - Intergenic
1128146151 15:65333499-65333521 GCCCTTCCTCCTGTCTTCTAGGG + Intronic
1128906822 15:71474719-71474741 CTCCCTCCTCCTGTCTCATGTGG - Intronic
1129225729 15:74169379-74169401 TCCCTTCCTCTTGTCTTTTGAGG - Intergenic
1130405946 15:83602125-83602147 CCCCTTCCTGCTGGCTGGAGTGG - Intronic
1130671828 15:85919696-85919718 CCCCTTCCTCCCAGCTGTGGTGG + Intergenic
1131045893 15:89315139-89315161 CCACTTCCTTCTGTATGCTGGGG - Intronic
1131054318 15:89366709-89366731 CCCCTTCTTCCTTGCTGCTGTGG - Intergenic
1131435152 15:92416323-92416345 CCCCTTCCACCTGTCTCTCCCGG - Intronic
1132299074 15:100765426-100765448 CTCCCTCCTCCTGTGTGTGGTGG + Intergenic
1133286961 16:4694936-4694958 CCCCTACCTCCTGTCTGCGCAGG + Exonic
1135256345 16:20944509-20944531 CCACTTCCTCCTGACTGTCTAGG + Exonic
1137637068 16:49996004-49996026 CCAGTTCCTCCTGTCTGCTTTGG - Intergenic
1139672458 16:68501041-68501063 CCCCATCCTCATGCCTCTTGGGG + Intergenic
1139854227 16:69967992-69968014 CCCCTTCCCCATTTCAGTTGAGG - Intergenic
1139883207 16:70190906-70190928 CCCCTTCCCCATTTCAGTTGAGG - Intergenic
1140369300 16:74404615-74404637 CCCCTTCCCCATTTCAGTTGAGG + Intergenic
1140410540 16:74738174-74738196 CCCCTTCCTCCTGTGTCTCTGGG - Intronic
1140441615 16:74992217-74992239 GCTCTTCCTCCTGACTGTTGTGG + Intronic
1141570204 16:84929554-84929576 CCCCGTCCTGCTGGCTGCTGGGG - Intergenic
1142372482 16:89690830-89690852 CCTCCCCCTCCTGTCTGGTGAGG + Intronic
1142617864 17:1147014-1147036 CCCCATCCTCCTGTCTTTCTGGG + Intronic
1143032074 17:3973421-3973443 CCCCTACCTACTGTGTGCTGGGG - Intergenic
1143548109 17:7612035-7612057 TCCCTTTCTCCTGTGTGCTGTGG - Intronic
1144560193 17:16315014-16315036 CCCCAGCCCCCTGCCTGTTGAGG - Intronic
1144729872 17:17520144-17520166 CCCCTCCCTCCTGGCCGCTGGGG + Intronic
1147468313 17:40630831-40630853 CCCTTTCCTCCTGCCTTTTGCGG + Exonic
1148962169 17:51402392-51402414 CCTCTTCTTCCTCTCTGCTGGGG + Intergenic
1149654613 17:58303537-58303559 CCTCTCCCTCCTGGATGTTGTGG - Intronic
1150984486 17:70180167-70180189 CCCACTGCACCTGTCTGTTGAGG - Intergenic
1151534454 17:74730749-74730771 ACCCTTCTGCCTGTCTGGTGAGG + Intronic
1151713167 17:75818185-75818207 CCCCTTCCTCCCCTCTGCTGTGG + Intronic
1152761121 17:82107504-82107526 CCTCTTCCTCCTTTCTGGCGGGG - Intronic
1155091330 18:22514686-22514708 CCCGTTCCTCCTGACTGATTGGG - Intergenic
1156186026 18:34664627-34664649 CACCTTCCACCTGTCTGTTTAGG - Intronic
1157218209 18:45802917-45802939 CCCCTTCCCCCAGTCTCTTAAGG + Intergenic
1157563138 18:48662541-48662563 CTCCTGCCTCCTGTCTGTGGCGG + Intronic
1158415028 18:57242647-57242669 CCTCTTCCTCCTTTCTCATGTGG - Intergenic
1158927964 18:62289822-62289844 CCTCTTTCTACTCTCTGTTGGGG - Intronic
1159341796 18:67143427-67143449 CACCTTGGTGCTGTCTGTTGAGG + Intergenic
1160099170 18:75904403-75904425 CCCCTTCCACCTGCCTCCTGTGG - Intergenic
