ID: 1173556984

View in Genome Browser
Species Human (GRCh38)
Location 20:43973288-43973310
Sequence CAGGAGAAGCAGCCGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 1, 2: 3, 3: 69, 4: 657}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173556984 Original CRISPR CAGGAGAAGCAGCCGGAGGA GGG (reversed) Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900183179 1:1321316-1321338 CAGGGGAAGCTGGCGGGGGAGGG - Intronic
900411087 1:2513020-2513042 CAGGTGAAGCAGCGGGAGAATGG - Exonic
900565418 1:3329572-3329594 CAGGAAAACCAGGCAGAGGAAGG + Intronic
900572258 1:3364470-3364492 CTGGACAAGCCCCCGGAGGATGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901109935 1:6785864-6785886 GAGGAGGAGGAGCCGGCGGAGGG + Intronic
901264915 1:7903032-7903054 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264924 1:7903059-7903081 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264933 1:7903086-7903108 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264942 1:7903113-7903135 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264956 1:7903158-7903180 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264970 1:7903203-7903225 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264979 1:7903230-7903252 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264993 1:7903275-7903297 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901265002 1:7903302-7903324 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901483247 1:9540087-9540109 CAGGAGAAGGGGGCGGGGGAGGG - Intronic
901651617 1:10746465-10746487 TAGGAGAAGCTCCCAGAGGAAGG + Intronic
902089708 1:13893310-13893332 CAGGAGAAGCAGCCCCGGGCCGG + Intergenic
902142355 1:14367401-14367423 GAGGAGAAGCAGCTGGACGTTGG - Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903788201 1:25875264-25875286 CCGGGGAAGCAGCCAGCGGAGGG - Intergenic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905823905 1:41015181-41015203 CAGGAGAAACGGCCAGAGGCAGG + Intergenic
905894439 1:41535906-41535928 CAGGAGAAGTTGCCGGGGGCAGG - Intronic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907868606 1:58422854-58422876 CAGCAGAAGCAGCAGAAGCAAGG + Intronic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908990055 1:70076131-70076153 CGGGAGCAGCAGCCGTATGAAGG + Exonic
909465027 1:75963951-75963973 CTGCAGAAGCAGCCAGATGAAGG + Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910343258 1:86211730-86211752 CAGGTGAAGAGGCCGGAAGAAGG - Intergenic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
911090959 1:94016475-94016497 CAGCAGAGGCAGCTGGAGCAGGG + Intronic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
913380302 1:118203085-118203107 CAGGAGAAGCTGGAGGAGAAAGG - Intergenic
914663209 1:149810896-149810918 CAGGAGAAGCACCTGGAAGCAGG + Intronic
914681162 1:149939183-149939205 TGGGAGGGGCAGCCGGAGGAGGG + Exonic
914704881 1:150162446-150162468 GAGGAGAAGCACTGGGAGGAAGG - Intronic
915476589 1:156156191-156156213 GAGGAGAGGCAGCCAGAGGCAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
917202534 1:172532929-172532951 CAGGCGGAGAAGCCGGAGGCAGG - Intronic
919192591 1:194242950-194242972 CAGGAGAAGCTCCCGGAAGGTGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923286583 1:232501914-232501936 AGGGAGAAGCAGCCGAAGGAAGG - Intronic
924554076 1:245103719-245103741 CAGGAGAGGGGACCGGAGGAGGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062969186 10:1633062-1633084 CAGGAGAGGAAGCAGGAGCACGG - Intronic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063115011 10:3067161-3067183 CAGGGGCAGCGTCCGGAGGAGGG - Intronic
1063401787 10:5753025-5753047 CAAGTGAAGCAGGCGGAGTAGGG + Intronic
1064283287 10:13970309-13970331 CAGGTGAAGAAGCAGGAGCAGGG + Intronic
1064420776 10:15188951-15188973 CAGGAGGAGGAGCTGGAGAATGG - Intergenic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1069742250 10:70692254-70692276 CAGAAGAGCCAGGCGGAGGAGGG + Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1072806268 10:98425641-98425663 CTGGAGAAGAAGCTGAAGGAAGG - Exonic
1073217840 10:101846344-101846366 CAGGAGAGGCTGCCAGAGGAGGG + Exonic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073491336 10:103855319-103855341 CTGGAGAAGGAGCCGGAGCCCGG - Exonic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074456652 10:113601304-113601326 CAGGAGAAGCAGCTGAAGGCTGG + Intronic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075521970 10:123148532-123148554 GAGGAGGAGGAGCCGGACGACGG + Exonic
