ID: 1173560857

View in Genome Browser
Species Human (GRCh38)
Location 20:44004384-44004406
Sequence GTTCTCATCTAGGGTTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 394}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173560857_1173560866 19 Left 1173560857 20:44004384-44004406 CCTGAGGAACCCTAGATGAGAAC 0: 1
1: 0
2: 0
3: 9
4: 394
Right 1173560866 20:44004426-44004448 CAGGAAGGTGGACATGGTCATGG 0: 1
1: 0
2: 3
3: 33
4: 320
1173560857_1173560863 4 Left 1173560857 20:44004384-44004406 CCTGAGGAACCCTAGATGAGAAC 0: 1
1: 0
2: 0
3: 9
4: 394
Right 1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG 0: 1
1: 0
2: 23
3: 279
4: 1866
1173560857_1173560864 7 Left 1173560857 20:44004384-44004406 CCTGAGGAACCCTAGATGAGAAC 0: 1
1: 0
2: 0
3: 9
4: 394
Right 1173560864 20:44004414-44004436 GAGAAGGTGAAGCAGGAAGGTGG 0: 1
1: 1
2: 12
3: 163
4: 1402
1173560857_1173560865 13 Left 1173560857 20:44004384-44004406 CCTGAGGAACCCTAGATGAGAAC 0: 1
1: 0
2: 0
3: 9
4: 394
Right 1173560865 20:44004420-44004442 GTGAAGCAGGAAGGTGGACATGG 0: 1
1: 0
2: 1
3: 48
4: 501
1173560857_1173560861 -9 Left 1173560857 20:44004384-44004406 CCTGAGGAACCCTAGATGAGAAC 0: 1
1: 0
2: 0
3: 9
4: 394
Right 1173560861 20:44004398-44004420 GATGAGAACAGAGAAGGAGAAGG 0: 1
1: 3
2: 13
3: 128
4: 1317
1173560857_1173560862 0 Left 1173560857 20:44004384-44004406 CCTGAGGAACCCTAGATGAGAAC 0: 1
1: 0
2: 0
3: 9
4: 394
Right 1173560862 20:44004407-44004429 AGAGAAGGAGAAGGTGAAGCAGG 0: 1
1: 3
2: 38
3: 396
4: 3092

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173560857 Original CRISPR GTTCTCATCTAGGGTTCCTC AGG (reversed) Intronic
903859007 1:26354121-26354143 GCTCTCAGCTGGGGTTCCTGAGG + Exonic
905332169 1:37212438-37212460 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
905973652 1:42159480-42159502 GTTTTCCTCTATGTTTCCTCTGG + Intergenic
906187224 1:43871284-43871306 GTTCTCTACCAGGGTTCTTCTGG - Intronic
906818864 1:48907829-48907851 GCTCTCTTCCAGGATTCCTCAGG - Intronic
908004081 1:59710333-59710355 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
908681433 1:66666076-66666098 GTTTTCATCTAGGGTTTTTATGG + Intronic
909446793 1:75757094-75757116 GTTTTCTTCTAGGGTTCTTATGG - Intronic
909454372 1:75833820-75833842 GTTTTCTTCTAGGGTTCTTAAGG - Intronic
910296095 1:85646896-85646918 GTTTTCATCTAGGGTTTTTATGG - Intergenic
910628160 1:89330472-89330494 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
911371880 1:97003648-97003670 ATTCCCATCTTGGGATCCTCTGG - Intergenic
911773842 1:101782818-101782840 CTTCTCATCCAGGGTTTCTCAGG + Intergenic
912034285 1:105291746-105291768 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
913335472 1:117705769-117705791 GTTTTCATCTAGGGTTTTTATGG + Intergenic
914459921 1:147874120-147874142 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
914964222 1:152239042-152239064 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
916056978 1:161074629-161074651 GTTCTCCTCAAGGGATTCTCAGG - Exonic
916621199 1:166499497-166499519 GTTTTCATCTAGGGTTTTTATGG - Intergenic
918889933 1:190253871-190253893 GTTTTCTTCTAGGGTTTCTATGG + Intronic
920995180 1:210983375-210983397 GTTTTCTTCTAGGGTTCTTATGG + Intronic
922383401 1:225056635-225056657 GTTTTCTTCTAGGGTTCTTATGG + Intronic
923232091 1:231996446-231996468 GTTCTCTTCTAGGGTTTTTTTGG + Intronic
924262916 1:242250452-242250474 GTTCTCATCAAGGTTTCCCCAGG - Intronic
924793142 1:247271435-247271457 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1063553857 10:7059136-7059158 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1065242939 10:23726439-23726461 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1065340624 10:24701310-24701332 GATCCAATCTAGGATTCCTCCGG + Intronic
1066721870 10:38348002-38348024 GTTCTCATCAAGGTTTCCCCAGG + Intergenic
1068390307 10:56387274-56387296 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1068394430 10:56443182-56443204 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1069348499 10:67498039-67498061 GTTTTCTTCTAGGGTTTCTATGG + Intronic
1070476082 10:76830438-76830460 TTTCTCATCTTGGGTTAGTCAGG - Intergenic
