ID: 1173560860

View in Genome Browser
Species Human (GRCh38)
Location 20:44004394-44004416
Sequence CTCCTTCTCTGTTCTCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 408}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173560860_1173560865 3 Left 1173560860 20:44004394-44004416 CCTAGATGAGAACAGAGAAGGAG 0: 1
1: 0
2: 3
3: 37
4: 408
Right 1173560865 20:44004420-44004442 GTGAAGCAGGAAGGTGGACATGG 0: 1
1: 0
2: 1
3: 48
4: 501
1173560860_1173560862 -10 Left 1173560860 20:44004394-44004416 CCTAGATGAGAACAGAGAAGGAG 0: 1
1: 0
2: 3
3: 37
4: 408
Right 1173560862 20:44004407-44004429 AGAGAAGGAGAAGGTGAAGCAGG 0: 1
1: 3
2: 38
3: 396
4: 3092
1173560860_1173560864 -3 Left 1173560860 20:44004394-44004416 CCTAGATGAGAACAGAGAAGGAG 0: 1
1: 0
2: 3
3: 37
4: 408
Right 1173560864 20:44004414-44004436 GAGAAGGTGAAGCAGGAAGGTGG 0: 1
1: 1
2: 12
3: 163
4: 1402
1173560860_1173560863 -6 Left 1173560860 20:44004394-44004416 CCTAGATGAGAACAGAGAAGGAG 0: 1
1: 0
2: 3
3: 37
4: 408
Right 1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG 0: 1
1: 0
2: 23
3: 279
4: 1866
1173560860_1173560866 9 Left 1173560860 20:44004394-44004416 CCTAGATGAGAACAGAGAAGGAG 0: 1
1: 0
2: 3
3: 37
4: 408
Right 1173560866 20:44004426-44004448 CAGGAAGGTGGACATGGTCATGG 0: 1
1: 0
2: 3
3: 33
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173560860 Original CRISPR CTCCTTCTCTGTTCTCATCT AGG (reversed) Intronic
900757319 1:4445343-4445365 CTCCTTCTTTCTAGTCATCTTGG + Intergenic
901286211 1:8080860-8080882 CTCCTTCCCTGCTACCATCTGGG - Intergenic
903186055 1:21629605-21629627 TTCCTTCTCTGTCCCCATCCTGG - Intronic
903236982 1:21956582-21956604 CTCATTCTCTGTGCTCCCCTGGG + Intergenic
903310666 1:22452399-22452421 CCCCTTCTCTCTTCCCCTCTCGG + Intronic
904366481 1:30014083-30014105 CTCCTTCTCTGCTCCAGTCTTGG - Intergenic
905289247 1:36910383-36910405 CTCCCTGTCTGTTCTGATCAGGG + Intronic
905676596 1:39830249-39830271 CTCCTCCAGTGTTCTTATCTTGG + Intergenic
905773446 1:40653245-40653267 CTCACTCTCTGCTCTCTTCTGGG - Intronic
905958026 1:42015541-42015563 CTCCTCCTCTCTTCTCACCAAGG + Intronic
906209019 1:44002040-44002062 CTCCTTTTCTGGTCTGTTCTGGG + Intronic
907229871 1:52986670-52986692 CTCTGTCTGTTTTCTCATCTAGG + Intronic
907410554 1:54280490-54280512 CTCTTTCCATGTTCTTATCTGGG + Intronic
907436979 1:54456266-54456288 CTGCTTCCCTGTTCTGCTCTGGG - Intergenic
908792898 1:67801094-67801116 GTGCTTCTCTGTTCTGCTCTAGG - Intronic
909068278 1:70962657-70962679 TTCCTGTTCTGTTCTCATCATGG - Intronic
909304010 1:74049049-74049071 TTACTTATCTTTTCTCATCTAGG - Intronic
912165458 1:107038358-107038380 CTCCTCTTCTTTTCTCTTCTCGG - Intergenic
912961011 1:114196122-114196144 CTTCTTCTCCCTTTTCATCTTGG - Intergenic
913182026 1:116331358-116331380 CTCCTTCTGAGTCCTCCTCTGGG + Intergenic
913260420 1:116992598-116992620 TTCCTCCTATGTTCTCTTCTAGG - Intergenic
913589693 1:120311509-120311531 TTCCTTCTTTGTTCTCTTGTTGG + Intergenic
913618492 1:120586857-120586879 TTCCTTCTTTGTTCTCTTGTTGG - Intergenic
914571721 1:148923367-148923389 TTCCTTCTTTGTTCTCTTGTTGG + Intronic
914601113 1:149206895-149206917 TTCCTTCTTTGTTCTCTTGTTGG - Intergenic
915281342 1:154824360-154824382 GTCCTTCTCTGTGCTTATGTTGG - Intronic
915968033 1:160329413-160329435 CTCCCTCTCTTCTCTGATCTAGG + Intronic
916167295 1:161975593-161975615 TTCCTTCTGTGTTGTCTTCTTGG + Intergenic
917025336 1:170635847-170635869 CTCCTTATTTATTCTCATTTTGG - Intergenic
917263081 1:173190589-173190611 CCCCTTCTCTGTACTCTTCGTGG + Intronic
917520463 1:175743906-175743928 CTCCCTTTCTCTTCTTATCTGGG - Intergenic
920907611 1:210186647-210186669 ATGCTTCCCTGTTCTCATATTGG + Intergenic
921634386 1:217475814-217475836 AACCATCTCTGTTCTCTTCTGGG + Intronic
923503576 1:234586410-234586432 CTCCTTCTCTGCTGCCATCCTGG + Intergenic
923850093 1:237784855-237784877 CTCCTTCTCTCTTCAGATCCAGG - Exonic
924513405 1:244747103-244747125 CTCCTTCTCTCTTCTCCACTGGG + Intergenic
924812302 1:247414068-247414090 CTTCTTCTCTATTTTCTTCTAGG + Intergenic
1062923394 10:1296866-1296888 CTCCTTCTCTGCTCCCAGCCTGG + Intronic
1064383480 10:14868134-14868156 CTGCTTCTCTGTTGTGCTCTTGG + Intronic
