ID: 1173556512

View in Genome Browser
Species Human (GRCh38)
Location 20:43969924-43969946
Sequence GTGTGTTAGGGGCAGGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 5, 3: 15, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173556512_1173556520 -6 Left 1173556512 20:43969924-43969946 CCCCTTGCCTGCCCCTAACACAC 0: 1
1: 1
2: 5
3: 15
4: 286
Right 1173556520 20:43969941-43969963 ACACACTCGTGTCGGAGACCAGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173556512 Original CRISPR GTGTGTTAGGGGCAGGCAAG GGG (reversed) Intronic
900430742 1:2602021-2602043 GTGTGCCTGTGGCAGGCAAGTGG - Intronic
901051400 1:6427515-6427537 GGGTGCTAGGTGCAGGCTAGTGG - Intronic
902607386 1:17576198-17576220 GTGGGACAGGGGCAGGCAGGAGG + Intronic
902781802 1:18709734-18709756 GTGTGCTAGGATCTGGCAAGTGG + Intronic
903045658 1:20562610-20562632 GTGTGTGAGGGGCAGCCAGGTGG - Intergenic
904163586 1:28538409-28538431 GACTGTTAGGGACAGGAAAGGGG - Intronic
904922596 1:34020557-34020579 GTGGGGTAGGGGTAGGCGAGTGG + Intronic
905010937 1:34746676-34746698 GTTGGTTGGGGGCAGGGAAGGGG - Intronic
905129822 1:35745814-35745836 GTGTATTGGGGGCAGGGAACAGG + Intronic
905323046 1:37131275-37131297 GTGGGTGAGGGACAGGCAGGAGG - Intergenic
905468599 1:38175120-38175142 CTGAGTCTGGGGCAGGCAAGAGG + Intergenic
905787574 1:40770488-40770510 GTGTGTGGTGGGCAGGGAAGAGG - Intronic
914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG + Intronic
914848024 1:151293465-151293487 GTGGGGTAGGGGCAGGAATGGGG + Intronic
915315764 1:155028211-155028233 GTGTGTTGGGGCCAGGCGGGTGG - Intronic
916160128 1:161903110-161903132 GTGTGCTAGGGGCAAGGAAGTGG - Intronic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
917622986 1:176817115-176817137 GTGTTTGGGGAGCAGGCAAGAGG + Intronic
918128948 1:181608207-181608229 GTGAGGGAGGGGCAGGTAAGTGG + Intronic
919697696 1:200595477-200595499 GAGAGTTAGAGGCAAGCAAGAGG + Intronic
921930115 1:220748191-220748213 GTGTTGTAGGGGCGGGGAAGAGG + Intergenic
922794878 1:228335062-228335084 GCGTCCTAGGGGCAGGCAGGAGG - Exonic
923892686 1:238233895-238233917 GTGTGTGAGGGTGAGGTAAGGGG - Intergenic
924089217 1:240485583-240485605 GTGTGTTAGGGGTAGGTGTGGGG - Intergenic
924178478 1:241417472-241417494 GTGTGCTAGGGGGAGGGACGGGG - Intergenic
924486365 1:244487477-244487499 CTGGATTAGGGGGAGGCAAGAGG + Intronic
924834536 1:247635600-247635622 GTGAGTGAGGGCCAGGGAAGTGG + Intergenic
1063463006 10:6226240-6226262 GTGGGTTCGGGGCTGGCTAGCGG - Exonic
1064000831 10:11662607-11662629 GTGTGTTGGGGGCAGGAGGGAGG - Intergenic
1064139463 10:12778300-12778322 GTGCCTTAGGAGGAGGCAAGAGG + Intronic
1064735317 10:18376355-18376377 TTGTGGTAGGGGCAGGCATTGGG + Intronic
1065676412 10:28179275-28179297 GTGTATAAGGGGCAGAGAAGGGG - Intronic