1072171154 10:92863432-92863454 GAACTGTTCTAGGGTTCCTCTGG + Intronic
1072835288 10:98704796-98704818 GTTTTCTTCTAGGGTTCTTATGG - Intronic
1074062388 10:109978851-109978873 ATTCTAATCTAGAGTTCCTTTGG - Intergenic
1074631015 10:115254740-115254762 GTTCTCTTCTAGGGTTTTTATGG + Intronic
1074673657 10:115824314-115824336 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1077456031 11:2681463-2681485 TTTCTCATCTAGGGAGCCTGAGG - Intronic
1077732973 11:4753973-4753995 GTTCTCTTATAGGATTACTCAGG + Intronic
1077860170 11:6170976-6170998 GTACCCCTCTAGGCTTCCTCTGG - Intergenic
1078998825 11:16732623-16732645 GTTTTCATCTAGGGTTTTTATGG - Intronic
1079257311 11:18842877-18842899 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1080093185 11:28373770-28373792 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1080180566 11:29420505-29420527 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
1080200826 11:29667677-29667699 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
1080218137 11:29869015-29869037 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1081060644 11:38471385-38471407 GTTTTCTTCTAGGGTTCTTCTGG - Intergenic
1081370264 11:42291737-42291759 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1082127363 11:48448914-48448936 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1082140167 11:48599713-48599735 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1082557364 11:54578629-54578651 GTTCTCTTCTAGGGTTTTTATGG - Intergenic
1082560931 11:54619845-54619867 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1085051383 11:73381935-73381957 GTCCTGAGCTTGGGTTCCTCTGG + Intronic
1085155092 11:74286213-74286235 GTTCCCAGGTAGGATTCCTCAGG - Exonic
1085966586 11:81535394-81535416 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1086804659 11:91225464-91225486 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1089888993 11:121860220-121860242 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
1090576637 11:128112135-128112157 GTTTTCTTCTAGGGTTCTTGTGG - Intergenic
1092604899 12:10107892-10107914 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1093216647 12:16369473-16369495 GATCTCAACTAGGGTTACTTGGG + Intronic
1093351679 12:18110498-18110520 GTTCTCAGCTGGAGTTCCTTTGG - Intronic
1093361591 12:18235961-18235983 GTTTTCTTCTAGGGTTTCTATGG + Intronic
1094715856 12:33014551-33014573 GTTTTCATCTAGGGTTTTTATGG - Intergenic
1095060867 12:37686642-37686664 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1095325455 12:40886672-40886694 GTTTTCTTCTAGGGTTTCTATGG + Intronic
1095558232 12:43534013-43534035 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1095858649 12:46890107-46890129 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1098120068 12:67227200-67227222 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1101790551 12:107922963-107922985 GTTTTCATCTAGGGTTGTTATGG - Intergenic
1101962442 12:109260053-109260075 GTTTTCATGTAGGGTGCCTGGGG + Intronic
1102252872 12:111399341-111399363 GTTCTCATCTGGGGTCCAACTGG + Intergenic
1103952853 12:124561062-124561084 GTGCTAACCTAGGATTCCTCCGG + Intronic
1105964063 13:25369340-25369362 GTTCTAACCTAGGCTGCCTCTGG + Intergenic
1106141939 13:27019056-27019078 GATCTCCTCCAGGATTCCTCTGG + Intergenic
1107107086 13:36655629-36655651 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1108142152 13:47434938-47434960 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1108793995 13:54008741-54008763 GTTCTCTTCTAGGGTTTTTATGG - Intergenic
1109087883 13:57999536-57999558 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1109774879 13:67027454-67027476 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1110509218 13:76329091-76329113 GTCCTCATCTCCGGTACCTCTGG - Intergenic
1110561406 13:76914279-76914301 GTTCTCAGCCAGGGTCCATCTGG + Intergenic
1110715868 13:78703499-78703521 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1110984738 13:81952825-81952847 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1111378409 13:87412657-87412679 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1111586705 13:90291499-90291521 GTTAACTTCAAGGGTTCCTCAGG - Intergenic
