ID: 1173560863

View in Genome Browser
Species Human (GRCh38)
Location 20:44004411-44004433
Sequence AAGGAGAAGGTGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2169
Summary {0: 1, 1: 0, 2: 23, 3: 279, 4: 1866}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173560859_1173560863 -5 Left 1173560859 20:44004393-44004415 CCCTAGATGAGAACAGAGAAGGA 0: 1
1: 0
2: 3
3: 27
4: 272
Right 1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG 0: 1
1: 0
2: 23
3: 279
4: 1866
1173560857_1173560863 4 Left 1173560857 20:44004384-44004406 CCTGAGGAACCCTAGATGAGAAC 0: 1
1: 0
2: 0
3: 9
4: 394
Right 1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG 0: 1
1: 0
2: 23
3: 279
4: 1866
1173560860_1173560863 -6 Left 1173560860 20:44004394-44004416 CCTAGATGAGAACAGAGAAGGAG 0: 1
1: 0
2: 3
3: 37
4: 408
Right 1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG 0: 1
1: 0
2: 23
3: 279
4: 1866

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173560863 Original CRISPR AAGGAGAAGGTGAAGCAGGA AGG Intronic
Too many off-targets to display for this crispr