1066055050 10:31673167-31673189 GTGTCTCAGGAGCAGGCATGAGG + Intergenic
1067427696 10:46222077-46222099 GGGTGATAGGGGAAGCCAAGAGG - Intergenic
1067817731 10:49495320-49495342 GTGTGTGAGAGGCAGGCGTGTGG - Intronic
1067832597 10:49618989-49619011 GGGTGTTAGGGGCAGGGGTGGGG - Intronic
1068893343 10:62171563-62171585 TGGTGGTAGGGGCAGGTAAGGGG - Intergenic
1069051859 10:63803428-63803450 GTGAGTTTGGGGCAGCCAATGGG + Intergenic
1070179664 10:74001184-74001206 GTGTGTTTTGGGGAGGCCAGAGG + Intronic
1070530632 10:77334046-77334068 GTGTGGTTGGGGCAGGCAGGGGG - Intronic
1072246532 10:93548596-93548618 GTGTGTTAGGGTCAGGGTTGGGG - Intergenic
1074494207 10:113964873-113964895 GTCTGTTGGGGGAAGGCAAGTGG + Intergenic
1075130464 10:119733819-119733841 GTGTGTTTAGGCCAGGCAAGTGG - Intronic
1075241524 10:120783363-120783385 GTGTGTTGGGGACAGTAAAGAGG + Intergenic
1075866861 10:125729997-125730019 GTGTGTGAGGAGCAGGCAGTAGG + Intronic
1076710361 10:132330614-132330636 GTGTGGGAGGGTGAGGCAAGAGG - Intronic
1077473152 11:2774283-2774305 CTGTGATAGAGGCAGGCATGGGG - Intronic
1077616097 11:3675241-3675263 GGGCGTTAGGGGCAGGCAGAGGG - Exonic
1077674053 11:4181950-4181972 GTGTGGGAGGGGCAGACGAGAGG + Intergenic
1077940272 11:6833517-6833539 GTGTGTTAGTGGCATGTTAGAGG - Intergenic
1078339419 11:10488389-10488411 GTGTGGTAGGGGAATGGAAGTGG + Intronic
1078881250 11:15450957-15450979 GAGTGCAAGGGGCAGGGAAGTGG + Intergenic
1081678523 11:44985458-44985480 GTGTGTTAGGAGAATGCATGAGG - Intergenic
1082637905 11:55619276-55619298 GTGGGGTAGGGGGAGGCAGGAGG - Intergenic
1083433221 11:62625779-62625801 CTGGGTTAGGGGGAGGGAAGGGG - Exonic
1084033754 11:66495607-66495629 CTGTGAGAGGGGCAGGCAGGTGG - Intronic
1084451409 11:69241022-69241044 GTGTGGTGGGGGCAGGGCAGGGG + Intergenic
1084689349 11:70716069-70716091 GTGTTGGAGGGGCAGGCATGGGG - Intronic
1088893128 11:114059883-114059905 GTGAGTGAGGGGCCGGGAAGAGG + Intronic
1089092295 11:115888101-115888123 AGGTGTTAGGAGCAGGAAAGAGG + Intergenic
1089362290 11:117899044-117899066 GTGTGTTTTGGGCAGGGAGGTGG - Intergenic
1089852875 11:121515498-121515520 GTGTTTTAGGAGCAGGGAGGAGG + Intronic
1090907328 11:131088315-131088337 TTGTGTTAGGGGGAGACAGGTGG - Intergenic
1092197986 12:6561641-6561663 GTATGAGAGGGGCAGGCAGGTGG - Intronic
1092284321 12:7120123-7120145 GTGGGGTAGGGGGAGGCAGGAGG + Intergenic
1092337952 12:7650519-7650541 GTGTGTTTGTGGGAGGTAAGTGG - Intronic
1094742320 12:33303614-33303636 GTGTGTTGGGGGCAGAGAGGGGG + Intergenic
1096269239 12:50151128-50151150 GTGAGTTTGGGGAAGGCCAGAGG - Intronic
1098306819 12:69110580-69110602 GTGTGATAGGTGAAGGCAAAGGG - Intergenic
1101997820 12:109537615-109537637 GTGTGTTTTGGGGAGGCAGGTGG - Intergenic