1112579941 13:100669857-100669879 GTTCTGACCTGGGGTACCTCTGG + Intronic
1112952470 13:105017231-105017253 GTTCTCTTCTAAAGTACCTCAGG - Intergenic
1115412640 14:33093005-33093027 GTTTTCTTCTAGGGTTTCTACGG - Intronic
1115727469 14:36232890-36232912 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1116033560 14:39601613-39601635 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1117631350 14:57695970-57695992 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
1117811939 14:59556497-59556519 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1117848984 14:59947612-59947634 GTTTTCTTCTAGGGTTCTTATGG + Intronic
1118484912 14:66205494-66205516 GTTTTCATCTAGGGTTTTTATGG - Intergenic
1118569158 14:67175182-67175204 GTTTTCTTCTAGGGTTTTTCTGG + Intronic
1118578994 14:67274227-67274249 GTTTTCTTCTAGGGTTTTTCTGG + Intronic
1118583516 14:67328582-67328604 GTTTTCTTCTAGGGTTTTTCTGG + Intronic
1118950279 14:70430258-70430280 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1118958572 14:70506316-70506338 GTTTTCATCTAGGGTTTTTATGG - Intergenic
1119197137 14:72725347-72725369 GTTCTCATGTAGGCCTCCCCTGG - Intronic
1123884017 15:24706066-24706088 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1124604457 15:31160377-31160399 GTTCTCACTTAGGGCCCCTCTGG + Intronic
1126877817 15:53063157-53063179 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1127991678 15:64123395-64123417 CTTCTTATCCAGGGTTCCTATGG + Intronic
1130677228 15:85963769-85963791 GTTCTCATCTAGAATTCATTTGG + Intergenic
1131389927 15:92039116-92039138 GTTTTCTTCTAGGGTTTTTCCGG - Intronic
1132218760 15:100088875-100088897 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
1132386248 15:101402306-101402328 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
1134804385 16:17112436-17112458 GTTTTCTTCTAGGGTTTCTAAGG - Intronic
1137799585 16:51250013-51250035 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1137828542 16:51521803-51521825 GTTTTCATCTAGGGTTTTTATGG - Intergenic
1137878345 16:52019571-52019593 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1138088821 16:54157404-54157426 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1139258116 16:65562956-65562978 GTTCCCATGTAGGGTTCATGTGG - Intergenic
1140886128 16:79245103-79245125 GTTTTCTTCTAGGGTTCTTAGGG - Intergenic
1141623015 16:85247146-85247168 GCTCTCATCTGTGGTTTCTCTGG + Intergenic
1142110278 16:88327482-88327504 GTTCTCATCTGCGGTTCCCAGGG + Intergenic
1145300468 17:21631535-21631557 GTTCTCATCCAGAATTTCTCTGG + Intergenic
1145349823 17:22071707-22071729 GTTCTCATCCAGAATTTCTCTGG - Intergenic
1145806284 17:27734664-27734686 CATCTCAACTACGGTTCCTCAGG + Intergenic
1149942212 17:60882546-60882568 GTTCTCTTCTAGGGTTTTTATGG + Intronic
1155190672 18:23427054-23427076 GTTTTCTTCTAGGGTTTCTGTGG - Intronic
1155444942 18:25901234-25901256 GTTCTCATCTAGAGGTTCTGGGG - Intergenic
1155478514 18:26260386-26260408 GTTTTCTTCTAGGGTTTTTCTGG + Intronic
1156280504 18:35632586-35632608 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
1156433111 18:37097178-37097200 GGTTTCTTCTAGGGTTCTTCTGG + Intronic
1157675372 18:49564589-49564611 GTTCCCATCTAGGGAAACTCAGG - Intronic
1157944880 18:51968013-51968035 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1157961572 18:52159576-52159598 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1158271012 18:55716603-55716625 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1164135296 19:22409326-22409348 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
1168372290 19:55846126-55846148 GTTTTCTTCTAGGGTTTTTCTGG + Intronic
925215664 2:2093795-2093817 GTTTTCATCTAGGGTTTTTATGG + Intronic
925301428 2:2815981-2816003 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
925374560 2:3374265-3374287 GTTTTCTTCTAGGGTTCTTATGG - Intronic
925545516 2:5011533-5011555 GTGCTCATCTCAGTTTCCTCAGG + Intergenic
926557861 2:14380546-14380568 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