1162015108 19:7841400-7841422 CCCCTCCCACCTGGCTGATGAGG - Intronic
1162529994 19:11230419-11230441 CACACTCCTCCTGCCTGTTGTGG - Intronic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1162572971 19:11483203-11483225 CCACTTCCTCCTGTTTTATGGGG - Intronic
1163829582 19:19541276-19541298 CCCCTTCCTCCCCTCTGTACAGG - Intronic
1164231632 19:23294100-23294122 CCCCTTCATACTGTGTGTAGGGG + Intergenic
1164925122 19:32124385-32124407 CGCCTGCCCCCTGCCTGTTGTGG - Intergenic
1165340164 19:35205621-35205643 GCCCTTCCTCCTGGCTCCTGCGG + Intergenic
1166930969 19:46301105-46301127 CCCCTCCTTCCTGGCTGGTGGGG - Intronic
1168352857 19:55686482-55686504 GCCCTTCCTCCTGTCTGCACCGG - Intronic
924978902 2:202484-202506 CCTTTTCCTCCTGCCTGCTGTGG + Intergenic
925159135 2:1670955-1670977 CACCTTCCTTCTGCCTGATGTGG - Intronic
925281183 2:2686442-2686464 CCCGTCCCTCCTGGCTGCTGCGG - Intergenic
925387450 2:3472073-3472095 CCCCTTCGTCCTGCCTGGGGTGG - Intronic
925811328 2:7703675-7703697 CACCGTCCTCCTGGCTGTTATGG - Intergenic
927200067 2:20572708-20572730 CTCCTTCCTCCTGTCTCTTCAGG + Intronic
927738018 2:25540050-25540072 CAGCTTCCTCCTGTCTTTTCAGG + Intronic
927806379 2:26150398-26150420 CCCTTTCCTCCTGCCTTTTGCGG - Intergenic
928617079 2:33051514-33051536 CCCCTTCATTCTGACTGTGGTGG + Intronic
929428980 2:41870953-41870975 AGCCTTCCTTCTGACTGTTGGGG - Intergenic
932606848 2:73171192-73171214 CCCCTCCCTCCTGGGTGTGGAGG + Intergenic
933832348 2:86221267-86221289 CTGCTTCCTGCTGGCTGTTGGGG - Intronic
933870906 2:86564206-86564228 CCCCATACTCCTGTCTCTGGTGG + Intronic
933925580 2:87089218-87089240 CCCCTCCCTCCTGGGTGTGGAGG - Intergenic
934662021 2:96148061-96148083 GCCCTGCCTCCTCTCTGCTGTGG - Intergenic
935029825 2:99311287-99311309 CCCCTGCCTCCTTTTTTTTGAGG + Intronic
935193500 2:100796788-100796810 CACCTACCTTCTGTCTGCTGTGG + Intergenic
935328087 2:101955997-101956019 ACCCATCATCCTGTCTGTTGAGG - Intergenic
936507746 2:113121428-113121450 CCATTTCCTCCTGTCTGCAGGGG + Intronic
936881598 2:117258524-117258546 CCCTTTCTTCCTGTCTGCAGTGG - Intergenic
937170323 2:119859534-119859556 CTTCTTCCTCCTGTCTGTTTGGG + Intronic
938185301 2:129226439-129226461 CCCCTTTCACCTGTCTGTCTAGG - Intergenic
938537315 2:132257017-132257039 TACCTCCCTCCTGTCTGTGGCGG - Intronic
938760659 2:134422865-134422887 CTACTTCCTCCTGATTGTTGAGG - Exonic
938824719 2:134993343-134993365 CCCCCTCCTGTTGCCTGTTGGGG - Intronic
939142230 2:138368639-138368661 CCCCTTCCTGCAGTCTGCAGTGG + Intergenic
941595426 2:167471050-167471072 CTCCTTCATCCTGTCTGATGGGG + Intergenic
943081282 2:183261399-183261421 ACCCTTTCTTCTCTCTGTTGGGG + Intergenic
944440445 2:199737937-199737959 CTGTTTCTTCCTGTCTGTTGGGG + Intergenic
944616827 2:201469208-201469230 CCCCTGCCATCTGTCTGTAGAGG + Intronic
