ID: 1173561739

View in Genome Browser
Species Human (GRCh38)
Location 20:44010970-44010992
Sequence CTCGCTTCTCCTCCGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173561734_1173561739 4 Left 1173561734 20:44010943-44010965 CCCAGAGGCTGTCGGGGAGAATC 0: 1
1: 1
2: 11
3: 35
4: 228
Right 1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG 0: 1
1: 0
2: 1
3: 33
4: 360
1173561733_1173561739 5 Left 1173561733 20:44010942-44010964 CCCCAGAGGCTGTCGGGGAGAAT 0: 1
1: 0
2: 4
3: 18
4: 224
Right 1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG 0: 1
1: 0
2: 1
3: 33
4: 360
1173561735_1173561739 3 Left 1173561735 20:44010944-44010966 CCAGAGGCTGTCGGGGAGAATCC 0: 1
1: 4
2: 13
3: 138
4: 380
Right 1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG 0: 1
1: 0
2: 1
3: 33
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173561739 Original CRISPR CTCGCTTCTCCTCCGGCTCC TGG Intronic
900647268 1:3714604-3714626 CTGGCCTCTCCTCCGGCCTCTGG - Intronic
900794141 1:4697882-4697904 CTTGCTTCTCCTCCGGCCACTGG - Intronic
900913559 1:5618968-5618990 CCCGCTTCTCCTGCGGCTCTTGG - Intergenic
901180591 1:7338971-7338993 CTCTCTCATCCTCCTGCTCCAGG - Intronic
901634788 1:10665446-10665468 CTCGCTTCTCCACCACCACCTGG + Exonic
901686493 1:10946394-10946416 CTCCCTCCTCCTCCCTCTCCGGG - Intergenic
902518671 1:17003481-17003503 CTCACTGCACCTCCGCCTCCTGG - Intronic
902539333 1:17141759-17141781 CTCCCCTCTCCTCCAGCCCCAGG - Intergenic
903460360 1:23516527-23516549 CTGGCTTCTCTTCCTCCTCCAGG - Exonic
904674436 1:32190075-32190097 TGCGCTTCTCCTCCTCCTCCCGG - Exonic
904677655 1:32208174-32208196 CTGGCTTCTGCTCCTGCCCCTGG + Exonic
906072721 1:43028924-43028946 CTCGCCTCTCCTCCGGTCCTTGG - Intergenic
906120926 1:43389983-43390005 CGCCCCTCACCTCCGGCTCCGGG - Exonic
906224464 1:44109979-44110001 CTCACTGCACCTCCGCCTCCCGG + Intergenic
906291964 1:44625282-44625304 CTCTTCTCTCCTCCAGCTCCTGG + Intronic
906624092 1:47310920-47310942 CTCACTGCACCTCCGCCTCCTGG + Intronic
907576691 1:55533044-55533066 CTCCCTTCTCCATAGGCTCCTGG + Intergenic
910402593 1:86852357-86852379 CTCTCCTTTCCTCCTGCTCCTGG - Intergenic
911706543 1:101020424-101020446 CTCCCTCCTCCTCTGGCTCCAGG + Intronic
911872785 1:103120280-103120302 CTCACTGCACCTCCGCCTCCTGG + Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912420330 1:109538403-109538425 GTCACTTCTCCTCCAGCACCCGG + Intergenic
913644980 1:120847340-120847362 CTCACTGCACCTCCGCCTCCTGG + Intergenic
914176655 1:145284745-145284767 CTCACTGCACCTCCGCCTCCTGG - Intergenic
914259357 1:145985840-145985862 CTCACTGCACCTCCGCCTCCCGG - Intergenic
914531382 1:148526224-148526246 CTCACTGCACCTCCGCCTCCGGG - Intergenic
914637010 1:149561516-149561538 CTCACTGCACCTCCGCCTCCTGG + Intergenic
915034586 1:152911183-152911205 GTTGCTTCTCCTCCTGCTCCAGG - Exonic
915355745 1:155254554-155254576 CTTGCCTCTCCTCCCTCTCCTGG - Intronic