927060126 2:19410493-19410515 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
927385066 2:22523271-22523293 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
927715740 2:25351294-25351316 GCTCTCATTTTGGGTTCGTCTGG - Intergenic
928629375 2:33175043-33175065 GTTTTCTTCTAGGGTTTCTATGG - Intronic
928878158 2:36065556-36065578 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
929271147 2:39973278-39973300 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
929276136 2:40026848-40026870 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
929333106 2:40708594-40708616 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
929360942 2:41089480-41089502 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
930239853 2:48924916-48924938 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
931205953 2:60146095-60146117 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
931885306 2:66610739-66610761 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
931887005 2:66628192-66628214 GTTTTCATCTAGGGTTTTTATGG + Intergenic
932051119 2:68398839-68398861 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
933470925 2:82722470-82722492 GTTCTCTTCTAGGGTTTTTATGG + Intergenic
933568672 2:83981420-83981442 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
934719021 2:96560063-96560085 GTTCTCATCCCGGGTTCCACAGG + Intergenic
936063824 2:109315698-109315720 TTTCCCACCCAGGGTTCCTCTGG + Intronic
938834703 2:135088995-135089017 GTTTTCTTCTAGGGTTTCTATGG + Intronic
938951807 2:136261532-136261554 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
939576300 2:143899578-143899600 GTTCTCATCCAGGCTGGCTCAGG - Intergenic
940387887 2:153094924-153094946 GTTCTCTTCTAGGGTTTTTATGG - Intergenic
941238867 2:163012215-163012237 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
941569683 2:167154513-167154535 GTTTTCTTCTAGGGTTTCTATGG + Intronic
943629855 2:190239070-190239092 GTTCTCTTCTAGGGTTTTTATGG + Intronic
943875103 2:193057712-193057734 CGTATCAACTAGGGTTCCTCTGG + Intergenic
943898567 2:193401912-193401934 GTTTTTTTCTAGGGTTCCTATGG + Intergenic
945013631 2:205491211-205491233 GTTTTCTTCTAGGGTTTCTATGG + Intronic
945434075 2:209798265-209798287 GTTTTCTTCTAGGGTTCTTATGG + Intronic
947241777 2:228002672-228002694 GTTTTCTTCTAGGGTTTCTATGG + Intronic
948590564 2:239047150-239047172 ATGCTCAGCCAGGGTTCCTCTGG - Intergenic
1169175864 20:3513213-3513235 GTTCTCTTCTAGGGTTTTTATGG + Intronic
1169392467 20:5201858-5201880 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1171559967 20:26115154-26115176 GTTCTCATCCAGAATTTCTCTGG - Intergenic
1172363037 20:34327626-34327648 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1173300947 20:41802399-41802421 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1173560857 20:44004384-44004406 GTTCTCATCTAGGGTTCCTCAGG - Intronic
1174254345 20:49243156-49243178 GTTCTCACCTTGGGATCCTCAGG - Intronic
1176970726 21:15262532-15262554 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1177028284 21:15950252-15950274 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1179049373 21:37875515-37875537 CTTCTACCCTAGGGTTCCTCGGG + Intronic
1179447590 21:41443776-41443798 GTTCTCTTCTAGGGATCTGCTGG + Exonic
1182817259 22:33176190-33176212 GTTTTCATCTAGGGTTTTTATGG - Intronic
949287600 3:2425175-2425197 GTTTTCTTCTAGGGTTCTTATGG + Intronic
949421188 3:3867756-3867778 GTTTTCTTCTAGGGTTCTTATGG - Intronic
951182709 3:19677784-19677806 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
951653280 3:24976865-24976887 GTTTTCATCTAGGGTTTTTATGG + Intergenic
952975648 3:38693178-38693200 GTTCTCTTCTAGGGTTTTTATGG + Intergenic
953265957 3:41388479-41388501 GTTTTCATCTAGGGTTTTTATGG + Intronic
954488888 3:50882152-50882174 GTTTTCTTCTAGGGTTCTTATGG - Intronic
955644500 3:61122391-61122413 GTTTTCTTCTAGGGTTTCTATGG - Intronic
956954384 3:74319552-74319574 GTTCTCTTCTAGGGTTTTTATGG - Intronic
956986126 3:74702708-74702730 GTTTTCATCTAGGGTTTTTATGG - Intergenic
957281275 3:78154321-78154343 GTTCTCCTGCAGTGTTCCTCTGG - Intergenic