1064969665 10:21051997-21052019 CCCCTTCTCTGCTCTCCTTTTGG - Intronic
1065432591 10:25674433-25674455 CTCCATCTCTGTGCTGTTCTAGG + Intergenic
1066153459 10:32650110-32650132 GTCCTGATTTGTTCTCATCTGGG + Intronic
1066192846 10:33071681-33071703 CTCCTTCCCTGGTCTCCTGTAGG + Intergenic
1066222675 10:33351019-33351041 CTCCTTCTCAGTTGGCATTTTGG + Intergenic
1067171420 10:43910060-43910082 CTCCTTGGCTGTCCTCATCCAGG + Intergenic
1068068727 10:52168445-52168467 CTCCTTCTCTCTTTTGTTCTAGG - Intronic
1068140277 10:52996862-52996884 CTTTTTCTCTCTTCTCCTCTGGG - Intergenic
1068455264 10:57247049-57247071 CTCCTTCTCTGCTCTCTGCCAGG - Intergenic
1069064179 10:63925421-63925443 CTCATTGCCTATTCTCATCTGGG + Intergenic
1069593486 10:69656079-69656101 CACCTTCCCAGTTCACATCTGGG + Intergenic
1069958859 10:72068017-72068039 CTCCTGCTCTGTGTTAATCTGGG + Intronic
1070724307 10:78777857-78777879 TGCCTTCTCTGTCCTCATCCTGG - Intergenic
1070852512 10:79578107-79578129 CATCTTCTCTGTTATCTTCTAGG - Intergenic
1074871588 10:117580820-117580842 CTCCTTTTCTTTTTTCCTCTTGG + Intergenic
1075704122 10:124488888-124488910 CTCCTTCTTTGCTCTAAACTTGG - Intronic
1075959351 10:126554851-126554873 TTCCTTCTCTGTTTTGATGTTGG - Intronic
1076829055 10:132985202-132985224 CTCCGGCTCTGGTCCCATCTCGG + Intergenic
1077646878 11:3932963-3932985 CTCCTTCTATGTTTTCTACTGGG - Intronic
1077662474 11:4082194-4082216 CTCCTTCTCTGCTTTCCTCAAGG - Exonic
1079425729 11:20340704-20340726 ATCCTTCTAAGTTCTCAGCTGGG - Intergenic
1080456162 11:32421321-32421343 CTGCTTATCTGATCTCCTCTGGG - Intronic
1080748741 11:35132824-35132846 CTGCTTCTCTGTCCTCATGGAGG + Intergenic
1080757998 11:35220476-35220498 CTCATTATCTGTTTTCTTCTTGG - Intronic
1081090827 11:38864289-38864311 CTTCTTCTCTCTTCTTGTCTTGG + Intergenic
1081180965 11:39985186-39985208 CTTCTTCTCTGAACTCATCAAGG - Intergenic
1081293646 11:41358297-41358319 TTTCTTCTCTGTTATCTTCTAGG - Intronic
1082852701 11:57779585-57779607 CTTCTTCTCTGTTCTTATGCTGG + Intronic
1084517250 11:69643613-69643635 CGCCTTTTCTGTTTTGATCTGGG + Intronic
1084581098 11:70024038-70024060 CTCCATCTCTCTCCTCCTCTTGG + Intergenic
1085849078 11:80098918-80098940 TACATTCTCTTTTCTCATCTAGG + Intergenic
1086195686 11:84136069-84136091 CTCCTTTTATATTCTCACCTTGG - Intronic
1087814741 11:102646333-102646355 TTTCTTCTATGTTCTCATCTAGG + Intergenic
1087949228 11:104199714-104199736 CTCTTTCTCTCATCTCTTCTTGG + Intergenic
1089737363 11:120559057-120559079 AGCCTTCTCTGTTCTCAGCTGGG + Intronic
1089943911 11:122447525-122447547 CTGCTTCTCAGTTCACATGTTGG + Intergenic
1089998336 11:122930049-122930071 CTCTTTCTCAGTTCACAGCTGGG - Intronic
1090408435 11:126491461-126491483 CTGGTTCTCTGCTCCCATCTGGG + Intronic
1090438966 11:126710612-126710634 CCCCTTCTCTGTCCTCAGCTGGG + Intronic
1090493681 11:127189192-127189214 CAACTACCCTGTTCTCATCTTGG - Intergenic
1091050176 11:132360712-132360734 CTTGTTTTCTGTTTTCATCTTGG - Intergenic
1092993556 12:13926546-13926568 ATCCTTCTCAGCTCTCATCCAGG - Intronic
1094044447 12:26151935-26151957 CTCCTTCTCTCTTTCAATCTAGG - Intronic
1095779746 12:46046588-46046610 CTCTTTCTCTTCTCTCCTCTGGG - Intergenic
1096155227 12:49337834-49337856 CTCCTTCTCTGCTTTCTTGTCGG - Intergenic
1096805139 12:54136024-54136046 CTCCTTTCCTGTTCACAGCTGGG + Intergenic
1098196788 12:68010711-68010733 CTCCTTCTGTGTTCTTGCCTTGG + Intergenic
1098346658 12:69512151-69512173 CTCCCTCCCTGTTCTCTTTTGGG + Intronic
1098420328 12:70289843-70289865 CTCATTATCTGTTCTCTTTTAGG + Intronic
1098506034 12:71251611-71251633 CACCATCTCTGTTCTCCCCTGGG - Intronic
1098614247 12:72503773-72503795 CTCCTTCTCTGAGCTCATTAGGG - Intronic
1099198273 12:79645597-79645619 ATGCTCCTCTGTTCTCATCTGGG + Intronic
1100388489 12:94126028-94126050 CTCCTTCACCCTTCTCATTTAGG + Intergenic
1100868411 12:98884466-98884488 CTCCCTAGCTGGTCTCATCTAGG + Intronic
1101649538 12:106662656-106662678 TTCCTTCTATGTTGTCTTCTAGG + Intronic
1102940164 12:116933933-116933955 CTCCATCTCTCTTTTAATCTAGG + Intronic
1103382339 12:120504136-120504158 GTCCTTCTTTCTTCTTATCTAGG - Intronic
1103538692 12:121651422-121651444 TTCATTCTCTGATCTCATCCTGG - Exonic