1106115226 13:26811941-26811963 GTGTTCTAGGGGCTGCCAAGTGG + Intergenic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1107553478 13:41497706-41497728 TTGTGTTAGAAGCAGGTAAGAGG + Intergenic
1107556143 13:41518089-41518111 GTGTGTAGGGGGCAGGAGAGAGG + Intergenic
1109555153 13:63964240-63964262 GTGTGTTGGAAGGAGGCAAGGGG + Intergenic
1109589000 13:64451452-64451474 GTGTGTTTGGGGCAGGGGGGTGG - Intergenic
1109814076 13:67556295-67556317 GGGTGTTGGTGGCAGCCAAGAGG + Intergenic
1111287614 13:86116304-86116326 GGGTATTAGGGGCTGGGAAGGGG - Intergenic
1112284243 13:98089710-98089732 GAGTGTTAGGTGCAGACAATTGG + Intergenic
1113062062 13:106332642-106332664 GTGTGTTGGGGGCAGGGGGGCGG - Intergenic
1117446165 14:55805572-55805594 GTGTGGTATTGGCAGGGAAGGGG + Intergenic
1118303319 14:64633914-64633936 GTGTATGTGGGGCAGGGAAGGGG - Intergenic
1118716555 14:68564093-68564115 CGGTGTTTGGGGCAGGAAAGGGG + Intronic
1118752271 14:68816108-68816130 GTTTTTGTGGGGCAGGCAAGTGG - Intergenic
1119044953 14:71310271-71310293 GTGTGTTAGGGACAGAAGAGGGG + Intergenic
1120545918 14:85811243-85811265 GTGTGTGAGGAGCAGCAAAGAGG + Intergenic
1123956936 15:25346211-25346233 GTGTGTTTGGGTGAGGGAAGAGG - Intronic
1125375090 15:39020240-39020262 GTGTGAAGGGGGCAGGAAAGGGG + Intergenic
1126319317 15:47405208-47405230 GTGTGTTAGTAGCAGGGAGGAGG + Intronic
1127023232 15:54774883-54774905 GTGTGTGAGGTGCATGCTAGTGG - Intergenic
1127120403 15:55766894-55766916 GTGTGGTGGGGGTAGGGAAGTGG - Intergenic
1127934696 15:63625813-63625835 CTGTGTTAGGGACAGTCTAGAGG - Intronic
1128079079 15:64845491-64845513 GGGTCTGAGGGGCAGGGAAGGGG + Intronic
1129855759 15:78823701-78823723 GGGTGTCAGGGAGAGGCAAGTGG + Intronic
1129883699 15:79023885-79023907 GTGTGTGAAGGGCAGGGTAGAGG - Intronic
1130109222 15:80950849-80950871 TTGTGGTTGGGGCAGGAAAGGGG - Exonic
1132720793 16:1314683-1314705 GTGTGTTGGGAGCAGGCCTGAGG + Intronic
1134104493 16:11476165-11476187 GTGAGTGAGGGGCAGGGAACAGG + Intronic
1134134037 16:11668303-11668325 GTGTGCTCGGGGCCGGCAGGCGG - Intergenic
1135842818 16:25892238-25892260 GTGTTTTAGGGGCAGGCATGCGG + Intronic
1136398694 16:30006370-30006392 GGGTGTTGAGGGCGGGCAAGTGG - Intronic
1140441847 16:74993905-74993927 GTTCCTCAGGGGCAGGCAAGAGG - Intronic
1140767229 16:78171466-78171488 ATGTGTTGGGGGGAGGCATGTGG + Intronic
1143952734 17:10646493-10646515 CTCTGTGAGGGGCAGACAAGGGG + Intronic
1144582937 17:16470143-16470165 GTGTCTTAGGGGAAAGCTAGGGG + Intronic
1146954798 17:36931297-36931319 GTGTGTGAGAGGCAGGAAGGTGG - Intergenic
1147184759 17:38707052-38707074 GTGTGGGAGGGGCAGGGGAGTGG - Intronic
1147210592 17:38870548-38870570 GTGTGTTGGGGGAAGGTTAGGGG + Intronic
1147367217 17:39966895-39966917 GTGTATTGGGGTCAGGCAGGAGG - Intronic
1147460571 17:40565519-40565541 GGGTGGGAGGGGCAGGGAAGAGG - Intergenic