1075582619 10:123633793-123633815 CAGGAGAGGAAGGCAGAGGAGGG + Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076016029 10:127028182-127028204 CGGGAGAAGCAGGGGCAGGAAGG + Intronic
1076271370 10:129155193-129155215 CAGGAGAAGCAGGTGGAACAAGG + Intergenic
1076482818 10:130796045-130796067 CAGCAGAGGCCGCTGGAGGAGGG + Intergenic
1076869459 10:133186239-133186261 CAGGAGAAGCCGCCTGCGGAAGG + Exonic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1078827839 11:14948175-14948197 CAGAAAAAGCTGCCTGAGGAGGG - Intronic
1078987034 11:16607004-16607026 GAGGAGGAGGAGCGGGAGGAGGG - Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081672096 11:44948192-44948214 CAGGAGAGGCAGCTGCAGGGCGG - Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1082076426 11:47979614-47979636 CAGGAGAAGCCGCAAGAGAAAGG - Intergenic
1082775221 11:57239444-57239466 CAGGAGAAGAACCAAGAGGATGG + Intergenic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1083077506 11:60056294-60056316 TAAGAGAAGCATCTGGAGGAGGG - Intergenic
1083169291 11:60913371-60913393 GAGGAGAAGCAGCTGGATGAGGG - Intergenic
1083174624 11:60941891-60941913 CAGGAAAAGCACCTGGAGGGTGG - Intronic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083571580 11:63764433-63764455 GAGGAGGAGGAGCTGGAGGAGGG - Exonic
1083712951 11:64560000-64560022 CAGGAGGGGGAGCGGGAGGAGGG - Intronic
1083921613 11:65784114-65784136 CAGAAGGAGCATCGGGAGGAGGG + Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1083997557 11:66279620-66279642 CAGGTGAGGCACCGGGAGGAAGG - Intronic
1083998737 11:66284712-66284734 CTGGAGACGCTGCCGGGGGACGG + Exonic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1084400362 11:68939695-68939717 CCAGAGGACCAGCCGGAGGAAGG + Exonic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1085440571 11:76558930-76558952 GAGCAGAAGTAGCCAGAGGATGG + Intergenic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1086026840 11:82303928-82303950 CAGGAGAAGCAGTGGATGGAAGG - Intergenic
1086286178 11:85253944-85253966 GAGGAGAAGCAGCTGGATGTTGG - Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086950882 11:92889158-92889180 CAGGAAAAGAAGTCGGAGGTAGG - Intronic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089015512 11:115162166-115162188 CAGTAGAAGTGGCGGGAGGAGGG + Intergenic
1089278320 11:117354929-117354951 TAGGAAACGCAGCCTGAGGAGGG + Intronic
1089542785 11:119200379-119200401 CAGGAGAAGGAGGTGGTGGAGGG - Intergenic
1089706916 11:120284657-120284679 CAGGAGAGGCAGCCCCAGGATGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1091047116 11:132334603-132334625 CAGGCCAAGCAGCTGGAGGGTGG + Intronic
1091082184 11:132681373-132681395 GAGGAGAAGCAGCTGGATGTCGG + Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092465673 12:8729473-8729495 CAGGAGAAGCAGCTGGACGTCGG - Intronic
1092945662 12:13451525-13451547 CAGGAGAAGGAACAGGATGAGGG - Intergenic
1093013206 12:14129822-14129844 TGGGATAAGCAGCCGGAGCAGGG - Intergenic
1093401734 12:18754293-18754315 GAGGAGAAGCAGCTGGACGTTGG - Intergenic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1093728746 12:22544368-22544390 CCGGAGAGGCGGCGGGAGGAAGG + Exonic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1096208315 12:49741922-49741944 GAGGAGAAGGAGCGGGAGAAAGG - Exonic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096596954 12:52701880-52701902 CAGGAGAAGCAGGCAGGGCATGG - Intronic
1097043343 12:56169662-56169684 AAGGAGAAGGAGCCAAAGGAAGG - Exonic
1097233607 12:57526129-57526151 CAGGAGCAGGGGCCCGAGGACGG - Exonic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1099019590 12:77386920-77386942 CATGAGAAGCAGTTGGAAGAAGG + Intergenic
1100098749 12:91076588-91076610 GAGGAGAAGGAGACGGAGAAGGG + Intergenic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1102491525 12:113292256-113292278 AAGGAGAAGCCTCTGGAGGACGG - Intronic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103059496 12:117847410-117847432 CAAGAGAAGAAGCCAGAGGAGGG + Intronic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1103904064 12:124318549-124318571 GAGGAGAAGCTGCAGGAGGTCGG - Intergenic
1104374321 12:128250523-128250545 CAGGACAAGAAGGCAGAGGAAGG + Intergenic
1104630300 12:130395088-130395110 CCTTAGAAGCAGCGGGAGGAAGG + Intergenic
1104946730 12:132417970-132417992 CAGGAGGAGCAGGCGGGGAAGGG - Intergenic
1105943266 13:25170073-25170095 CCGGAGAAGGAGCAGCAGGAAGG - Exonic