945066717 2:205953763-205953785 TCTCTTCATCCTGTCAGTTGAGG - Intergenic
945191107 2:207188418-207188440 TACTTTCCTCCTGTCTGTTGAGG + Intergenic
946767408 2:223053235-223053257 CCCCCTCCTCCTGAATGGTGAGG - Exonic
947624362 2:231610605-231610627 CCACTTCCTGCTGTCTGTTACGG - Intergenic
948125517 2:235562392-235562414 CCCCTCCCTCTTGTGTGTTTTGG + Intronic
948135279 2:235631815-235631837 GCCCTTCCTGCTGTCAGGTGTGG + Intronic
1168772175 20:422148-422170 CCTCCGCCTCCTGGCTGTTGCGG - Exonic
1172289036 20:33762024-33762046 CCTCGTCCTCCTGCCTGCTGGGG - Exonic
1172765917 20:37350705-37350727 CCCCATTCTCCTCCCTGTTGGGG + Intronic
1172789610 20:37493785-37493807 TCCCTACCTCCAGGCTGTTGGGG + Intronic
1173554090 20:43953367-43953389 CCCCTTCCTCCTGTCTGTTGTGG + Intronic
1174259038 20:49279796-49279818 TCCATTCTTCCTGTGTGTTGGGG + Intergenic
1174447796 20:50602218-50602240 CCCCTTCCTCGTGGCCGTTCTGG + Exonic
1175325025 20:58118458-58118480 TTCCTTCCTCCTATCTCTTGTGG - Intergenic
1176195761 20:63835855-63835877 CCCTTGCCTTCTGTCTGCTGGGG - Intergenic
1177213864 21:18104362-18104384 CTCCTTCCTGCTGTCTTGTGAGG + Intronic
1178237611 21:30860717-30860739 CCCCTTCCACCTGGTTCTTGTGG - Intergenic
1178370308 21:32021659-32021681 CCCCTTCCTTGTGACTGGTGGGG + Intronic
1178620939 21:34174338-34174360 ACCCATCCTCCTTTATGTTGTGG - Intergenic
1179309291 21:40182459-40182481 TCCCTCCCTCCTGTCCGTGGTGG - Intronic
1179502986 21:41821511-41821533 CCCCCTCCTCCTCCCTGCTGAGG - Intronic
1179724094 21:43332104-43332126 CCCTGTCCTGCTGTCTGTGGTGG + Intergenic
1179787500 21:43738047-43738069 CCCCTTCCTCATGGCTGTTATGG + Intronic
1179939599 21:44629016-44629038 CTCCTTCCTGCTGTCTGGTCTGG - Intronic
1181136868 22:20773510-20773532 CCCAGCACTCCTGTCTGTTGTGG - Intronic
1182303660 22:29353158-29353180 TTCCTTCCTCCTCTCTGTTCTGG - Intronic
1183642538 22:39101203-39101225 CCCCTCCCTTCTCTCTGTTTGGG + Intronic
1184122269 22:42459759-42459781 CTCCTCCCTCCTGTCTGATCTGG - Intergenic
1184795676 22:46731206-46731228 CCCCTTCCTCCTTGCTGGAGTGG + Intronic
1185352874 22:50347080-50347102 CTCCCTCATCCTGCCTGTTGTGG + Intronic
949221107 3:1634920-1634942 GCCCTTACTCTTATCTGTTGTGG - Intergenic
949632286 3:5941661-5941683 ATCTTTCCTCCTTTCTGTTGTGG + Intergenic
950029144 3:9840464-9840486 CCCCTGACTCCTCTCTGTAGGGG + Intronic
950130560 3:10542661-10542683 CCACTTCCTCCTGACTGTAATGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951703021 3:25515047-25515069 GGGCTTCCTCCTGTCTCTTGGGG + Intronic
953214122 3:40901935-40901957 CCCCTTCCTCCTTCATGTTTAGG + Intergenic
954278686 3:49560211-49560233 CCCTTTCCTCTTGTTAGTTGTGG + Intronic
954949801 3:54461885-54461907 ATCCTTCCTGCTTTCTGTTGTGG + Intronic
955030514 3:55212147-55212169 ATCCTTCCTGCTTTCTGTTGTGG - Intergenic
955423641 3:58764793-58764815 CCTCTTCCTCCTTCCTCTTGAGG + Intronic