1103890119 12:124232289-124232311 CTCCTTCCCTGGGATCATCTGGG + Intronic
1104477206 12:129080795-129080817 CTCTTGCTTTGTTCTCAGCTGGG + Intronic
1106795994 13:33206439-33206461 CTCCTTTTCTGTTTTCTCCTTGG - Intronic
1106898386 13:34329841-34329863 CTCCTTCTCTTCCTTCATCTGGG - Intergenic
1106997201 13:35499462-35499484 CAGCTGCTCTGTTCTCATGTGGG + Intronic
1107170342 13:37334064-37334086 CTTCTTTTCTATTCACATCTGGG + Intergenic
1108045514 13:46380369-46380391 CTCCATTTCAGTTCTCAACTTGG - Intronic
1108275810 13:48808322-48808344 CTTGTTCTATGTTCTCTTCTAGG - Intergenic
1109397046 13:61773612-61773634 CTCATTCTCAGTTTTCATCCTGG - Intergenic
1109588096 13:64436694-64436716 TTCTCTCTCTGTTCTCATCAAGG + Intergenic
1109796433 13:67319711-67319733 CTTAATCTCTTTTCTCATCTTGG + Intergenic
1111348643 13:86996980-86997002 CTTCATCTGTGCTCTCATCTTGG - Intergenic
1112115035 13:96342980-96343002 CTGCTTCTCTGTTCTCTTAAAGG + Intronic
1113385619 13:109845076-109845098 TTCCTCCTCTGTGCTCACCTGGG - Intergenic
1113745498 13:112741606-112741628 CTCCGTCCCTGTGCTGATCTGGG + Intronic
1114237666 14:20836433-20836455 CCCCTGCTCTGTTCTCATTTTGG - Intergenic
1114298439 14:21351810-21351832 CCTCTTCTCTTTTCTCATCAGGG + Exonic
1114311814 14:21474564-21474586 CTCTTTCTCCCTTCCCATCTTGG - Intronic
1114829866 14:26127792-26127814 CCCCTTCTGAGTTCTCAGCTGGG + Intergenic
1115853649 14:37606803-37606825 CTCCTTCCCTGTCACCATCTTGG + Intronic
1117454839 14:55886631-55886653 GTCCTTGTCATTTCTCATCTAGG + Intergenic
1117473115 14:56066790-56066812 CTCCTTGCTTGTTCTCTTCTTGG - Intergenic
1119181008 14:72605266-72605288 CTCCCTCTCTGCTGGCATCTGGG - Intergenic
1119551508 14:75517257-75517279 CTCCATCTTTGTTCTACTCTTGG - Intergenic
1119601105 14:75978006-75978028 CTTCCTCTCTGCTCTCACCTTGG + Intronic
1119723419 14:76907023-76907045 CACCTTCTCTGTGCATATCTAGG - Intergenic
1119863658 14:77955492-77955514 ATCCTTCTATGTTCTCTTTTTGG + Intergenic
1120282551 14:82457378-82457400 CTCCTTTCCTGTTCACTTCTAGG - Intergenic
1120808082 14:88774760-88774782 CTCCTTCAGTGGTCTCATCTAGG + Intronic
1120925474 14:89793335-89793357 CTCCTTTCCTGTTCTCCTCTCGG + Intergenic
1121276850 14:92674160-92674182 CTCCTTCCCTCCTCTCACCTCGG - Intronic
1125839861 15:42790178-42790200 TTCCTCCTATGTTCTCTTCTAGG - Intronic
1126057620 15:44745930-44745952 CCCCTTCTCTCCTCTCTTCTGGG - Intronic
1126573977 15:50180303-50180325 CACCTCCTCTGTTCTCATTCAGG - Intronic
1127031123 15:54864304-54864326 CTCATTTTCTGTTTTCTTCTTGG + Intergenic
1127561208 15:60138171-60138193 CTTCTTCTTTGTTCTTCTCTGGG - Intergenic
1127599334 15:60519520-60519542 CTCCTTAGTTGTTCTCATATGGG + Intronic
1128322837 15:66704823-66704845 CCCCTTCTTTGTTCTCCTCTTGG + Intronic
1128381529 15:67116686-67116708 CTCCTTCACTGTGCCCATTTAGG - Intronic
1129363399 15:75039122-75039144 CTCCTTGGCTGTTCTTATTTGGG + Intronic
1129551900 15:76460611-76460633 CTCATTCTCTCTTCTCCTTTTGG + Intronic
1130192994 15:81754172-81754194 CTCTTTCTCGTTTCTCCTCTTGG + Intergenic
1130533021 15:84761993-84762015 CTTCTTCACTGATCTCATCTTGG - Intronic
1130918761 15:88326517-88326539 ATCCATCTCAGTACTCATCTGGG - Intergenic
1131421901 15:92313398-92313420 TTCCTTTTCTTTCCTCATCTTGG - Intergenic
1131659043 15:94494329-94494351 CTCCCTCTCTGTTTTCCTATGGG - Intergenic
1132140762 15:99392027-99392049 CTCTTTCTCTCCTCTCGTCTGGG - Intergenic
1132781557 16:1629247-1629269 CCCCTTCTCTGTCCCCACCTAGG + Intronic
1133620888 16:7525425-7525447 CTCCATCTCTGTTTGCCTCTGGG + Intronic
1135133617 16:19872104-19872126 CTTCCTCTCTGTGCTCATCTGGG - Exonic
1135180798 16:20272572-20272594 CTTGCTCTCTGTTCTCATGTGGG - Intergenic
1140571495 16:76111807-76111829 CTACTTCTCTGTTCTTCACTTGG + Intergenic
1140663270 16:77207890-77207912 CTGCTTCCTTCTTCTCATCTGGG + Intronic
1141154631 16:81588613-81588635 CTCGTTCTCTGTTATCTGCTTGG + Intronic
1142438063 16:90075871-90075893 CTCCTTCTGGGCTCTCCTCTTGG + Exonic
1142479400 17:209034-209056 CACCTCCTCTGTCCTCATCTGGG + Intergenic
1143838870 17:9714765-9714787 CTCCTTCTCCGTTCTTTTCTTGG - Intronic
1144804320 17:17954186-17954208 CTCCTTTTCTGTGCTCAGCATGG - Intronic