1106164167 13:27227487-27227509 AAGGAAGAGCACCCGGAGGAAGG + Intergenic
1106176673 13:27337862-27337884 CAGGAGAAACAGCCTGTGGCTGG + Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111423100 13:88043360-88043382 GAGGAGAAGGAGCCGGATCATGG + Intergenic
1112290689 13:98142666-98142688 CAGGCGAAGCAGCCCCAGGCAGG + Exonic
1113381611 13:109810807-109810829 CAGGACCCGCAGCCGGAGCAAGG - Intergenic
1113605546 13:111602663-111602685 GAGGAGAGGCATCTGGAGGAGGG - Intronic
1115153715 14:30314809-30314831 GAGGAGAAGCAGCTGGATGTTGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115546010 14:34465324-34465346 CAGGAGAAGCTAATGGAGGAAGG + Intergenic
1117454524 14:55884100-55884122 GAGCAGAAGCTGCCAGAGGAAGG - Intergenic
1117562709 14:56958610-56958632 CAGGAGGACCAGCCTTAGGAAGG + Intergenic
1118746666 14:68779018-68779040 CAGGACAAACAGCCGGAGAGGGG + Intergenic
1118922973 14:70166933-70166955 GAGGAGGAGCAGCCAGAGGAGGG - Exonic
1119166219 14:72496048-72496070 CAGGAAAAGCAGCCAGAAAAGGG - Intronic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1119712787 14:76835006-76835028 CAAGAGAAGTAGCAGGTGGAAGG - Intronic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1120645139 14:87065021-87065043 CAGGAGAGAGAGCCAGAGGAGGG + Intergenic
1121145291 14:91577704-91577726 GAGGAGAAGCAGCTGGACGTTGG + Intergenic
1121153669 14:91663074-91663096 GAGGAGAAGGAGGTGGAGGAGGG - Intronic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1122836037 14:104431597-104431619 CAGCAGACGCAGCCTGAGGTGGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123022665 14:105408958-105408980 GAGGAGGAGGAGCAGGAGGAGGG - Intronic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124179225 15:27457049-27457071 AAGTAGAAGGAGCTGGAGGAGGG + Intronic
1124700826 15:31910269-31910291 CAGGAGCAGCATCCAGAGGAGGG + Intergenic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127343118 15:58066605-58066627 GAGGGGAAACAGCCGGAAGAGGG - Intronic
1127784447 15:62343372-62343394 CAGCAGAAGCAGCTGGCAGAAGG + Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128749541 15:70139225-70139247 GAGGAGCAGCAGGCGGAGGTGGG - Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1130380252 15:83365728-83365750 CTGGAGAAGCGGCCGGACGCAGG - Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131488034 15:92838333-92838355 CAAGAGAAACAGCCGTAGGTGGG - Intergenic
1131790417 15:95958441-95958463 AAGGAGAAGCATCTGGAGGCTGG - Intergenic
1132311235 15:100859452-100859474 CAGGAGGAGAAGCCCCAGGAGGG - Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133345306 16:5065882-5065904 CAGGAGCAGCAGCCCCAGGCTGG + Exonic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136032160 16:27511216-27511238 CAGAACAAGAAGCCAGAGGAAGG + Intronic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136933378 16:34437401-34437423 CGGCAAAAGCAGCCGGAGCAGGG + Intergenic
1136971194 16:34974413-34974435 CGGCAAAAGCAGCCGGAGCAGGG - Intergenic
1137386460 16:48047351-48047373 GAGGAGAAGGAGGTGGAGGATGG + Intergenic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138308658 16:56004085-56004107 CAGGTGAACCACCCTGAGGACGG - Intergenic
1138528196 16:57620781-57620803 GAAGACAAGCAGCCGGTGGAGGG - Intronic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1140209229 16:72958053-72958075 AAGGAGAAGCACCCGGAGCCGGG - Exonic
1140209888 16:72961497-72961519 CAGGAGGAGCAGCAGGGGAATGG - Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141518135 16:84559883-84559905 GGGGAGAAGCAACTGGAGGAGGG + Intergenic
1141608706 16:85169660-85169682 CAGGTGAAGCAGCCGGCGGCGGG + Intergenic
1141635674 16:85312745-85312767 GAGGAGAAGGAGGGGGAGGAAGG + Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142631524 17:1229283-1229305 CCGGAGAAGCCGGCGGGGGAAGG - Intergenic
1142704244 17:1684471-1684493 GAGGAGAAGCTGCAGGAGAAAGG - Exonic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143361748 17:6376894-6376916 TGGGAGAAGCTTCCGGAGGAAGG + Intergenic
1143587257 17:7856448-7856470 CTGGAGCAGCAGCCGTGGGAGGG + Intergenic
1144354724 17:14434424-14434446 TAGGAGATGCATCCTGAGGAAGG + Intergenic
1145846333 17:28041969-28041991 CAGCAGAAGCAGCCGGCGGCGGG + Intronic
1146180977 17:30697972-30697994 CAGGAGGGGCAGCCCGGGGAAGG - Intergenic
1146475904 17:33162600-33162622 GAGGAGAAGTGGCTGGAGGAGGG - Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147320392 17:39642420-39642442 CAGGAGAGGCAGCCTGGGCAGGG + Intronic