957850245 3:85798372-85798394 GTTTTCATCTAGGGTTTTTACGG + Intronic
958508699 3:95016507-95016529 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
958563594 3:95779662-95779684 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
959526038 3:107378434-107378456 GTTATGACCTGGGGTTCCTCAGG - Exonic
959722601 3:109509306-109509328 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
959831739 3:110870854-110870876 GTTCTCATCTAAGTCTTCTCTGG + Intergenic
959947648 3:112143838-112143860 GTTTTCATCTAGGATTCTTATGG + Intronic
960069332 3:113411250-113411272 GTTCTCTTCTAGGGTTTTTATGG + Intronic
960345032 3:116520482-116520504 GTTTTCTTCTAGGGTTTCTATGG - Intronic
960716770 3:120583526-120583548 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
961351127 3:126304542-126304564 GTTCTCTTCTTGTGTTTCTCTGG + Intergenic
961926074 3:130482150-130482172 GTTTTCTTCTAGGGTTTTTCTGG + Intronic
962202362 3:133412501-133412523 GTTCTCAGCAAGGGTGCCCCAGG + Intronic
962836287 3:139191744-139191766 GTTTTCTTCTAGGGTTCTTATGG + Intronic
962854884 3:139335652-139335674 GTTTTCTTCTAGGGTTCTTATGG - Intronic
964574098 3:158145236-158145258 GTTTTCTTCTAGGGTTTTTCTGG + Intronic
964694877 3:159496140-159496162 GTTTTCATCTAGGGTTTTTATGG - Intronic
964964731 3:162477995-162478017 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
965088778 3:164135939-164135961 GTTCTCTTCTAGGGTTTTTATGG - Intergenic
965147161 3:164921674-164921696 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
971863871 4:32143556-32143578 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
972916905 4:43892610-43892632 GTTCTCTTCTAGGGTTTTTATGG + Intergenic
972949535 4:44301822-44301844 GTTTTCTTCTAGGGTTTCTATGG + Intronic
973328413 4:48887442-48887464 GTTTTCTTCTAGGGTTCATATGG + Intronic
973591148 4:52443078-52443100 GTTCTCTTCTAGGGTTTTTATGG + Intergenic
973593222 4:52463991-52464013 GTTCTCTTCTAGGGTTTTTATGG - Intergenic
974451400 4:62066297-62066319 GTTCTCTTCTGTGGGTCCTCTGG + Intronic
974470647 4:62314266-62314288 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
974689158 4:65272686-65272708 GTTTTCATCTAGGGTTTTTATGG + Intergenic
974705271 4:65506971-65506993 GTTTTCTTCTAGGGTTTCTATGG + Intronic
974739955 4:65994402-65994424 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
974750387 4:66133050-66133072 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
974955938 4:68641340-68641362 GTTTTCTTCTAGGGTTCTTATGG + Intronic
974959364 4:68678604-68678626 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
975002168 4:69238000-69238022 GTTTTCATCTAGGGTTTTTATGG - Intergenic
975055863 4:69928260-69928282 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
975075866 4:70208318-70208340 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
975255623 4:72231972-72231994 GTTCTCTTCTAGGGTTTTTATGG + Intergenic
975465887 4:74709067-74709089 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
975479763 4:74864838-74864860 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
975503617 4:75114903-75114925 GTTTTCATCTAGGGTTTTTATGG - Intergenic
975520237 4:75292759-75292781 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
975625834 4:76346272-76346294 GTTCTCTTCTAGGGTTTTTATGG - Intronic
978838851 4:113185814-113185836 GTTTTCTTCTAGGGTTCTTATGG + Intronic
978948124 4:114523655-114523677 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
979012747 4:115392209-115392231 GTTCTCTTCTAGGGTTTTTATGG - Intergenic
979581829 4:122369810-122369832 GTTTTCATCTAGGGTTTTTATGG - Intergenic
979800122 4:124897909-124897931 GTTTTCCTCTAGGGTTTCTATGG - Intergenic
980454318 4:133019503-133019525 GTTTTCATCTAGGGTTTTTAAGG - Intergenic
980848369 4:138351743-138351765 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
981237816 4:142438588-142438610 GTTTTCTTCTAGGGTTCTTATGG - Intronic
981450890 4:144896397-144896419 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
981789198 4:148517071-148517093 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
982604531 4:157497445-157497467 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