1145841373 17:27997999-27998021 CCCCTTCTCTTTCCTCACCTCGG + Intergenic
1146623793 17:34420680-34420702 CTCCTTGTGTGTTCTCATCTAGG + Intergenic
1147267399 17:39243190-39243212 CTCCATCTCAGTTCACACCTCGG + Intergenic
1147702999 17:42407597-42407619 CTCCACCTCTTCTCTCATCTGGG + Intronic
1148616281 17:49002872-49002894 ATCCTTAACTGTTCTCATTTGGG + Intronic
1149182228 17:53952907-53952929 CTCCTTTTCTTTGCTCTTCTTGG - Intergenic
1151512152 17:74567411-74567433 TTCCTTCTCTGGCCTCTTCTGGG + Intergenic
1152009310 17:77701218-77701240 CTCCTAATCTGTTCCCTTCTTGG + Intergenic
1152771561 17:82172738-82172760 CTCCATTTCTTTCCTCATCTGGG + Exonic
1152787620 17:82257731-82257753 CTCCTCCTCAGCTCTCTTCTGGG - Intronic
1155104914 18:22654243-22654265 ATGCTTCTCTGGTCTCATCTAGG - Intergenic
1156486206 18:37467287-37467309 CACTTTCTCTGCTCTCACCTGGG + Intronic
1156520078 18:37714618-37714640 CTCCTTTTCTGTTCTGAACCTGG + Intergenic
1156524354 18:37752487-37752509 CTCCTTCTTTGTAATCATGTAGG - Intergenic
1156570816 18:38250846-38250868 GTCATTTTCTGTTCTCATCCAGG - Intergenic
1156682174 18:39604127-39604149 CTCCTTGTTTATTCTCTTCTGGG + Intergenic
1157197439 18:45630948-45630970 CTCCTGCTCTCCTCTTATCTAGG + Intronic
1157405061 18:47415850-47415872 CTCCCTCCCAGTTCTCCTCTGGG - Intergenic
1157967639 18:52226172-52226194 TTCAGTCTATGTTCTCATCTGGG + Intergenic
1158741357 18:60146081-60146103 TCCCTCCTCTGTTCTCAGCTGGG + Intergenic
1158888227 18:61848988-61849010 CCCCTTCCCTGTTCTCCCCTGGG - Intronic
1158907104 18:62024374-62024396 CCCCTTCCCTGTTCTCATGAGGG + Intergenic
1159640949 18:70862296-70862318 CTCCTTCCCTTTTCTCCACTAGG - Intergenic
1162351047 19:10149737-10149759 GTCCTTTTCAGTTTTCATCTAGG + Intronic
1163598662 19:18234857-18234879 CTCCCTCTCTGTTCTATGCTTGG + Intronic
1163813478 19:19449109-19449131 CTCCCTCTCTGGTGTCATCTGGG - Intronic
1164436523 19:28235282-28235304 CTCCTCCTCTGTTCACTTTTGGG - Intergenic
1164501809 19:28826704-28826726 CTCCCTGTCTGTTCTCATCCTGG - Intergenic
1165223481 19:34337274-34337296 CCCCTTCTCTATTCTCAAGTTGG - Intronic
1165906179 19:39196281-39196303 TTCCTTCTCTGTCCTCACCTGGG - Intergenic
1166297968 19:41897864-41897886 CTTCGTCTCTGTTCTTGTCTTGG + Intronic
1166588763 19:43975852-43975874 CTCATCCTCTGTTCTCAAGTCGG + Intronic
1167504718 19:49865225-49865247 CAGCATCTCTCTTCTCATCTTGG + Exonic
1167719194 19:51167203-51167225 CTCCTTCTCTGCTCCCCTCTGGG + Intergenic
1167921818 19:52788357-52788379 CTCCTTTTCTTTGCTCCTCTTGG + Intronic
1167942091 19:52956048-52956070 CTCCTTTTCTTTGCTCTTCTTGG + Exonic
1167944981 19:52980912-52980934 CTCCTTTTCTTTGCTCTTCTTGG + Intergenic
925292595 2:2757554-2757576 CTACTTCTGTGTGCTCCTCTCGG + Intergenic
926217886 2:10916189-10916211 CGCCTTCTCTGCACTCACCTGGG + Intergenic
926286790 2:11494986-11495008 CTCCTGCTCTGTTCCCATGGTGG + Intergenic
927340459 2:21978009-21978031 CTCCTTCTCTTTTCCCTCCTGGG + Intergenic
928160826 2:28922688-28922710 CTCCTTGACTGTTCTCTTCTTGG + Intronic
928177943 2:29047711-29047733 CACCTTCTCTGATCACGTCTTGG - Intronic
928284818 2:29980702-29980724 CTCTTTCTCTGTTGTCCTATAGG + Intergenic
928285499 2:29986718-29986740 CACCTTCCCTGTGTTCATCTTGG - Intergenic
928620756 2:33085379-33085401 CACCTTCTCTGGACACATCTGGG + Intronic
929286024 2:40136078-40136100 CTCCATCCTTCTTCTCATCTTGG - Intronic
929949175 2:46393296-46393318 CTCCATCTCTGTCCTGATCTTGG + Intergenic
931064080 2:58564841-58564863 CTCCTTTTTTGTTGTCATCGAGG + Intergenic
931864829 2:66398213-66398235 CTCATTTTTTCTTCTCATCTGGG - Intergenic
931923852 2:67049545-67049567 CTTCTTCTGTGTTTTCTTCTAGG - Intergenic
932311548 2:70746509-70746531 CTCCTACTGTTTCCTCATCTTGG - Intronic
932892586 2:75609816-75609838 ATCCTTCTATGTTCTCAAGTAGG - Intergenic
933849191 2:86352135-86352157 CCCCTGCTCTGTTCTCTCCTTGG + Intergenic
934710730 2:96512380-96512402 CTCCTTCTCTATTGTAATATTGG - Intergenic
935625380 2:105168350-105168372 CTCGGTCTCTTTTCTCATGTGGG - Intergenic
935688437 2:105708466-105708488 CTCCATCACTGTCTTCATCTGGG + Intergenic
936030757 2:109068364-109068386 CCTCTTCTCTGTTGCCATCTGGG - Intergenic
936228609 2:110680179-110680201 CTCCCTCCCTGTTGTCTTCTGGG + Intergenic