956167441 3:66407316-66407338 CCCCTTTATCCTGTCAGTAGTGG + Intronic
956700001 3:71950539-71950561 CCCCTTCCTCTGGGCTGCTGTGG - Intergenic
957572682 3:81968733-81968755 CCCCTTCCCTCTGGCCGTTGTGG + Intergenic
960888013 3:122416491-122416513 CCGCTCCCTCCTGTTTGTTGTGG + Intergenic
961334132 3:126160058-126160080 CCCCTGCATCCTGTCTGCTGAGG + Intronic
961370004 3:126423265-126423287 CCCCTGGCTCCTGTCTGCTCAGG + Intronic
962330200 3:134471661-134471683 CCCATGCCTCCTGTCTGTCTGGG + Intergenic
964148692 3:153497818-153497840 TCCTCTCCTCCTGTCCGTTGAGG + Intronic
964473868 3:157081772-157081794 GCCGCTCCTCCTGCCTGTTGTGG - Intergenic
966884574 3:184369480-184369502 CCTCTTCCTCCTCCCTGCTGAGG - Intronic
966898119 3:184461052-184461074 CTCCCTCCTCCTCTGTGTTGGGG + Intronic
968507994 4:980831-980853 CCCCATCCTTCTTTCTGTTTAGG - Intronic
968602333 4:1516127-1516149 CCTCTTCCTCCTGGCTGGAGGGG - Intergenic
968755102 4:2411646-2411668 CTGCTTCCTCCTGGCTGTAGAGG + Intronic
968902467 4:3438144-3438166 TTCCTGCCTCCTGTCTGCTGTGG + Intronic
968968271 4:3780541-3780563 CCCCATCCTCCTGCCGGCTGGGG - Intergenic
971124773 4:23741554-23741576 CCCCTTAATCCTGTCTTTTCTGG + Intergenic
972299130 4:37768583-37768605 TCCAGTCCTCCTGTCTTTTGGGG - Intergenic
972702264 4:41505565-41505587 CCCATCCATCCAGTCTGTTGTGG + Intronic
972915321 4:43869912-43869934 CCCCTTCCTCAAGTCTATTGTGG + Intergenic
975657450 4:76655839-76655861 CACCTTCCTTCTCTCTGCTGGGG + Intronic
976491028 4:85670579-85670601 CCCCTCCCTCCTTTCTGGTGTGG - Intronic
978777906 4:112521112-112521134 TCCCTGCCTTCTGTCTGCTGTGG - Intergenic
979491479 4:121332933-121332955 CCTCTTCCTCCTGCCTCTTATGG - Exonic
979535988 4:121821376-121821398 CCATTTGCTCCTTTCTGTTGTGG - Intronic
981689594 4:147492495-147492517 CCCCTTCCTTTTGTCTTTAGGGG + Intronic
981913649 4:150010524-150010546 ACCTTGCCTGCTGTCTGTTGTGG - Intergenic
982112615 4:152070701-152070723 CCTCTTCCTCCTGGCTCTTTGGG + Intergenic
982190747 4:152853017-152853039 TCCCTCCCTACTGTCTGCTGGGG - Intronic
982543987 4:156710149-156710171 CACATTGGTCCTGTCTGTTGAGG - Intergenic
983514176 4:168639379-168639401 CCGCATCCTCCAGTCTGGTGTGG + Intronic
985794977 5:1955620-1955642 CTCCTTCCTCATGACTGTTGTGG + Intergenic
985844072 5:2331097-2331119 CCCATTCCTCCTCTCTTTGGAGG + Intergenic
985872538 5:2568798-2568820 CCTCTTCCTCTTGTCTCCTGTGG + Intergenic
987328996 5:16838542-16838564 CCCCTTGCTCTTTTGTGTTGTGG - Intronic
988533837 5:32048902-32048924 CTCCTTCCTACTGTGTGTTTTGG + Intronic
992073866 5:73173468-73173490 GCCCGTCCTGCTGTCAGTTGGGG + Exonic
992167994 5:74073975-74073997 TCCCTGCCTCCTGTCTGTATCGG - Intergenic
992717234 5:79522787-79522809 CTCCTTCCTCCTGTCCTTTCAGG - Intergenic
993419449 5:87682731-87682753 GCCCTTCCTCCTGTCTTTTGGGG - Intergenic
993580312 5:89652948-89652970 CCCCTTCCTTCTGACTGAGGAGG + Intergenic