915455563 1:156038300-156038322 CTCACTGCACCTCCGCCTCCCGG - Intronic
915602635 1:156931951-156931973 CTCGGTGCTCCACAGGCTCCAGG - Exonic
916514843 1:165506605-165506627 CTTGCTTCTGCTCCTGTTCCAGG - Intergenic
918334884 1:183498916-183498938 CTCTCTTCCCCTCCAACTCCTGG + Intronic
920243880 1:204573589-204573611 CTCCATTCTCCCCCAGCTCCCGG + Intergenic
922543052 1:226433580-226433602 CCCCCTTCTCCTCCGGCTTCTGG + Intergenic
924622121 1:245671465-245671487 CTCCCTACTCCCCCGGCCCCCGG - Intronic
1063707454 10:8444637-8444659 CTCAATTCTCCTCTGGCTGCGGG + Intergenic
1064984989 10:21200700-21200722 CTCGCCTCTGCTCTGACTCCAGG - Intergenic
1065458649 10:25933984-25934006 CTCCCTTCTCGCCGGGCTCCGGG + Intergenic
1066710483 10:38228026-38228048 CTCTCCTTTCCTCAGGCTCCCGG - Intergenic
1067832748 10:49619886-49619908 CTGTCTTCTCCTGCCGCTCCAGG - Exonic
1068646803 10:59476860-59476882 CTCACTACACCTCCGCCTCCGGG - Intergenic
1069662468 10:70132658-70132680 CTCGCCCCTCTTCCGGGTCCCGG + Intronic
1070015537 10:72526368-72526390 CTCACTGCACCTCCGCCTCCCGG + Intronic
1070289879 10:75107278-75107300 ATCTCTGCTCCTCCGCCTCCTGG - Intronic
1070591483 10:77805042-77805064 CTCACTGCACCTCCGCCTCCTGG + Intronic
1072131522 10:92498680-92498702 CTCACTGCACCTCCGCCTCCCGG - Intronic
1072138606 10:92571052-92571074 CTCACTGCACCTCCGCCTCCTGG + Intronic
1072339804 10:94436208-94436230 CTCACTGCACCTCCGCCTCCTGG + Intronic
1073062926 10:100742990-100743012 CTGCCTTCTCCTGGGGCTCCAGG - Intronic
1073412108 10:103350887-103350909 CTCCCGGCTGCTCCGGCTCCCGG - Exonic
1074528589 10:114281328-114281350 CTCGCCTCTCCTGCGTCTCCGGG - Intronic
1074803670 10:117026998-117027020 GTCACTTCCCCTCCAGCTCCAGG + Intronic
1075124147 10:119686348-119686370 CTCACTGCACCTCCGCCTCCCGG + Intergenic
1075705197 10:124496461-124496483 CTCGCTTGACCTCCGGCTAACGG + Intronic
1076095661 10:127733546-127733568 CTGGCTTCTTCTCGGGCTCTGGG - Intergenic
1078225906 11:9391322-9391344 CTCACTGCACCTCCGCCTCCCGG - Intronic
1078245874 11:9573314-9573336 CTCGCTGCTCCTCCGGTGCTGGG - Intergenic
1080599723 11:33809765-33809787 CTCTCTTCTCCTCTTTCTCCAGG + Intergenic
1080628346 11:34051570-34051592 CTAGCTTCTCCGCCGTCCCCCGG - Intergenic
1081901725 11:46634470-46634492 CTCACTGCACCTCCGCCTCCCGG + Intronic
1082802743 11:57426599-57426621 TCCGCTTCTCCACCTGCTCCCGG - Exonic
1083317888 11:61827787-61827809 CTAGGATCTCCTCCGGCGCCCGG + Exonic
1083754109 11:64780026-64780048 CTCACTACACCTCCGCCTCCTGG - Intergenic
1084633178 11:70370024-70370046 CTCACTGCACCTCCGCCTCCTGG + Intronic
1084732566 11:71082728-71082750 TTCTCCTCTCCTCCTGCTCCAGG - Intronic
1087655214 11:100914552-100914574 CTCATCTCTCCTCCGCCTCCTGG + Intronic
1088420243 11:109636781-109636803 ATTGCTTCTCCTCCAACTCCGGG - Intergenic
1088480714 11:110294318-110294340 CTCACTGCACCTCCGCCTCCTGG - Intronic
1089126967 11:116183327-116183349 CTGCCTTCCCCTCCTGCTCCAGG - Intergenic
1089262388 11:117232075-117232097 GTCACTGCTCCTCCGGCTCCCGG - Exonic