982684617 4:158473206-158473228 GTTTTCTTCTAGGGTTTTTCTGG + Intronic
983004608 4:162468253-162468275 GTTTTCTTCTAGGGTTCTTACGG - Intergenic
983594824 4:169454216-169454238 GTTTTCTTCTAGGGTTTCTATGG - Intronic
983704810 4:170644292-170644314 GTTTTCCTCTAGGGTTTCTATGG - Intergenic
986551054 5:8956155-8956177 TTTCCTATCCAGGGTTCCTCAGG + Intergenic
986654307 5:9995743-9995765 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
986655551 5:10007720-10007742 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
986655925 5:10012137-10012159 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
986792266 5:11173483-11173505 GCTCTCATCAAGGTTTCCACAGG - Intronic
986950342 5:13075244-13075266 GTTTTCATCTAGGGTTTTTATGG + Intergenic
987534497 5:19166233-19166255 GTTCTCTTCTAGGGTTTTTATGG - Intergenic
988058543 5:26134492-26134514 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
988377553 5:30456693-30456715 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
988721054 5:33879494-33879516 GTCATCATCTAGGCTTGCTCTGG - Intronic
989661946 5:43809277-43809299 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
990022615 5:51146236-51146258 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
990212787 5:53498668-53498690 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
990984183 5:61626343-61626365 GTTCTCATCTCGGGAACCCCAGG - Intergenic
991544134 5:67762572-67762594 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
992360515 5:76033352-76033374 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
993624979 5:90213230-90213252 GTTTTCTTCTAGGGTTTCTGTGG - Intergenic
994276269 5:97842247-97842269 GTTCTCATCTCCACTTCCTCTGG + Intergenic
994282965 5:97927897-97927919 GTTTTCATCTAGGGTTTTTATGG + Intergenic
994462835 5:100088709-100088731 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
995274820 5:110266100-110266122 CTCCTCATCTAGGCTTTCTCTGG + Intergenic
995460200 5:112395131-112395153 GTTTTCTTCTAGGGTTCGTATGG - Intronic
996305897 5:122047151-122047173 GTTCTCTTCTAGGGTTTTTATGG + Intronic
996419981 5:123252037-123252059 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
997034719 5:130175888-130175910 GTTTTCTTCTAGGGTTTCTATGG - Intronic
999604689 5:153301543-153301565 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
999946775 5:156606150-156606172 GTTTTCTTCTAGGGTTCTTATGG + Intronic
999984448 5:156989772-156989794 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1000052785 5:157576335-157576357 CTTCTCCTCTGGGATTCCTCTGG - Intergenic
1000664006 5:163971939-163971961 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1000819533 5:165966307-165966329 GTTCTCTTCTAGGGTTTTTATGG + Intergenic
1005799577 6:29407441-29407463 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1007443176 6:41882153-41882175 GATCTCATCTAGGGTGTGTCTGG + Intronic
1007978323 6:46124462-46124484 GTTTTCATCTAGGGTTTCAATGG - Intergenic
1008095202 6:47332872-47332894 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1008725005 6:54406926-54406948 GTTTTCATCTAGGGTTTTTATGG + Intergenic
1008785599 6:55163663-55163685 GTTTTCTTCTAGGGTTCTTATGG - Intronic
1009999129 6:70930228-70930250 GTTTTCTTCTAGGGTTCTTATGG - Intronic
1010416838 6:75621033-75621055 GTTCTGATCTAGAGTTTTTCAGG + Intronic
1010832007 6:80542437-80542459 CTTCTAAGCTTGGGTTCCTCAGG + Intergenic
1010878181 6:81135583-81135605 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1011552665 6:88544323-88544345 GTTCTCAGCTATGGTCCTTCTGG + Intergenic
1012048532 6:94309431-94309453 GTTTTCTTCTAGGGTTCTTACGG + Intergenic
1012740289 6:103007904-103007926 GTTTTCATCTAGGGTTTTTATGG - Intergenic
1012799500 6:103806872-103806894 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1012921988 6:105229649-105229671 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1014121134 6:117726318-117726340 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
1014853661 6:126372230-126372252 GGTGTCATCTGGGTTTCCTCTGG - Intergenic