996651306 5:125880085-125880107 CACCTTCTTCCAGTCTGGTGGGG + Intergenic
997206630 5:132054054-132054076 CCCCTGCCTCCTTTCTGGGGTGG + Intergenic
1001704987 5:173735131-173735153 CCTGTTTCTCCTGGCTGTTGGGG + Intergenic
1003256364 6:4478701-4478723 CCCCTGCCCCTTGTCTGTCGAGG + Intergenic
1004546554 6:16603714-16603736 CTACTTCCTCCTGCCTGTTCTGG - Intronic
1005178734 6:23078865-23078887 CCCCTTCCTCCCGGCTGTCAAGG + Intergenic
1006554999 6:34858516-34858538 CCCCTTCCCCCTGTCCATTTGGG + Exonic
1006648790 6:35534395-35534417 CCCCCTCCTCCTGCCTGTATGGG + Intergenic
1007231058 6:40348008-40348030 CCCCTTTTTCCTGTGTGCTGGGG + Intergenic
1008236810 6:49060668-49060690 ACCTTTCCTGCTTTCTGTTGTGG - Intergenic
1010824653 6:80457486-80457508 ACACTCCCTCCTGTCTGTTTGGG + Intergenic
1011164366 6:84429902-84429924 CCCTTTCCTCCTGCCTTTTGTGG + Intergenic
1011358263 6:86495214-86495236 ACCCTTCCTGCTTTCTCTTGTGG + Intergenic
1015708359 6:136112329-136112351 TCCCCTCCTCCTGCCTGTTTTGG + Intronic
1017153898 6:151305863-151305885 CTTCTTCCTCCTGGCTGTTTAGG - Exonic
1017343451 6:153353347-153353369 CCACTTCCTCCTCCCTGGTGGGG + Intergenic
1018549783 6:164982478-164982500 CCACTTACTCCTGCATGTTGTGG - Intergenic
1021324889 7:19254720-19254742 CTCCTTTCTTCTGTCTGTAGGGG + Intergenic
1023629827 7:42153137-42153159 CCCTTTCCTCCTAGCTTTTGAGG + Intronic
1024261514 7:47577311-47577333 CCTCTTCCTCTTCTCTTTTGGGG - Intronic
1025252110 7:57358611-57358633 TGCCTGCCTCCTGGCTGTTGAGG - Intergenic
1026837312 7:73647583-73647605 CTCCTTCCTCCTGGCAGCTGAGG + Intergenic
1029642305 7:101828910-101828932 CCCCTTCCCCCTGCCTGGGGTGG - Intronic
1030849528 7:114465909-114465931 CCCTTCCCTCCCATCTGTTGAGG + Intronic
1031614374 7:123864007-123864029 CCCCTTCCTCCTGACAGTGAAGG - Intronic
1032477650 7:132223395-132223417 CCCCTTCTTCCTGGCTCTTAAGG - Intronic
1032567992 7:132968146-132968168 CCTCTACCTCCTGTGTGTTATGG - Intronic
1032657478 7:133947286-133947308 CCCCTTCCTCCTGCCCCTTCAGG + Intronic
1034126351 7:148675214-148675236 CTCCTTCCTTCTGTCTGAGGCGG + Intergenic
1034380573 7:150688684-150688706 ACCCATCCTCCTGCCTGATGGGG - Intronic
1034732509 7:153400260-153400282 TCCCTTTCTCCTGCCTGTTCAGG + Intergenic
1035064623 7:156095749-156095771 CTCCTTCCTCCTGACCGGTGTGG - Intergenic
1035317523 7:158006112-158006134 CCCCTTCCTCCTGCCTCTCCTGG + Intronic
1035630730 8:1104838-1104860 CCACTTCCTGCTCTCTGGTGAGG - Intergenic
1035720554 8:1788146-1788168 CACCTTCATCCTGTGTGTTTAGG - Intergenic
1036406475 8:8459826-8459848 CACCTTCCTCCTTTCTTCTGAGG - Intergenic
1037984678 8:23282358-23282380 CCTCTTTCTCCTTTCTTTTGGGG + Intronic
1039382172 8:37096033-37096055 CCCTTTTCTCCTGCCTTTTGCGG - Intergenic
1040356652 8:46624939-46624961 CCCCTGCCTCTTTTCTGTTTTGG + Intergenic
1040453575 8:47573558-47573580 CACCTTCCTCCAGGCTGATGAGG - Intronic