936657985 2:114510237-114510259 TTCCTTTTCTTTTCTCAACTTGG + Intronic
936726776 2:115328960-115328982 CTGCTTCTCTGTTCTCAAAAGGG - Intronic
937776502 2:125783115-125783137 CTCATTTTCTGACCTCATCTTGG + Intergenic
939576302 2:143899588-143899610 CTCATTTTCTGTTCTCATCCAGG - Intergenic
939612193 2:144325116-144325138 TTCCTTCTCTGTCCTCCTTTGGG - Intronic
939931012 2:148232884-148232906 CTCCTTCTCTTTTCTCAAAGAGG + Intronic
940471102 2:154101675-154101697 CTCCTTGTCTTTTCTTAGCTTGG + Intronic
940708766 2:157136395-157136417 CTTCTTCTCCGGTCTGATCTAGG - Intergenic
942304442 2:174592042-174592064 CTTCTTCAATGTGCTCATCTAGG + Intronic
943763609 2:191636349-191636371 TTCCTTCTCTGTGCTCCCCTAGG - Intergenic
943776509 2:191772519-191772541 GTCTTTCTTTGTTCTCATTTAGG - Intergenic
943788641 2:191907411-191907433 CTCCTTCTCTTCTCTCATCTGGG + Intergenic
944865022 2:203851534-203851556 CTCATTCTCAGCTATCATCTCGG - Intergenic
945158996 2:206869579-206869601 CTACTTCTCTGTTCTAAGCAGGG - Intergenic
945417892 2:209597865-209597887 CTCATCCTCTGTTCTGATTTAGG + Intronic
947037790 2:225879171-225879193 CTCCTTCTCTGTCCTACGCTAGG + Intergenic
947708890 2:232298553-232298575 CTGCTTTTGTGTTTTCATCTGGG + Intronic
947992926 2:234500989-234501011 TCCCTTCTCTGGTCTCAGCTGGG - Intergenic
948835544 2:240624421-240624443 GTCCTTCTCTGCTGTCATCCCGG - Intronic
948975528 2:241461343-241461365 CTCCTGGTCTGCTCTCATCCTGG + Intronic
949005216 2:241642331-241642353 CTCTTTCTCTGTTTTCATTCAGG + Intronic
949024875 2:241762582-241762604 CCCTTCCTCTGTTCTCCTCTTGG + Intronic
1168782226 20:502855-502877 CTCCTCCTCTTTTCTTATCTTGG + Intronic
1168820438 20:769306-769328 CTCTTTCTCTGTTCTAGACTCGG + Intergenic
1168973619 20:1947704-1947726 CTGCTTCTCTGTGCTTACCTGGG - Intergenic
1170085144 20:12523164-12523186 CTGCTTCATTCTTCTCATCTGGG - Intergenic
1170211114 20:13847084-13847106 TCCCCTCTCTGTTCTCATCCTGG + Intergenic
1170924994 20:20714132-20714154 GTCCTGATCTGTTATCATCTGGG - Intergenic
1172314013 20:33939521-33939543 CTCCCTTGCTGTTCTCATCATGG + Intergenic
1173560860 20:44004394-44004416 CTCCTTCTCTGTTCTCATCTAGG - Intronic
1173764624 20:45596226-45596248 CTGCTGATCTGTTCTCCTCTTGG + Intergenic
1173861627 20:46287617-46287639 CTGCTTCTCCTGTCTCATCTCGG - Intronic
1174395324 20:50243440-50243462 CTGCTTCCCTTTTCTCAGCTGGG - Intergenic
1174730173 20:52908382-52908404 TTACCTCTGTGTTCTCATCTAGG - Intergenic
1175355133 20:58359578-58359600 TCCCTTCCCTTTTCTCATCTTGG + Intronic
1175458709 20:59134706-59134728 CAACCTCTCTGTGCTCATCTGGG + Intergenic
1176126080 20:63475452-63475474 CCCCTTCTCTGGTCTCCTCCAGG + Intergenic
1177044691 21:16154883-16154905 CTCCTTTTCTTTTCTCACCCTGG - Intergenic
1177232102 21:18335153-18335175 CTCCTTCACTGGTCTCATTAAGG - Intronic
1177680412 21:24361077-24361099 CTCACTCTCTGTTCTCAAGTAGG + Intergenic
1177899299 21:26894052-26894074 CAGCTTCTCTGTTGCCATCTGGG - Intergenic
1178807065 21:35848015-35848037 CTCCTTCTCATTTCTCTTATAGG + Intronic
1179566671 21:42253278-42253300 CTGCTTCTCTGATCTGCTCTGGG - Intronic
1179914871 21:44470160-44470182 TGTCTTCTCTGTTCTCATCCTGG - Intergenic
1180086259 21:45509279-45509301 CTCCATCTGTGTCCTCCTCTGGG - Intronic
1180699955 22:17775876-17775898 GTCCCTCTCTTTTCCCATCTGGG - Intergenic
1181743201 22:24937792-24937814 CATCTTCTCAGTTCTCAGCTGGG + Intronic
1181877573 22:25951973-25951995 CTCCTTCCCTGCTCTGATCAAGG - Intronic
1182035841 22:27197649-27197671 CCCCTTCTCTCTTTTTATCTTGG + Intergenic
1182329649 22:29542052-29542074 CTCCTTCTCATCTCTCAGCTTGG + Intronic
1182632933 22:31701628-31701650 CTCCTTCTCTGTTACAAGCTAGG - Intronic
1182873730 22:33672169-33672191 CTCCTCTTCTGTGCTTATCTGGG - Intronic
1183733974 22:39633458-39633480 ATCCTTCTCTCTTCTGCTCTGGG - Intronic
1183736129 22:39645907-39645929 CAGCTTCTCTTTTCTCATCTGGG + Intronic
1184177705 22:42798773-42798795 ATACTTCTCTGTTCCAATCTAGG + Intronic
1184725372 22:46341959-46341981 TTTCTCCTCTGTTCTCATCACGG + Intronic
1185148142 22:49150266-49150288 CTCCTGCTCTGTTCACTCCTGGG + Intergenic
1185264499 22:49893214-49893236 CCCCTTCTCTCTCCTCTTCTGGG - Intergenic