1150470818 17:65435971-65435993 GAGTATTAGAGGCAGGAAAGTGG - Intergenic
1151920964 17:77155275-77155297 GTGTTTTTTGCGCAGGCAAGAGG - Intronic
1152182022 17:78828452-78828474 GTGTATTTGGGGCAGGCAGGTGG - Intronic
1152189277 17:78878725-78878747 GGGGGTGAGGGGCAGGGAAGTGG + Intronic
1152610793 17:81314189-81314211 GTCTGTCAGGGGCATGCAAAGGG - Intronic
1152638594 17:81440227-81440249 GTTTGTCAGGGGCGGGCAGGTGG + Intronic
1153973156 18:10244756-10244778 GTGTGTTGGGGGCTAGTAAGGGG + Intergenic
1156341242 18:36212338-36212360 GTGGGTGAGGGGCAGCCACGGGG + Intronic
1157494063 18:48142728-48142750 GTGGGATAGTGGCAGGAAAGGGG + Intronic
1157564183 18:48668598-48668620 GGGTGCAAGGGGTAGGCAAGGGG - Intronic
1160624900 18:80197073-80197095 GTTTCTTGGGGGCAGGGAAGAGG - Intronic
1161494727 19:4580905-4580927 GGGGGTTCGGGGCAGGCAGGGGG - Intergenic
1161750869 19:6095616-6095638 GGGTGTGTGGGGCAGGGAAGGGG + Intronic
1161821402 19:6533160-6533182 GTGGGGAAGGGGCAGGAAAGAGG - Intronic
1162185923 19:8904755-8904777 GTGTGTTAGGGGCAGATGTGAGG + Intronic
1164717511 19:30404297-30404319 CTGTATTTGGGGCAGGCCAGAGG + Intronic
1165445891 19:35856657-35856679 GGGGTTGAGGGGCAGGCAAGGGG - Intronic
1165787895 19:38473408-38473430 GTGGGTCAGGCGCAGGCAGGGGG - Exonic
1166636004 19:44452454-44452476 GTGTGTTAGGGGCTGGCCCCAGG + Intergenic
925093567 2:1175373-1175395 GTGAGTTAGGAGGTGGCAAGAGG - Intronic
926536520 2:14119884-14119906 GTGTGTTTTGAGAAGGCAAGTGG + Intergenic
926650603 2:15339974-15339996 GTATATTGGGGGCAGGGAAGAGG + Intronic
926809249 2:16741742-16741764 TTGTGTTGGGGGGAGGTAAGTGG + Intergenic
926822870 2:16872418-16872440 GTGAGTTTGGGGGAGGCATGAGG + Intergenic
927099934 2:19780386-19780408 GTGTGTCAGGAACAGTCAAGAGG - Intergenic
927519041 2:23688328-23688350 GTGGGTGAGGGACAGGCATGGGG - Intronic
927705879 2:25296336-25296358 CTGTGTAAGGGGCGGGCAGGAGG + Intronic
928132121 2:28660144-28660166 CTCTGTTAGGCACAGGCAAGAGG + Intergenic
928465753 2:31520793-31520815 GTGGGTTGGGGACAGGGAAGGGG - Intergenic
929780246 2:44952656-44952678 GCGAGGTAGGGGCAGGCAAAAGG - Intergenic
930030988 2:47057854-47057876 GAGTGTTATGGGCACTCAAGAGG - Intronic
931068651 2:58618817-58618839 GTGTGTGGGGGGCAGGGGAGAGG + Intergenic
932112572 2:69013907-69013929 GTGTCCCAGGAGCAGGCAAGGGG + Intronic
932411336 2:71549679-71549701 GAGGGGTAGGGGCAGGCATGGGG + Intronic
933878264 2:86642197-86642219 GTGGGGGAGGGGCAGGCAGGTGG - Intronic
933993935 2:87654122-87654144 GGGTGAGAGGGGCAGGGAAGGGG - Intergenic
934541365 2:95177909-95177931 GTGTGTTAGAGGCAGGGAGCTGG + Intronic
934951476 2:98578629-98578651 GTGTGCTAGGGGCAGGCGGATGG - Intronic
936299930 2:111296792-111296814 GGGTGAGAGGGGCAGGGAAGGGG + Intergenic
936639708 2:114298394-114298416 GTGTGGTAGGGGCTGGGAAAGGG + Intergenic