1147584175 17:41643582-41643604 CAGGAGAAGCAGGTGGAGCTAGG + Intergenic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1147961159 17:44168438-44168460 CAGGACAGGCAGCGGGAGAAGGG + Intergenic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1150089440 17:62310017-62310039 GAGGAGGAGGAGCAGGAGGAAGG - Intergenic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150238268 17:63610860-63610882 CAGGTGAAGCAGCAGCTGGACGG - Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151153138 17:72105034-72105056 CAGGAGAAGCGGATGGCGGATGG - Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152325165 17:79631802-79631824 CAGGGGGAGCAGCCTGAGGGTGG - Intergenic
1152465666 17:80464693-80464715 CAGGAGAGGAACCTGGAGGAGGG + Intergenic
1152694043 17:81734919-81734941 CAGGGGAAGCAGCTGCAGGCAGG + Intergenic
1153448155 18:5196797-5196819 GAAGAGAAGCAGCGGGACGAGGG + Intronic
1154021360 18:10666658-10666680 ACGGAGAAGCAGCCACAGGAAGG + Intronic
1155877188 18:31101912-31101934 CAGCAGGAGCAGCCGGCAGAGGG + Exonic
1156380792 18:36559301-36559323 CAAGAGAAGCAGCCGCAGAGAGG - Intronic
1156727573 18:40148009-40148031 CAGGCCACGCAGCCGGAGGTGGG - Intergenic
1156882917 18:42102320-42102342 CTGGAGCAGCAGCTGAAGGAAGG - Intergenic
1156939056 18:42742721-42742743 CAGGTGAAGCAGCCCTAAGAAGG + Intergenic
1157589683 18:48828908-48828930 GAGGAGGAGCAGGCGGGGGAAGG - Intronic
1157797995 18:50593369-50593391 CAGAGGAAGCACCTGGAGGATGG - Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158349324 18:56549125-56549147 TAGGAGAAGCGGGTGGAGGATGG + Intergenic
1158707629 18:59807491-59807513 CAATGGAAGCAGCCAGAGGAAGG - Intergenic
1159024373 18:63169032-63169054 CAGGAGAGTCAGCCAGAGGCTGG - Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1160030827 18:75258064-75258086 GAGGAGCAGCAGCCGGCAGATGG - Intronic
1160486708 18:79299923-79299945 CACGAGGAGCAGCCGTAGGCCGG + Intronic
1160845622 19:1164803-1164825 GAGGAGGAGGAGCAGGAGGAGGG + Intronic
1160973930 19:1783251-1783273 CAGGAGGAGAAGGTGGAGGAGGG - Exonic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161957856 19:7506349-7506371 CAGGGGATGAAGCCGGGGGAGGG - Intronic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162289536 19:9768560-9768582 CCGGAGCAGCAGCGGGAGGCCGG + Exonic
1162931361 19:13959458-13959480 GAGGGGACGGAGCCGGAGGATGG + Exonic
1162984119 19:14258384-14258406 CAGGAGGAGGAGCAGGGGGAAGG - Intergenic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163672366 19:18636681-18636703 CAGGACAAGTAGGCGCAGGATGG - Intergenic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1163749199 19:19065197-19065219 GTGGAGACGCTGCCGGAGGAGGG + Intronic
1165090026 19:33381410-33381432 CAGGAGAAGCTGTCCCAGGAGGG + Exonic
1165900138 19:39165686-39165708 CAGGAGAAGCAGCCAGTGAGAGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1166947073 19:46404016-46404038 CGGGAGAGGAAGCCAGAGGAAGG - Intergenic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925220264 2:2133792-2133814 CAGGAAAAGTAGCCTGGGGAAGG - Intronic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
925732985 2:6935480-6935502 CAGGAAAAGAGGCCTGAGGATGG - Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926052503 2:9753891-9753913 CAGCAGAGGCAGCCGTGGGAGGG + Intergenic
926147185 2:10403953-10403975 GAGGAGAGGCAGCCAGAAGAAGG - Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
928813088 2:35253497-35253519 GAGGAGAAGCAGCTGGATGTCGG + Intergenic
929246415 2:39708172-39708194 CGTGAGAAGCAGCCGGTGGTAGG + Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929993075 2:46805769-46805791 CAGGAGAAGCACCCACATGAAGG - Intergenic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931355961 2:61537917-61537939 CAGCAGAAGCGGCAGGAGTAGGG + Exonic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
932124154 2:69128129-69128151 CAGGAGAATCAGCCTGAACATGG + Intronic
932238238 2:70138290-70138312 CAGGAGCAGCAGCCTGACCAAGG + Intergenic
932744460 2:74321322-74321344 CAGGAGAAAGAACCTGAGGAAGG + Intronic
932837283 2:75049541-75049563 CACGAGGAGGAGCCAGAGGACGG - Exonic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933939810 2:87235754-87235776 CAGGAGAACCAGGCAGTGGACGG + Intergenic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934792061 2:97069906-97069928 AAGGAGGGGCAGCCGAAGGAAGG + Intergenic
934814558 2:97313804-97313826 AAGGAGGGGCAGCCGAAGGAAGG - Intergenic