949707966 3:6840616-6840638 ACCCTTCTCGGTTCTCTTCTGGG + Intronic
950355097 3:12401177-12401199 CTCCTTCGCTTTCCTCCTCTTGG + Intronic
950797021 3:15518543-15518565 CTCCTTCCTGGTTCTCCTCTGGG + Intronic
950841860 3:15975518-15975540 CTCCTGCTCAGTTTTCATTTGGG - Intergenic
951371391 3:21854174-21854196 CTATTTTTCTATTCTCATCTTGG + Intronic
953033579 3:39193029-39193051 CTCCTCCTCTGTTCTGAGCCTGG + Intergenic
953771090 3:45779180-45779202 CTCCTCCACTGTTCCCAACTGGG + Intronic
954368312 3:50157408-50157430 CTCCTTCTCTGCTTTCTTCCTGG + Intronic
955634587 3:61013659-61013681 CTCCTTCTCTGATATCATGATGG - Intronic
955849245 3:63202409-63202431 CCCCTTCTCTTCTCCCATCTGGG - Intergenic
956204053 3:66737985-66738007 CACCTCATCTGTTCCCATCTTGG - Intergenic
956907171 3:73778304-73778326 CTTCTCCTCTGGTCTCATCTTGG + Intergenic
957136895 3:76299724-76299746 CTCCTTCACTGTTCTCACCCTGG - Intronic
960208270 3:114929454-114929476 CTCTTGCTGTGTTGTCATCTTGG - Intronic
960607964 3:119527811-119527833 CTCCTTCTCTCTCTGCATCTTGG + Exonic
960620981 3:119636451-119636473 CTGTTTCTCTGTTCTCATGGTGG - Intronic
960946112 3:122967828-122967850 CTCCTTCTCAGTCCTCCTCTGGG - Intronic
962933238 3:140056597-140056619 CTCTTTCTCAGTTCCTATCTGGG - Intronic
963332137 3:143926432-143926454 CTACTTTCCTGTTCTCATCTTGG - Intergenic
963427499 3:145150694-145150716 CTGCTTCTCTTTTATCTTCTCGG + Intergenic
963735197 3:149010970-149010992 TTCCTTTTCTGTTCTTTTCTGGG + Intronic
963859015 3:150287633-150287655 CTCTTTCTCTTTTCCCCTCTTGG + Intergenic
963983698 3:151568017-151568039 CTCTCTCTCTGTTTTCTTCTGGG + Intergenic
964001114 3:151773005-151773027 CTCCTTTTCACTTCTCATCCAGG + Intergenic
964247588 3:154671227-154671249 CTTCTTTCCTGCTCTCATCTTGG - Intergenic
965494002 3:169375442-169375464 ATTCTTCTCTCTTCTCTTCTTGG - Intronic
967267330 3:187702163-187702185 CTCTTTCTGTGTTCTCACCAGGG - Exonic
968292265 3:197547844-197547866 CTCCTGCTCTGCCCTCATCCTGG + Intronic
968943091 4:3649322-3649344 CTCCTTCCCTGTGTTCATCCTGG + Intergenic
969339833 4:6533209-6533231 CTCCTGCCATGTTCTCTTCTGGG - Intronic
969434819 4:7182778-7182800 GTCCTTCTCTGTTTTCTTCCTGG + Intergenic
970423135 4:15923686-15923708 CTCCTTCTCATCTCTCACCTGGG + Intergenic
970872177 4:20828654-20828676 CTCATTCTCTGTTATTCTCTTGG + Intronic
970892198 4:21059525-21059547 CTCCTTCTCTGGTGTGGTCTCGG - Intronic
971161788 4:24140880-24140902 CTCCATCTTTGTTCTCTTTTGGG - Intergenic
971615643 4:28787895-28787917 CTCAATCTCTGTTCTCCTTTGGG + Intergenic
972211100 4:36838552-36838574 CTTCATATTTGTTCTCATCTAGG - Intergenic
973840869 4:54859233-54859255 CTTCTTCTGTGTTCTAATCAAGG - Intergenic
973990066 4:56396395-56396417 TTCCTTCTCTGATCTCACCTTGG + Intronic
975432589 4:74312180-74312202 GTCCTTCTATGTTGTCAGCTAGG - Exonic
976201455 4:82583340-82583362 TTCCTTCTTTGTTTTAATCTAGG + Intergenic
976822056 4:89217519-89217541 CACCTTCTCTGTTTTCATGTTGG + Intergenic
977018842 4:91733359-91733381 CCCTTTCTCTGTTCTCCTGTTGG - Intergenic
977800964 4:101230918-101230940 CTCCTTTTCCCTCCTCATCTAGG + Intronic
978099948 4:104826257-104826279 TTCTTTCTTTGTTCTCAGCTAGG + Intergenic
978412807 4:108443727-108443749 CTCCTTCCCTCCTCTCATCTTGG + Intergenic
978599795 4:110415917-110415939 CTCCTTTTCTTTGCTCTTCTTGG - Intronic
979098758 4:116587949-116587971 CTTCTTCTCTATTTTCTTCTTGG + Intergenic
979131075 4:117045445-117045467 TTTCTTCTCTGTTTTCTTCTTGG + Intergenic
980027951 4:127788844-127788866 ATCCTGCTCTGTACACATCTTGG + Intronic
981120358 4:141043337-141043359 ACCCTTCTGTGTTGTCATCTAGG - Intronic
982096038 4:151924347-151924369 CTCATTCTTTATTCTCATCCAGG - Intergenic
983437026 4:167729451-167729473 CTCCTTCTCTCTTTTTTTCTAGG + Intergenic
985249987 4:188014082-188014104 TTCATTCTCTATTCCCATCTTGG - Intergenic
986061183 5:4192636-4192658 TTCCTTCTCTTTTCACTTCTTGG - Intergenic
986510406 5:8500392-8500414 CTTCTTCTGTGGTCTCTTCTTGG - Intergenic
990063287 5:51679499-51679521 CTCCTCCTATGTTCCTATCTTGG - Intergenic
990086776 5:51988073-51988095 CAGCTTCGCTGTTCTTATCTTGG - Intergenic
991470263 5:66960959-66960981 CTCCTTCTATCCTCTTATCTTGG + Intronic
992929105 5:81622776-81622798 CTCTCTCTCTCTTCTCAGCTAGG + Intronic