941294308 2:163717009-163717031 GGGTGTTTGGAGAAGGCAAGTGG - Intronic
941769472 2:169329695-169329717 GGCTGGTAGGTGCAGGCAAGAGG + Intronic
942418501 2:175783242-175783264 ATGTGATATGGGCAGGCAAGAGG - Intergenic
942616181 2:177794150-177794172 GCATGTTGGGGGCAGGAAAGGGG + Intronic
942981376 2:182087296-182087318 GTGGGAGAGTGGCAGGCAAGAGG - Intronic
944153558 2:196588177-196588199 TTCTGTTGGGGGCAGGCAGGTGG - Intronic
945179978 2:207081998-207082020 GTGTGTTGGGGGCAGAAAGGAGG + Intronic
945506796 2:210651593-210651615 GAGTGTTCGAGGCAGACAAGAGG - Intronic
945847281 2:214961049-214961071 GTGTGTTAGAGGGAGGCAGTGGG + Intronic
946139785 2:217680483-217680505 GTGTGTCAGGGGGAGGTGAGAGG + Intronic
946252933 2:218424352-218424374 GTGAGTCAGGGGCAGGGGAGGGG + Intronic
946338959 2:219056363-219056385 TTGGGTCAGGGGCAGGCCAGGGG + Intronic
947359661 2:229334307-229334329 GTGTGTTAGGGGCAGGCATGGGG - Intergenic
1168848329 20:960010-960032 GTGTGTGAGAGGGAGACAAGAGG + Exonic
1170428612 20:16258589-16258611 GTGTGTTTGGGGATGGGAAGGGG - Intergenic
1171495419 20:25551609-25551631 GTGAGGTGGGGGCAGGCAGGAGG + Intronic
1172331839 20:34080818-34080840 TTGTGTCAGGGGCAGGAAAGGGG - Intronic
1172506652 20:35467611-35467633 GAGGGTTAGGGACAGGCAGGGGG + Intronic
1173077127 20:39829823-39829845 GTGTACTGGGGGCAGGCAGGGGG - Intergenic
1173256072 20:41395077-41395099 GTGTGGGAGGGGCAGGCTGGTGG + Intergenic
1173556512 20:43969924-43969946 GTGTGTTAGGGGCAGGCAAGGGG - Intronic
1173656731 20:44704695-44704717 GTGTGTTAGGGGGAGGGTGGGGG - Intergenic
1173873411 20:46355501-46355523 GTGTGTTAGGCCCAGGGAGGAGG - Intronic
1175193039 20:57224158-57224180 GTGTGGTGGGGACAGGCAGGGGG + Intronic
1175327278 20:58138517-58138539 GGGTCTTAGTGGCAGGGAAGTGG - Intergenic
1175476816 20:59281715-59281737 GTGTGTTCGGGGTAGGAAGGAGG - Intergenic
1175947037 20:62563752-62563774 GTGTGCAACGGGCAGGCAGGTGG + Intronic
1176064517 20:63187739-63187761 GTGTGTGAGGGCCAGGCTGGAGG - Intergenic
1176214544 20:63941923-63941945 GTGTGGCAGGGGAAGGAAAGAGG + Intronic
1176319511 21:5296561-5296583 GTGGGTTGTGGGGAGGCAAGAGG + Intergenic
1177458033 21:21369129-21369151 GTTTGCTTAGGGCAGGCAAGGGG - Intronic
1180012228 21:45058662-45058684 GAGAGTGAGGGGCAGGGAAGGGG + Intergenic
1180704750 22:17802400-17802422 TGGTGTTAGGAGAAGGCAAGAGG + Intronic
1181669756 22:24420568-24420590 GTGGGTACGGGGCTGGCAAGGGG + Intronic
1182369224 22:29799250-29799272 GTGGGCAAGGGGCAGACAAGGGG - Intronic
1182676572 22:32043701-32043723 AAGTGTAAGGGGCAGGAAAGCGG + Intronic
1183354858 22:37352710-37352732 GTGTGGCTGGGGCAGGAAAGTGG + Intergenic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1184246336 22:43237531-43237553 GTGCGTTCCTGGCAGGCAAGTGG - Intronic