936353327 2:111730019-111730041 CAGGAGAACCAGGCAGTGGACGG - Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938127673 2:128686255-128686277 CAGGGGAAGGAGCCCCAGGATGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
938942486 2:136181271-136181293 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
940815211 2:158290150-158290172 CAGGAGAGGGAGCTGAAGGATGG + Intronic
942985412 2:182134778-182134800 GAGGAGGAGCAGCAGGATGAGGG + Intergenic
943269677 2:185783027-185783049 CATGAGAAGCTACCGGAAGAAGG - Intronic
943834366 2:192500424-192500446 GAGGAGAAGCAGCTGGATGATGG + Intergenic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945995534 2:216432839-216432861 CAGGTGAAGCGCACGGAGGATGG - Exonic
946037682 2:216756702-216756724 CAGGGGGAGCTGCCGGAAGAAGG + Intergenic
946176031 2:217922460-217922482 CAGGCCAAGCTGCCAGAGGACGG + Intronic
946306626 2:218860057-218860079 CAGCAGCAGCAGCCCGAGGCGGG - Exonic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946471395 2:219964285-219964307 GAGGAGAAGCAGCTGGATGTAGG + Intergenic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947536289 2:230942280-230942302 CAGGAGAAGGAGGCAGAAGAAGG - Intronic
948375737 2:237519199-237519221 AAGGGGAAGCAGCTGGAAGAAGG + Intronic
948580983 2:238986952-238986974 CAGGTGACGCTGCCAGAGGAAGG - Intergenic
948587462 2:239028238-239028260 CAGGAGAAGAATCCCGAGGATGG - Intergenic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948741304 2:240048337-240048359 CAGCAGAAGCAGCCAGAGTGGGG - Intergenic
948805635 2:240452606-240452628 CAGGAGCAGCACCCGCAGGCGGG + Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172939322 20:38643836-38643858 AAGGAGAAGCAGCTGGCAGAAGG + Exonic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1174115085 20:48221279-48221301 CAGGAGAAGCAGCCTGTGCCAGG + Intergenic
1174166444 20:48586910-48586932 CAGTACAAGCAGCTGGAAGACGG - Intergenic
1174582595 20:51582714-51582736 CAGGAGAACCAGCCGTGGGAGGG + Intergenic
1174943290 20:54956115-54956137 CAGGAGAAGCACCTGGAGTTCGG - Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175636130 20:60585948-60585970 CAATAGAAGCAGCCGTGGGAAGG - Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180665851 22:17511424-17511446 CATCAGGAGCAGCCGGAGGTGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181766303 22:25094591-25094613 CTGGAGAGGCTGCTGGAGGAAGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182072788 22:27475431-27475453 CAGGAGGGGCAGGCAGAGGAAGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183711175 22:39504381-39504403 CGGGAGAGGCAGCTGGAGAAGGG + Exonic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1183746847 22:39697135-39697157 CAGGTGCAGTGGCCGGAGGAAGG + Intergenic
1183864027 22:40690179-40690201 GAAGAGAGGCAGCCGGGGGATGG - Intergenic
1183987653 22:41578267-41578289 CAGGAGAGGTAGGGGGAGGACGG + Intronic
1184695629 22:46137405-46137427 CAGGAGGAGGAGTCGGGGGAGGG - Intergenic
1184856360 22:47148745-47148767 CAGGAGAAGAACCCAGAGGAGGG - Intronic
1184897657 22:47421049-47421071 CAGGGGAAGCAGCCAGGGAATGG - Intergenic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
950254501 3:11493311-11493333 GAGGAGAAGCAGCTGGATGTTGG - Intronic
954152028 3:48662563-48662585 GAGGAGAAGGAGCAGGAGTATGG + Exonic
954452116 3:50577280-50577302 GAGGGGAAGCAGCTGGATGAGGG + Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954894341 3:53963311-53963333 CAGCAGAAGAGGCTGGAGGAAGG + Intergenic
955400393 3:58587093-58587115 GAGGAGACGCCGCCGGGGGAAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955553706 3:60112539-60112561 CAGCAGAAACAGCCAAAGGAGGG + Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956290418 3:67654645-67654667 GAGGAGGAGCAGCGGGAGGAGGG + Intergenic
959040286 3:101414520-101414542 CAGGTGAAGCAGCAGCTGGACGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962263403 3:133928797-133928819 CAGGAGAGGCAGTCGGATGCAGG - Exonic
964570763 3:158105755-158105777 CAGGCGGAGGAGCTGGAGGAGGG - Exonic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
965587013 3:170327703-170327725 CAGGAGCAGGAGCGGGAGGTGGG - Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966732072 3:183159579-183159601 CAGCAGAAGCAGCCCCAGCAGGG + Intronic
966877507 3:184331550-184331572 CTGGAGAAGCTGCTGAAGGAGGG + Exonic
966902672 3:184498325-184498347 CAGGAAAAGAACACGGAGGAGGG - Intronic
967135657 3:186510643-186510665 CAGTGGAAGCAGCCACAGGATGG - Intergenic