1015358630 6:132309888-132309910 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1017236357 6:152120782-152120804 CATCTCAACTAGGGTTCCTGGGG - Intronic
1018348322 6:162926691-162926713 GTTTTCTTCTAGGGTTTCTGTGG - Intronic
1019143781 6:169963899-169963921 GTGCTCCTCCAGGGTTCCTCCGG + Intergenic
1020343739 7:7140702-7140724 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1020517555 7:9141694-9141716 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1020569668 7:9843780-9843802 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
1020881629 7:13768890-13768912 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1020885147 7:13811166-13811188 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1021307617 7:19050763-19050785 GTTTTCTTCTAGGGTTCTTAAGG - Intronic
1022876713 7:34540787-34540809 GTTCTCTTCTAGGGTTTTTATGG + Intergenic
1025277758 7:57598627-57598649 GTTCTCATCCAGAATTTCTCTGG + Intergenic
1025577961 7:62671880-62671902 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1027445583 7:78269870-78269892 GTTTTCTTCTAGGGTTTCTATGG + Intronic
1027447659 7:78292970-78292992 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1027576878 7:79942194-79942216 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1027637564 7:80694018-80694040 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1027871381 7:83712506-83712528 GTTCTCTTCTAGGGTTTTTATGG + Intergenic
1028320099 7:89449195-89449217 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1028324608 7:89506632-89506654 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1030165977 7:106555607-106555629 GTTTTCATCTAGGGTTTTTATGG + Intergenic
1030922486 7:115409040-115409062 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1032887288 7:136154434-136154456 GTTCTCAACTGGGGTTCATAGGG + Intergenic
1033670864 7:143491373-143491395 CTTCCCATCTGAGGTTCCTCAGG - Intergenic
1036955363 8:13182425-13182447 GTTTTCATCTAGGGTTTTTATGG + Intronic
1037408641 8:18570355-18570377 GTTTTCTTCTAGGGTTTCTATGG - Intronic
1038082856 8:24159645-24159667 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1041470213 8:58199673-58199695 GTTTTCTTCTAGGGTTCTTATGG + Intronic
1041842587 8:62289347-62289369 GTTTTCTTCTAGGGTTTTTCTGG + Intronic
1042972028 8:74419761-74419783 GTTTTCTTCTAGGGGTTCTCTGG + Intronic
1043042819 8:75283271-75283293 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
1043189686 8:77202802-77202824 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1043194578 8:77275810-77275832 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1045083627 8:98655371-98655393 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
1045088658 8:98715168-98715190 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
1045094005 8:98777915-98777937 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
1045205446 8:100034993-100035015 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
1045591553 8:103604103-103604125 GTTTTCTTCTAGGGTTTTTCTGG + Intronic
1045669041 8:104526718-104526740 GTTTTCTTCTAGGGTTTTTCTGG - Intronic
1046009563 8:108529811-108529833 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1046342537 8:112877954-112877976 GTTTTCATCTAGGGTTTTTATGG - Intronic
1046721634 8:117626526-117626548 ATTCTCATCTATGGTAACTCTGG + Intergenic
1047656350 8:126981608-126981630 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1047667592 8:127108867-127108889 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1047744531 8:127834456-127834478 GTTTTCATCTAGGGTTTTTATGG - Intergenic
1048092401 8:131255361-131255383 GTTTTCATCTAGGGTTTTTATGG - Intergenic
1048424310 8:134308620-134308642 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1050373689 9:4948812-4948834 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1051113152 9:13663088-13663110 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1051826127 9:21222253-21222275 GTTTTCTTCTAGGGTTCTTATGG - Intronic
1051886446 9:21898268-21898290 GTTTTCATCTAGGGTTTTTATGG - Intronic
1051887842 9:21913664-21913686 GTTTTCATCTAGGGTTTCTATGG - Intronic
1053404361 9:37858953-37858975 GTGCTCCTTTGGGGTTCCTCAGG - Intronic