1185057308 22:48587709-48587731 GTGTGTGAGGGCCGGGGAAGTGG - Intronic
949366303 3:3285246-3285268 GTGTGTTAAGGGTAGGGAAAAGG + Intergenic
950161434 3:10764038-10764060 GTGAGTGAGGGGAAGGCAACAGG - Intergenic
950578176 3:13845668-13845690 GTGTACAGGGGGCAGGCAAGAGG - Intronic
951422429 3:22503209-22503231 GTGTCTTGTGGGCAGGGAAGAGG - Intergenic
954631003 3:52047565-52047587 CTGTGCCAGGGGCAGGCAAAGGG - Intergenic
954707802 3:52490270-52490292 GTGTGGTTGGGGCAGGCCTGGGG + Intronic
956204024 3:66737567-66737589 GTGTGTTCTTGGCAGGCAATTGG + Intergenic
957803272 3:85114191-85114213 GTGTGTTAGGGGCTGGATGGGGG + Intronic
961177864 3:124850858-124850880 GTGAGGGAGGGGCAGGGAAGAGG + Intronic
961336432 3:126182610-126182632 GAGTGTTAGGGGCCTGCAATGGG + Intronic
961356033 3:126340617-126340639 GTGCCTTAGGGGCAGGCGGGTGG + Intergenic
961714255 3:128847858-128847880 GTGGGTGGGAGGCAGGCAAGAGG - Intergenic
962566824 3:136669211-136669233 GTGTGTTAGAAGCAGGCAAGTGG - Intronic
963938469 3:151077804-151077826 GTGTGTAGGAGGCAGGCAATTGG - Intergenic
964558423 3:157966130-157966152 TTGAGTCAGGGGCAGGTAAGTGG - Intergenic
966819846 3:183915753-183915775 GTGTGTTGGGGGCAGGGAGGGGG - Intergenic
967849431 3:194071020-194071042 GGGTGTGAAGGGCAGGAAAGGGG + Intergenic
968085935 3:195873889-195873911 GTGTGGTGGGGCCAGGCCAGTGG - Intronic
968897808 4:3414927-3414949 GTGTGTGAGGGGCATGTGAGGGG + Intronic
971417130 4:26442158-26442180 GTGGATTAGGTGAAGGCAAGGGG - Intergenic
973362873 4:49181324-49181346 GTGTGTCAGGGGCAGACGACAGG - Intergenic
973724689 4:53763619-53763641 TTGTGTTAGGAGCAGGAATGAGG - Intronic
975337687 4:73199253-73199275 GTGTGTTGGGAGGAGGGAAGGGG + Intronic
976498521 4:85758635-85758657 GTGCGTTGGAGGAAGGCAAGTGG + Intronic
980984558 4:139683060-139683082 GTTTGGAAAGGGCAGGCAAGCGG + Intronic
981659723 4:147152198-147152220 GTGTGTTTGAGGCAGCCCAGAGG + Intergenic
983074782 4:163312737-163312759 GTGTGTATGGGGGTGGCAAGGGG - Intergenic
985777820 5:1854105-1854127 CTGTGGTAGAGGCAGGGAAGAGG - Intergenic
985803584 5:2021999-2022021 CTGTGTTAGGGGGAGGCAAGGGG - Intergenic
985942625 5:3150732-3150754 GTATGTGAGGGGGAGGGAAGGGG + Intergenic
987090293 5:14503931-14503953 GGGTGTGTGGGGCAGGCACGAGG - Intronic
987855033 5:23410639-23410661 GCCTGTTAGGGGCTGGCAGGGGG - Intergenic
988509827 5:31855448-31855470 GTGTGTGACGGGCAGGGAAGGGG + Intronic
989168100 5:38450129-38450151 TTGGTTTAGGGGCAGGCATGTGG - Intronic
990861422 5:60331677-60331699 GTGGGGAAGGGGAAGGCAAGAGG + Intronic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
993301201 5:86213186-86213208 GGGTGATAAAGGCAGGCAAGAGG - Intergenic
993640188 5:90393099-90393121 GTATGTTAGGGGGAAACAAGTGG - Exonic
994652556 5:102546872-102546894 GTGTGTTAGGGGCTGGGAGAGGG - Intergenic