967214136 3:187195991-187196013 CAGGAGAAGCACTTGGAAGATGG + Intergenic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968734300 4:2287428-2287450 CACGTGCAGCAGCCGTAGGATGG + Intronic
969682485 4:8651025-8651047 CAGGAGAAAAAGGCAGAGGAAGG + Intergenic
969723094 4:8904143-8904165 GAGGAGAAGCAGCAGGTCGAGGG - Intergenic
969961207 4:10946524-10946546 GACGAGAAGCAGCCCTAGGAGGG + Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
971195013 4:24464834-24464856 CAGGAGAAACATGCGGTGGAGGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975969403 4:80015712-80015734 GAAGAGAAGAAGCAGGAGGAGGG + Intronic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
979567181 4:122167531-122167553 CAGGAGAAGCAACCAGATTAAGG - Intronic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
984359646 4:178711806-178711828 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
984510612 4:180674103-180674125 CAGGAGAAGCAGGTGAAAGATGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985489516 5:171211-171233 CAGGACAAGCAGCGGGAGCTAGG + Exonic
985553982 5:547190-547212 CAGGAGCAGCTGCCCAAGGATGG + Intergenic
985768878 5:1796617-1796639 CAGGGGAGGCAACCCGAGGAGGG - Intergenic
985774119 5:1831787-1831809 CAGGAGGAGGAGCCGGGGGAAGG - Intergenic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986545481 5:8892217-8892239 CAGGAGATGAAGCTGAAGGAAGG - Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
990450756 5:55929808-55929830 AAGGAGAAGCATCCTGCGGAGGG - Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
995173036 5:109139453-109139475 AAGGAGAAGTAGCAGGAGAATGG - Intronic
995918749 5:117284463-117284485 CAGGAGAAGCAGGCCGGGCACGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998395023 5:141812678-141812700 GAGGAGGAGGAGCAGGAGGAGGG + Intergenic
998644002 5:144042332-144042354 GAGGAGAAGCAGCTGGACGTTGG - Intergenic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
1000046210 5:157523986-157524008 CAGGAACAGCAGTTGGAGGAAGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000539379 5:162520889-162520911 CAGGTGATGCAGCCAAAGGAGGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001549042 5:172588661-172588683 CAGGAGCACCAGCTGGAGGTGGG + Intergenic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002664683 5:180814423-180814445 GAGGAGGAGCAGCCAGAGGAGGG - Intronic
1002971101 6:2021035-2021057 CAGGAGAAGCAGCTGGGAGAAGG - Intronic
1003083907 6:3045687-3045709 CAGGTGAAGCAGCAGCTGGACGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003637321 6:7844683-7844705 CACGTGAACCAGCCTGAGGAGGG + Intronic
1003849621 6:10208508-10208530 GAGGAGGAGCAGGCAGAGGAGGG + Intronic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1004425252 6:15502676-15502698 CATGAGATGCAGCCTGAGGCGGG - Intronic
1004495156 6:16156116-16156138 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1004636105 6:17469257-17469279 GAAGAGAAGCACCCGGAGGGTGG + Intronic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1006081937 6:31572839-31572861 CAGGTGAGGCAGCAGGAGAATGG + Exonic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007661645 6:43490393-43490415 CATGAGAAGCAGCAGCAGCATGG - Intronic
1007701966 6:43770968-43770990 GAGGAGCCGCAGCCGGAGGAGGG + Exonic
1008255791 6:49297978-49298000 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1008531598 6:52466267-52466289 CAAGAGGAGCAGCCGCTGGAAGG - Intronic
1008666454 6:53721738-53721760 CAGGAGAAGAACTCGAAGGAAGG + Intergenic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1009408807 6:63341491-63341513 CAGTAGCAGCAGCCCCAGGAAGG + Intergenic
1011016593 6:82763228-82763250 CAGGAGCAGTAGGTGGAGGAAGG + Intergenic
1011702909 6:89972104-89972126 CAGGAGCAGCAGCTGGGGCAAGG + Intronic
1012980975 6:105830806-105830828 CAGAAGGGGCAGCTGGAGGAGGG + Intergenic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016738989 6:147508748-147508770 CATCAGAAGAAGCCTGAGGAAGG - Intergenic
1018214678 6:161515161-161515183 CAGTAGATGCAGTTGGAGGAAGG - Intronic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018895831 6:168016438-168016460 CGGGAGGAGCAGCCGGTGGCTGG - Intronic
1019221675 6:170478321-170478343 CAGGAGATGAAGCCTGAAGAGGG - Intergenic
1019486898 7:1293555-1293577 CAGGAGAAGCAACGTGAAGAGGG - Intergenic
1019550712 7:1601086-1601108 CAGGAGAAGCAGCCCGCAGGGGG + Intergenic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019749399 7:2719239-2719261 CGGGAGAGGCGGCCGGAGGATGG - Intronic
1019860435 7:3653538-3653560 CAGGAGAAGCCAGTGGAGGAAGG + Intronic