1042694289 8:71539368-71539390 ACCCTGTCTCCTGTGTGTTGTGG - Intronic
1044463608 8:92478000-92478022 GCGCATCATCCTGTCTGTTGAGG + Intergenic
1046973307 8:120246327-120246349 CTCCTTCCTCATGTCCCTTGAGG - Intronic
1047294539 8:123559419-123559441 CCACTTCCTCCTTTCTTTGGTGG + Intergenic
1048259913 8:132936733-132936755 CCCCTGCCTCCTCTCCGGTGGGG + Intronic
1049362538 8:142219242-142219264 CTCCTTCCTCCTGCCTGTCTGGG - Intronic
1049579863 8:143406402-143406424 GCCCTCCCTCCTGGCTGCTGTGG - Intergenic
1049665727 8:143841609-143841631 CCCCTTCGACCTGTCCCTTGGGG - Intergenic
1050731996 9:8719497-8719519 CCACTTTCTCCTGTCTGATGAGG + Intronic
1052841240 9:33292623-33292645 TCCCTTCCTCATGTCTCTTATGG + Intronic
1055017342 9:71633082-71633104 ACCCTTCCTCCTGAAAGTTGAGG + Intergenic
1056354681 9:85786670-85786692 CCCCTTCTTCCTTTATGCTGAGG - Intergenic
1056636890 9:88338663-88338685 CCATTTCCTCCTATCTGTGGTGG + Intergenic
1058604447 9:106705726-106705748 CCCTTTCCTCCTCTCTGTGTGGG + Intergenic
1059492681 9:114682124-114682146 CTCCCTCCTCCTCGCTGTTGTGG - Intergenic
1059534534 9:115069304-115069326 CCCCTGCCTCCTGTCTCTTATGG + Intronic
1059541318 9:115133073-115133095 CCCTCTCCTCCTGTGTGTTGGGG - Intergenic
1060225104 9:121785714-121785736 CCCCCTCCTCCTCTGGGTTGAGG + Intergenic
1060260727 9:122071522-122071544 CACCCTCCTCCTTTCTGCTGAGG - Intronic
1060361447 9:122962100-122962122 TCCCTTCCCCCTGCCTTTTGTGG - Intronic
1060517952 9:124277500-124277522 CCCTTTCCTGCTGGGTGTTGGGG + Intronic
1061064480 9:128268817-128268839 CACCTTCCTCCTGCCTGCTGTGG - Intronic
1061178682 9:129011813-129011835 TCCCTGCCTCCTGTCTTTAGGGG + Intronic
1061478859 9:130886516-130886538 CCCCTGCCTCCATTCTGCTGGGG - Intronic
1061479289 9:130888694-130888716 CCGCTTCCTCGTGTCAGATGTGG + Intergenic
1062682675 9:137790492-137790514 CTCCTGCCTCCTCTCTGCTGAGG + Intronic
1203428801 Un_GL000195v1:69190-69212 CCTTTTCCTCTTGTCTCTTGAGG - Intergenic
1186765919 X:12770444-12770466 CCCCTTTCTCCCGTCTGTCTGGG - Intergenic
1188514652 X:30972318-30972340 CTCCTTCCTCATTTCTCTTGAGG + Intronic
1189930215 X:46001430-46001452 ATCTTTCCTCCTGTCTCTTGTGG + Intergenic
1191144278 X:57149868-57149890 ATCCTTCCTCCTTTCTCTTGTGG + Intergenic
1191743998 X:64465676-64465698 CCCCTTCCTGATTTCTTTTGGGG + Intergenic
1194105784 X:89765388-89765410 TCTCTTACTCCTGTCTTTTGTGG + Intergenic
1194118705 X:89934916-89934938 ATCTTTCCTCCTTTCTGTTGTGG + Intergenic
1195104845 X:101593844-101593866 TCCCTTCCTCCTCACTGTGGGGG - Intergenic
1196367529 X:114940356-114940378 ACCTTTCCTGCTTTCTGTTGTGG + Intergenic
1199999660 X:153052392-153052414 CCCCTTCAGCCTTTCTCTTGGGG + Intergenic
1200457746 Y:3413248-3413270 TCTCTTACTCCTGTCTTTTGTGG + Intergenic
1202034477 Y:20617954-20617976 GCCTTTCCTGCTTTCTGTTGTGG + Intergenic