994946955 5:106406863-106406885 GTGTGTTAGGGGTTGGGGAGTGG + Intergenic
995517606 5:112969485-112969507 GTGGAGTAGGGGAAGGCAAGGGG - Intergenic
996990377 5:129623357-129623379 GTGTGTTAGGAAGAGGCGAGAGG - Intronic
997990303 5:138539309-138539331 GTGTTTTCTGAGCAGGCAAGAGG - Intronic
999037927 5:148374477-148374499 GAGTATTGGGGGCAGGGAAGAGG - Intergenic
999726735 5:154444856-154444878 GCGTTTTATGGGCAGGGAAGAGG - Intergenic
1000185720 5:158855887-158855909 GTGTGTTTGGAGCAGGGCAGGGG - Intronic
1001148583 5:169206128-169206150 CTATGTTGGGGGCAGGGAAGAGG + Intronic
1001381794 5:171310501-171310523 GTGTGTTTGGGGGAGGCAGAGGG - Intronic
1003126217 6:3357963-3357985 GTGGGTGAGGGGAAGGGAAGAGG + Intronic
1003537816 6:6991112-6991134 GTGTGGGAGGCCCAGGCAAGAGG + Intergenic
1004190997 6:13463296-13463318 GCGAGTTAGGGGCAGGCACAGGG + Intronic
1005972747 6:30774318-30774340 GTTTGTCGGGGGCAGGAAAGAGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006935071 6:37711588-37711610 GTGTGAAAGGGGCAGCCAAGAGG + Intergenic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1009670645 6:66744922-66744944 GGGTATTATGGGCTGGCAAGGGG - Intergenic
1010816501 6:80364313-80364335 GTGAGTTACTGGCAGCCAAGAGG + Intergenic
1011699766 6:89944700-89944722 GTGTGTTGGGGGCAGGCAGGGGG - Intronic
1012225432 6:96698258-96698280 GTGGGTTGGTGGCAGGGAAGTGG + Intergenic
1012423930 6:99094072-99094094 GTGTGTGTGGTGAAGGCAAGTGG - Intergenic
1015183012 6:130381348-130381370 TTTTGTTAGGGGCAGGCAAGAGG - Intronic
1018117863 6:160605622-160605644 GGGTGTTAGGGGCAGAGAAACGG + Intronic
1019327520 7:445682-445704 GTGGGGAAGGGGCAGGCCAGGGG - Intergenic
1022192132 7:28026692-28026714 CTGTGTTAGGGGCAAGAAATTGG - Intronic
1023069186 7:36412112-36412134 GTGTGCTAGGGGCAAGCAGAAGG - Intronic
1023897367 7:44445124-44445146 GAGTGTAAGGGGCAGGCAGCAGG - Intronic
1023939909 7:44762778-44762800 GTGTGTCAGGGGCTGCCAGGTGG - Intronic
1024263144 7:47586886-47586908 ATGTGTTAGGGGTAGTGAAGGGG - Intergenic
1025876636 7:65486267-65486289 GTGGGGTGGGGGCAGGCAGGAGG + Intergenic
1027780994 7:82520283-82520305 GTGTGGTATCAGCAGGCAAGAGG + Intergenic
1031986865 7:128168924-128168946 TTGTGTTGGGGGCAGGGAAGAGG - Intergenic
1032536777 7:132671133-132671155 GTGTGGGAGGGGCGGGGAAGAGG + Intronic
1034438342 7:151074317-151074339 GGGGGTTAGGGGCAGGAAGGGGG + Intronic
1034622031 7:152463902-152463924 GTGAGTTAGGGGCAGGGGCGGGG + Intergenic
1034894851 7:154869849-154869871 GTGTGTTGGGGGCAGGGGTGGGG - Intronic
1035321908 7:158035460-158035482 GTGTGGCAGTGGCAGGCAGGGGG + Intronic
1037624556 8:20595634-20595656 GGAAGTTAAGGGCAGGCAAGTGG + Intergenic
1038023589 8:23570366-23570388 GTGTTTTGGGGACAGGAAAGAGG + Intronic
1038649403 8:29388828-29388850 GTGGATGAGGGGCAGGCTAGAGG + Intergenic