1019940216 7:4283597-4283619 CAGCAGTGGCAGCCGCAGGAAGG - Intergenic
1020954126 7:14718635-14718657 CAGGAGAAGTAGTCCGGGGAGGG + Exonic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021564996 7:22008202-22008224 CAGGAGAAGCAGCAGTAGACAGG + Intergenic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1023717190 7:43056326-43056348 CAGGGGAAGCATCTGGAGCATGG - Intergenic
1023862695 7:44225629-44225651 CAGGAGCAGCGGCTCGAGGAGGG - Intronic
1024222998 7:47303039-47303061 CTGGAGAAGCCACTGGAGGAGGG + Exonic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1025014514 7:55428073-55428095 CAGCTGAAGCGGCAGGAGGAAGG + Intronic
1026463927 7:70637668-70637690 CAAGAAAAGCAGCCCCAGGAAGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1032326887 7:130937179-130937201 CAGGAGAAGCACCCAGTAGATGG + Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1032784627 7:135191127-135191149 CAGCAAAGGCAGCCAGAGGATGG + Intronic
1032803875 7:135337514-135337536 CAGGAACAGCAGCTGGAAGAAGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1035184024 7:157111887-157111909 GAGGAGAAGCAGCTGGATGTTGG - Intergenic
1035469839 7:159102712-159102734 CAGGAGGGGCAGGCGGAGCAGGG + Intronic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1035783670 8:2247411-2247433 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783683 8:2247449-2247471 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783696 8:2247487-2247509 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783707 8:2247525-2247547 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783733 8:2247601-2247623 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783746 8:2247639-2247661 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783771 8:2247715-2247737 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783823 8:2247867-2247889 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783836 8:2247905-2247927 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783849 8:2247943-2247965 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783887 8:2248056-2248078 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783900 8:2248094-2248116 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783913 8:2248132-2248154 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783973 8:2248322-2248344 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783997 8:2248398-2248420 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784019 8:2248474-2248496 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784081 8:2248664-2248686 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784202 8:2249044-2249066 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784215 8:2249082-2249104 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784265 8:2249234-2249256 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784290 8:2249310-2249332 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784335 8:2249462-2249484 CAGGAGGAGGAACCAGAGGAAGG + Intergenic
1035784382 8:2249614-2249636 CAGGAGGAGGAACCAGAGGAAGG + Intergenic
1035784427 8:2249766-2249788 CAGGAGGAGGAACCAGAGGAAGG + Intergenic
1035784474 8:2249918-2249940 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035808335 8:2471795-2471817 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808369 8:2471909-2471931 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808382 8:2471947-2471969 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808395 8:2471985-2472007 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808418 8:2472061-2472083 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808444 8:2472137-2472159 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808457 8:2472175-2472197 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1036281016 8:7401607-7401629 CAGGAGAAGGAGCCAGAGTTGGG - Intergenic
1036340449 8:7909965-7909987 CAGGAGAAGGAGCCAGAGTTGGG + Intergenic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037901190 8:22690540-22690562 AAGGAGAAGAAGGCGGAGAAGGG - Exonic
1038463167 8:27733858-27733880 CAGATGCAGCAGCGGGAGGAAGG + Exonic
1039317068 8:36385513-36385535 GAGGAAAAGTAGCCAGAGGAAGG - Intergenic
1039381623 8:37091040-37091062 CAAGAGGAGAAGCCAGAGGAGGG + Intergenic
1039455358 8:37702365-37702387 TAGGAGAAAGAGGCGGAGGAGGG - Intergenic
1039979273 8:42392395-42392417 CAGGAGACGCAGACGGGGAAAGG - Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040487637 8:47888930-47888952 CAGGAGCAGCTGCAGGAGCACGG + Intronic