993088344 5:83392695-83392717 ATCCTTCCCTGCTCTCATCCTGG - Intergenic
993375659 5:87147160-87147182 CTCCAGTTCTGCTCTCATCTTGG + Intergenic
996168396 5:120256265-120256287 CTCCCTCTCTTTTCTCTTGTTGG + Intergenic
996342554 5:122454616-122454638 GCCCTTCTCTGTCCCCATCTTGG + Intronic
997827740 5:137122798-137122820 CAGCTTCGCTGTTCTAATCTTGG + Intronic
999261979 5:150244065-150244087 ATCATTCTCCCTTCTCATCTTGG - Intronic
1000460499 5:161511182-161511204 CTCCTTCTCTCTTTTGATGTAGG - Intronic
1000822717 5:166004585-166004607 ATCCTTCTATGTTCTGATATTGG + Intergenic
1000944672 5:167406218-167406240 CACCTTGTCAGTTCTCATCCGGG + Intronic
1001240386 5:170064654-170064676 CTCCCTCTCTCTTCTTATTTTGG - Intronic
1001598426 5:172913525-172913547 TTACTTCTCTGTCCTCATCGAGG + Intronic
1001997613 5:176174728-176174750 CTCCCTCCCTGTTGTCTTCTGGG + Intergenic
1002621140 5:180489270-180489292 CTTTTTCTCTGTACTAATCTTGG + Intergenic
1002672473 5:180879324-180879346 TTCCCTCTGTGTTCTCTTCTAGG + Intergenic
1003259539 6:4504803-4504825 TTCTTTCTCTGCTCCCATCTAGG + Intergenic
1003772326 6:9319267-9319289 CTTCTTCCATGTTCACATCTGGG - Intergenic
1004084358 6:12430099-12430121 TTCCTTGCCTGTTTTCATCTAGG + Intergenic
1004577636 6:16912870-16912892 TTCCTTCTTTCTTCTCCTCTGGG - Intergenic
1004972164 6:20922698-20922720 CTATGTCTCTGTTCTCATCCCGG - Intronic
1005355647 6:24980836-24980858 CACCTTCTCTGCTCCCATCCTGG - Intronic
1005594924 6:27369710-27369732 CTCCTTCTCTGAACTCCTATGGG + Intergenic
1005861997 6:29908749-29908771 CTCCTACTCTGCTCTCAACCTGG + Intergenic
1006297022 6:33174217-33174239 CCCCTTCTCCGTTCTCACCAGGG - Exonic
1007354492 6:41302796-41302818 CCCCTTTGCTGTTCTCATGTTGG + Intergenic
1009923429 6:70091708-70091730 CTTTTTCTCTGTTCACCTCTAGG - Intronic
1011138027 6:84120461-84120483 CATCTTCTGTGTTCTCATCCTGG + Intergenic
1011247109 6:85331228-85331250 CTGCTTCTTTGTTCTCCTCTGGG - Intergenic
1011476720 6:87755876-87755898 CTCCTTCTGTGCTCTTATCCTGG + Intergenic
1011556861 6:88579259-88579281 CTCTCTTTCTGTCCTCATCTGGG + Intergenic
1012355704 6:98311305-98311327 CTCCTTCTCTGATCCAGTCTGGG - Intergenic
1012865036 6:104608920-104608942 CACCTTCACTCTTCTCAACTTGG + Intergenic
1013483241 6:110570029-110570051 TTCATTCTCTGTTCTTAGCTGGG - Intergenic
1013630119 6:111978496-111978518 TTCTTTCTCTGTTCTACTCTAGG - Intergenic
1014787351 6:125634073-125634095 CTCCTTTCCTGTTGTCCTCTTGG + Intergenic
1015006510 6:128288185-128288207 CTCGTTGGCTGTTCTCATTTTGG + Intronic
1015444959 6:133293063-133293085 CTCTTTCTCTGATCCCCTCTTGG + Intronic
1017318953 6:153066237-153066259 CTCCTCATCTGTTCTGATTTTGG - Intronic
1017498352 6:155001232-155001254 CTCCTTCTAGGTTGTCATATGGG - Intronic
1018362642 6:163087414-163087436 CACCTTCTCTCTTTTCATCCTGG - Intronic
1019701840 7:2477914-2477936 TTCCCTCTCTGTGCTCTTCTGGG - Intergenic
1021006256 7:15397634-15397656 CTCTTTCTTTTTTCTAATCTGGG + Intronic
1021093035 7:16505188-16505210 CTCCTTTTCTCTTCTGCTCTAGG - Intronic
1023076395 7:36486578-36486600 GTCCTTCTCTGTTCTCCTTTGGG + Intergenic
1024219558 7:47277313-47277335 CTTCTTCTCATTTCTCCTCTCGG + Exonic
1024828136 7:53416666-53416688 CTCCTCCTCTGACCTCTTCTAGG + Intergenic
1026078527 7:67195984-67196006 CTCATTATATGTTCTCCTCTAGG + Intronic
1026472744 7:70708198-70708220 CTCATTCTCTGTTCATAGCTGGG + Intronic
1026484040 7:70802291-70802313 CTCCTTCTGTGGTATCAACTGGG - Intergenic
1026698294 7:72616002-72616024 CTCATTATATGTTCTCCTCTAGG - Intronic
1027153619 7:75750815-75750837 CCCCTTCTCTCTTCTAATCGAGG - Intergenic
1027346453 7:77264573-77264595 CTCTTTCTGTGTCCTCATTTTGG + Intronic
1027450501 7:78326048-78326070 TTCCTTCTCTGTTGTCTCCTAGG + Intronic
1030397485 7:109005522-109005544 CTCCTTTGCTATTCTCTTCTTGG - Intergenic
1031049555 7:116931331-116931353 CTCCTGCTTCCTTCTCATCTTGG - Intergenic
1031934403 7:127721396-127721418 CTGCTTCCCTATTCTCACCTGGG - Exonic
1032299764 7:130675924-130675946 ATCCTCCTCTGGTCTCAACTAGG + Intronic
1033203142 7:139392028-139392050 CACCTTCTCTTTTCTCCACTTGG + Intronic
1033225927 7:139562388-139562410 CCTCTTCCCTGTTCTCATTTTGG + Exonic