1040734537 8:50489942-50489964 ATGTGTTAGGTGTAAGCAAGGGG + Intronic
1040955062 8:52971116-52971138 GTGAGTCAGGGGCAGCCAGGTGG - Intergenic
1041625759 8:60024786-60024808 GTTTGTGGGTGGCAGGCAAGGGG + Intergenic
1044112886 8:88298244-88298266 GGGTGTTTGGGGAAGGGAAGTGG - Intronic
1046530774 8:115442597-115442619 GTGTGTTTGGGGGAAGGAAGGGG + Intronic
1046890355 8:119415847-119415869 GTGTGTTGGGGGGAGGGGAGTGG - Intergenic
1048047629 8:130787923-130787945 TTGTGTTCGGGGCAGTCAGGCGG + Intronic
1048161051 8:132022436-132022458 GAGAGTGAGGGGGAGGCAAGGGG + Intergenic
1048443346 8:134476168-134476190 GTGTGGGTGGGGCAGGCAGGAGG - Intergenic
1049554858 8:143276828-143276850 GTGGGTTGGGGGCAGGTAGGAGG - Exonic
1051125699 9:13802770-13802792 GTGTGTTAATGGCAGGTAGGTGG - Intergenic
1051237530 9:15017550-15017572 GTGTGGTGGGGGGTGGCAAGTGG - Intergenic
1051353257 9:16218145-16218167 GTGTGTCAGGAGCGGCCAAGAGG + Intronic
1051556576 9:18390369-18390391 GTGTTTTCTGGGCAGACAAGTGG + Intergenic
1058107630 9:100990815-100990837 GTGTTTTAGCAGCTGGCAAGGGG - Intergenic
1060120912 9:120988524-120988546 GTGTGTTTGAGGAAGGCTAGTGG + Intronic
1061661628 9:132134055-132134077 GTGTGTTAGTGGGAGGGAAGAGG - Intergenic
1061817960 9:133207596-133207618 GAGGGTTAGGGACAGGGAAGTGG - Intronic
1061993527 9:134172879-134172901 GTGGGCTGGGGACAGGCAAGAGG + Intergenic
1062242439 9:135547578-135547600 GAGGGTTAGGGACAGGGAAGTGG + Intronic
1062314703 9:135960990-135961012 GGGTGTTGGGGGCAGGGGAGGGG + Intronic
1062393057 9:136341607-136341629 GTGGGTGAGGGGCAGGCTTGGGG + Intronic
1062598449 9:137309580-137309602 GTGTGTCAGGGTCAGGCACTGGG - Intronic
1203751382 Un_GL000218v1:83761-83783 GTGCGTCAGGGGCAGACAACAGG + Intergenic
1185518873 X:721725-721747 GTGTGTGTGTGTCAGGCAAGTGG + Intergenic
1185737125 X:2502390-2502412 GGTTGTTGGGGGCAGGGAAGTGG - Intronic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186723980 X:12337009-12337031 GTGTGTTAGGAGGAAGTAAGTGG + Intronic
1187188492 X:17010604-17010626 TTGTGTAAGGGGGAGGGAAGAGG + Intronic
1188043791 X:25402294-25402316 GGGTGTTAGTGGCAGGCACTGGG + Intergenic
1189707881 X:43777995-43778017 GTGGGATAGGGGCAGGGTAGGGG - Intronic
1192552186 X:72063224-72063246 GTGAGTTTGGGGGAGGCAGGAGG - Intergenic
1195899561 X:109783235-109783257 GTGTGTGCGGGGCAGGGAAGAGG - Intergenic
1196531822 X:116796873-116796895 GAATGTTGGGGGCAGGTAAGGGG - Intergenic
1197144874 X:123160213-123160235 GTGTGTTTGCGGGGGGCAAGAGG + Intergenic
1197968099 X:132086200-132086222 GTGTGTTTGGGGGGGGCAATTGG + Intronic
1199284625 X:146042238-146042260 CTGTGTTAGGTGCATGCCAGTGG - Intergenic
1199825138 X:151491058-151491080 ATGTGTTGGGGGCGGGGAAGTGG + Intergenic
1201528332 Y:14961549-14961571 GTGTGTTTGGGGCATGGAGGTGG + Intergenic