1040664681 8:49618741-49618763 CAAGAGCAGCAGCCTTAGGAGGG - Intergenic
1041167190 8:55102054-55102076 GAGGAGAGGAAGCGGGAGGAGGG + Intergenic
1041326167 8:56667661-56667683 CAGGAGTAGCAGCTGGAGCTGGG - Intergenic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1042235896 8:66613107-66613129 CGGGAGAAGCCGGCGGAGGGCGG - Exonic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042937346 8:74073226-74073248 CAGGAGAAGAAGCTGAAGGAGGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1044274680 8:90285838-90285860 AAGGAGAAGCAGCTGGATGTTGG - Intergenic
1044857701 8:96493670-96493692 CCGGAGAAGCAGGCTCAGGAGGG + Exonic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045000153 8:97871345-97871367 CAGGAAAAGCAGGCCGAAGAGGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045951461 8:107856029-107856051 CAGATGAAGAAGCTGGAGGATGG + Intergenic
1046678249 8:117137108-117137130 CAGGAGATGTAGACGGAGAAGGG - Intronic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1047252745 8:123192975-123192997 CAGGGGAAGCGGCTGGAGGCAGG + Intronic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048072903 8:131040367-131040389 TTGGGGAGGCAGCCGGAGGAGGG + Exonic
1048306832 8:133290277-133290299 CAGGAAGAGCAGCCACAGGAAGG + Intronic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1049100767 8:140577596-140577618 GAGGAGGAGCAGCTGGAGGGAGG + Intronic
1049325266 8:142018249-142018271 GAGGACAAGCAGCGGGAGGGGGG - Intergenic
1049334604 8:142076527-142076549 CATGAGAAGGAGCCGGGGGCAGG - Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049415226 8:142491970-142491992 CAGGAGGAGCAGGCAGAGGCAGG + Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1052169701 9:25377797-25377819 GAGGAGAAGCAGTTGGATGATGG - Intergenic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052701793 9:31946906-31946928 CAGGAGGAGCAGCTGGACAATGG - Intergenic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053415533 9:37944834-37944856 CAGGAGAAGCTGCAGGGAGAAGG - Intronic
1054728423 9:68676292-68676314 CAGGAGAGGAAGCAGGTGGATGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056162038 9:83906387-83906409 CTGGAGAACCTGCCAGAGGAGGG - Intronic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1059411477 9:114135063-114135085 CAGGACAAGAAGCCAGAGGCAGG + Intergenic
1059691240 9:116687591-116687613 GAGGAGATGCAGCTGGGGGAGGG + Intronic
1060282885 9:122225989-122226011 CTGGAAATGCAGCCGGACGACGG + Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060896659 9:127223291-127223313 CAGGAGCAGCATCCTCAGGAAGG + Intergenic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061405795 9:130392368-130392390 CAGGAGACGAGGCCTGAGGACGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062165389 9:135105007-135105029 GAGGAGAAGCAGCAGAAGAAAGG - Intronic
1062369383 9:136229817-136229839 CAGGAGAGGTGGCCAGAGGAGGG - Intronic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062729815 9:138102643-138102665 CAGGAGGAGCGGCAGCAGGAGGG - Intronic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1185499346 X:585140-585162 GAGGAGAAGAAGGTGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185714475 X:2330177-2330199 GAGGAGGAGAAGCAGGAGGAGGG + Intronic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186313164 X:8342082-8342104 GAGGAGGAGAAGCAGGAGGAGGG - Intergenic
1186393997 X:9189504-9189526 TAAGAGCAGCAGCTGGAGGAAGG - Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187622963 X:21079007-21079029 GAGGAGATGAAGCCTGAGGAGGG - Intergenic
1188188345 X:27144414-27144436 GAGGAGAAGCAGCTGGACGTTGG + Intergenic
1188553245 X:31383692-31383714 GAGGAGAAGCAGCTGGATGTTGG + Intronic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1194300645 X:92182061-92182083 CAGTAAAAGCAGCTGGAGGGAGG + Intronic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196900029 X:120373889-120373911 CAGGAGGAGGAGGCGGGGGAGGG - Intronic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1197774867 X:130112036-130112058 CAGGAGAAGCAGGCCGATGCTGG - Intergenic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1202233299 Y:22678630-22678652 CTGGAGAAGACACCGGAGGAAGG + Intergenic
1202309857 Y:23517528-23517550 CTGGAGAAGACACCGGAGGAAGG - Intergenic
1202560944 Y:26153065-26153087 CTGGAGAAGACACCGGAGGAAGG + Intergenic
1202590760 Y:26480839-26480861 CAGGAGAAGAAAGGGGAGGAGGG + Intergenic