1053704236 9:40733701-40733723 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1054414320 9:64857307-64857329 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1054945222 9:70788719-70788741 TTTCTCATCTAGGGTTCCCATGG + Intronic
1058090496 9:100800568-100800590 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1060360321 9:122949789-122949811 ATTGTCTTCTAGGGCTCCTCAGG - Intronic
1062101419 9:134730566-134730588 GTTCTCACCTTGGTGTCCTCGGG + Intronic
1185829442 X:3286042-3286064 TTTCTTATCTAGGCTTCATCTGG + Intergenic
1186842218 X:13495456-13495478 GTTCTCATCAAAGGTTCAGCAGG + Intergenic
1187192389 X:17047389-17047411 GTTATCCTCCAGGGTTCGTCGGG - Exonic
1188227044 X:27612550-27612572 GTTTTCTTCTAGGGTTTCTATGG + Intronic
1190514828 X:51213004-51213026 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1190519241 X:51260406-51260428 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1190535983 X:51428554-51428576 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1190863533 X:54365522-54365544 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1190977629 X:55421978-55422000 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1191005547 X:55707466-55707488 GTTCTCTTCTAGGGTTTTTATGG - Intergenic
1191066499 X:56353722-56353744 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1191076228 X:56456305-56456327 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1191115881 X:56852175-56852197 GTTTTCTTCTAGGGTTCTTACGG - Intergenic
1191914644 X:66188353-66188375 GTTCCCATCCAGGGCTCCTAGGG - Exonic
1192628120 X:72751258-72751280 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1192653589 X:72969550-72969572 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1192719015 X:73672870-73672892 GTTTTCTTCTAGGGTTTCTATGG + Intronic
1192721772 X:73706426-73706448 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
1192823823 X:74673451-74673473 GTTTTCTTCTAGGGTTCTTATGG + Intergenic
1192876681 X:75236835-75236857 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1192883126 X:75308948-75308970 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1192905986 X:75551016-75551038 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1193008817 X:76651947-76651969 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1193054247 X:77133089-77133111 GTTCTCTTCTAGGGTTTTTATGG + Intergenic
1193267318 X:79487137-79487159 GTTTTCTTCTAGGGTTCTTATGG - Intergenic
1193974220 X:88097918-88097940 GTTGTCATCTAGGGTTTTTGTGG + Intergenic
1195170993 X:102268326-102268348 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1195187867 X:102418773-102418795 GTTTTCTTCTAGGGTTTCTATGG + Intronic
1195425590 X:104725989-104726011 GTTTTCTTCTAGGGTTTCTATGG + Intronic
1195660926 X:107377147-107377169 GTTTTCTTCTAGGGTTTTTCTGG + Intergenic
1196054963 X:111345279-111345301 GTTTTCTTCTAGGGTTCTTATGG - Intronic
1196338559 X:114568506-114568528 GTTGTCATCTCTGTTTCCTCTGG - Intergenic
1196356148 X:114795469-114795491 GTTTTCTTCTAGGGTTTCTATGG + Intronic
1197327837 X:125116273-125116295 GTTCTCTTCTAGGGTTTTTATGG - Intergenic
1198705152 X:139440712-139440734 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
1198887735 X:141357709-141357731 GTTTTCATCTAGGGTTTTTATGG + Intergenic
1199022554 X:142899085-142899107 GTTTTCATCTAGGGTTTTTATGG - Intergenic
1199567763 X:149233678-149233700 GTTTTCTTCTAGGGTTTTTCTGG - Intergenic
1199622999 X:149715651-149715673 GTTCTCCTCCAGTGATCCTCTGG - Exonic
1200743646 Y:6882482-6882504 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1201405697 Y:13647561-13647583 GTTTTCTTCTAGGGTTCTTAAGG + Intergenic
1201664316 Y:16431964-16431986 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1201974613 Y:19835204-19835226 GTTTTCATCTAGGGTTTTTATGG + Intergenic
1202166831 Y:21998387-21998409 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1202224529 Y:22587986-22588008 GTTTTCTTCTAGGGTTTCTATGG + Intergenic
1202318585 Y:23607674-23607696 GTTTTCTTCTAGGGTTTCTATGG - Intergenic
1202552182 Y:26062383-26062405 GTTTTCTTCTAGGGTTTCTATGG + Intergenic