1033509719 7:142047815-142047837 TTGCTTCTTTGTTCTCATCTAGG - Exonic
1033512560 7:142074115-142074137 TTGCTTCTTTGTTTTCATCTAGG - Intronic
1033727189 7:144131538-144131560 TTCCTTCTATGTTCTCTTCCAGG - Intergenic
1034190459 7:149209449-149209471 CTCCTTCCCTGTCTTCATCAAGG + Intronic
1034694533 7:153042101-153042123 CACCTGCTCTGTGATCATCTTGG - Intergenic
1035304137 7:157919443-157919465 GTCCTTCTCTCTTATCATCATGG - Intronic
1035713779 8:1738540-1738562 CCCATTCTCTCTTCTCTTCTGGG - Intergenic
1035768989 8:2131522-2131544 CTCCTTCTCTTTTTGTATCTAGG - Intronic
1035966058 8:4193414-4193436 TTGCTTCTCTGTTCACATCCAGG + Intronic
1036002279 8:4620495-4620517 TTCCTTGTCTTTTATCATCTTGG - Intronic
1037346846 8:17909982-17910004 TTCTTTATCTGTTCTCATGTCGG + Exonic
1037771177 8:21800999-21801021 CTCCTTCCCTGTTCTCCTTAGGG - Intronic
1038756347 8:30344484-30344506 TTCCTTCTATGTTATCTTCTAGG + Intergenic
1039848541 8:41343229-41343251 TTCCTTCCCTGCTCTCATGTGGG + Intergenic
1040343422 8:46458959-46458981 CTTCTTTTCTGTTTTTATCTTGG + Intergenic
1040652389 8:49464274-49464296 CTCCCTCTCTCTTCTGAGCTGGG - Intergenic
1041647471 8:60268053-60268075 CTCTTTCTCTTTTTTCATTTTGG - Intronic
1042875496 8:73437331-73437353 CTCTATCTCTGTCCTCAGCTGGG - Intronic
1045348543 8:101316847-101316869 CTCCTTCACTGGTCTCCTCCAGG + Intergenic
1045499394 8:102733402-102733424 CTGCTTGGCTGTTTTCATCTGGG - Intergenic
1045500817 8:102743118-102743140 CTCCTTCTTTGTTCTCAACTTGG - Intergenic
1045778757 8:105838733-105838755 TTCCTTCTCCTTGCTCATCTTGG - Intergenic
1047549612 8:125855883-125855905 CTCCTTTTCAGATCTCAGCTTGG - Intergenic
1049388023 8:142354043-142354065 CTCCTGCTCTGCTGTCAGCTTGG - Intronic
1049840623 8:144768892-144768914 CTGCTTCCCTCTTCTCACCTGGG - Intergenic
1049961564 9:742495-742517 ATCCTCCTCTATTCTCCTCTGGG + Intronic
1050693570 9:8255486-8255508 TTCCTTCTTTGTTCTCTTTTTGG + Intergenic
1050950620 9:11587097-11587119 CACCTCCTCTGTGCTCATGTTGG - Intergenic
1051065024 9:13092751-13092773 GTCCTTCTATGTTCTCAGCTGGG + Intergenic
1053479531 9:38405756-38405778 CTCTGTCTCTGTTGTCAGCTGGG - Intergenic
1054725434 9:68645515-68645537 CCCCTTCTCTCCTCTCAGCTGGG + Intergenic
1054807795 9:69410128-69410150 TTCCTTCTCTGGGCTCATCCTGG - Intergenic
1054970601 9:71081052-71081074 GTCCCTCTCAGCTCTCATCTTGG + Intronic
1055884046 9:81038154-81038176 CTCAGTCCCTGTTCTCTTCTGGG - Intergenic
1058131696 9:101260793-101260815 TTCTTTCTATGTTCTCTTCTAGG - Intronic
1058730339 9:107844067-107844089 CTCCTTCTGTGTTCCCAACTGGG + Intergenic
1059450734 9:114370224-114370246 ATCCAGCTTTGTTCTCATCTGGG - Intronic
1060254968 9:122019409-122019431 CTCCTTCTCAAATCTCATCTGGG + Intronic
1060873899 9:127066161-127066183 CTGGTTCTCTGGTCTCAGCTGGG - Intronic
1061028417 9:128065513-128065535 CTCCCTGTCTGTCATCATCTGGG + Intronic
1061423610 9:130485527-130485549 CTGCTTTTCTGTCCTCAGCTCGG - Intronic
1186105909 X:6205498-6205520 TGCCTTCTCTTTTCTTATCTGGG - Intronic
1186253494 X:7694502-7694524 CTCCTTCTCTGTACTCCCCAGGG + Intergenic
1186298610 X:8175474-8175496 CTCCTTGTGTGTTCTTATATGGG - Intergenic
1187077828 X:15953144-15953166 TTCCTTCTCTCATCTCATCTGGG - Intergenic
1187254423 X:17629414-17629436 CTCAGTCTCTGCTCTCATCAAGG - Intronic
1187771540 X:22703961-22703983 ATACTTCTATTTTCTCATCTAGG + Intergenic
1192203446 X:69081571-69081593 ATTCTTCTCTGTTCTCATTGAGG - Intergenic
1192550936 X:72052862-72052884 CTCCTTTTCTGTTAGCAGCTTGG - Intergenic
1193321050 X:80121876-80121898 AACCTTCTCTTTTCCCATCTAGG + Intergenic
1194608271 X:96008204-96008226 CTTCATTTCTGCTCTCATCTTGG - Intergenic
1195211448 X:102654869-102654891 CTCCTTCCCAGCTCTCATTTTGG - Exonic
1195985877 X:110629574-110629596 ATTCTTCTCTGTTTTCATATTGG - Intergenic
1197641829 X:128975954-128975976 GTCTGCCTCTGTTCTCATCTGGG + Intergenic
1197720214 X:129739896-129739918 CACCCTCTCTGTCCTCAACTAGG + Intronic
1199998417 X:153042426-153042448 CCTTTTCTATGTTCTCATCTTGG + Intergenic
1200105021 X:153707219-153707241 CTCATTCTCTGTTCTCTGCGTGG + Intronic
1200374829 X:155768478-155768500 CTCTCTCTCTGTCCTCAGCTTGG - Intronic
1201355956 Y:13097299-13097321 TTCCTTCTCTGGGCTCATCCTGG + Intergenic