1092732740 12:11549651-11549673 CTCACTGCACCTCCGCCTCCCGG + Intergenic
1095488071 12:42704973-42704995 CTCCCTTCCCCACTGGCTCCAGG + Intergenic
1095734798 12:45545002-45545024 CTGGCTTCTCCTCTGGGCCCTGG - Intergenic
1095742614 12:45623441-45623463 CTAGCTCCTCCTCCAGCTCTAGG - Intergenic
1095875819 12:47079564-47079586 CTTCCTTTCCCTCCGGCTCCCGG + Exonic
1096003130 12:48145849-48145871 CTGCCTGCTCCTCCAGCTCCTGG - Exonic
1096365777 12:51027099-51027121 CTCACTGCACCTCCGCCTCCCGG - Intronic
1097062987 12:56299971-56299993 CGCGCTTCCCTTCTGGCTCCTGG - Intronic
1097145843 12:56938950-56938972 CTCCCTTCTTCTCCTGCCCCAGG + Intergenic
1097151404 12:56982488-56982510 CTCCCTTCTTCTCCTGCCCCAGG + Intergenic
1097705607 12:62865569-62865591 CTCACTTAACCTCCGTCTCCCGG + Intronic
1098487649 12:71040105-71040127 ATCTCTTTTCCTCCTGCTCCTGG + Intergenic
1098923776 12:76327149-76327171 CTCTCTGCACCTCCGCCTCCTGG - Intergenic
1099650108 12:85415791-85415813 CTCACTTCTCCTCGACCTCCTGG - Intergenic
1100215911 12:92448314-92448336 CTGGCCTCTCCTCCTACTCCTGG + Intergenic
1100545367 12:95597094-95597116 CTCACTACACCTCCGCCTCCTGG + Intergenic
1101822727 12:108196192-108196214 CTCGCTCTTCCTCCTTCTCCCGG - Exonic
1102766828 12:115440634-115440656 CTCCCAGGTCCTCCGGCTCCAGG + Intergenic
1102854005 12:116277650-116277672 CTCGCTTCTCCTCCCTCCCCGGG + Intergenic
1103080491 12:118020128-118020150 CTCACTTACCCTCTGGCTCCTGG + Intronic
1103764522 12:123271231-123271253 CTCCTTTTTCCTCCGGCTTCTGG - Intronic
1104765593 12:131328129-131328151 CTCACTTCTGCTCCAGCTGCTGG - Intergenic
1104813730 12:131633923-131633945 CTCACTTCTGCTCCAGCTGCTGG + Intergenic
1105454257 13:20525831-20525853 CTCGCAGCTCCGCCGGCGCCTGG - Exonic
1105844238 13:24281080-24281102 CTCCCTTCTCCTGAGGCGCCAGG + Intronic
1107288284 13:38821893-38821915 CTCACTTGGCCTCAGGCTCCCGG + Intronic
1108164448 13:47677437-47677459 CTCTCTTGCCCTCTGGCTCCAGG - Intergenic
1110815096 13:79852446-79852468 CTCACTGCACCTCCGTCTCCCGG - Intergenic
1112901387 13:104362426-104362448 GTCACTCCTCCTCCAGCTCCAGG - Intergenic
1113271210 13:108676725-108676747 CACGCCTCTCCTCTGGCTTCTGG - Intronic
1113485549 13:110650009-110650031 CTCACTGCACCTCCGCCTCCTGG + Intronic
1113568594 13:111337541-111337563 CTGGCATCTCCTTTGGCTCCAGG + Intronic
1113594092 13:111519275-111519297 CTGGCTTCTCCTCCTGCATCTGG + Intergenic
1115365559 14:32553234-32553256 CTCACTGCACCTCCGCCTCCTGG + Intronic
1115755746 14:36524923-36524945 CTACCTTCTCCACCGACTCCAGG + Intergenic
1116497126 14:45574730-45574752 CTCTCTTGTCCTCTGGCTCCTGG + Intergenic
1116607064 14:47013868-47013890 CTCACTGCACCTCCGCCTCCTGG + Intronic
1117416815 14:55504439-55504461 CTCTCTCTTCCTCCTGCTCCAGG + Intergenic
1117963936 14:61188422-61188444 CTGGCTCCGGCTCCGGCTCCGGG + Intronic
1118607624 14:67515179-67515201 CCCGCTCCTCCTCCCGCGCCGGG + Exonic
1119410385 14:74426368-74426390 CTCGCTTCGCCGCCTCCTCCGGG - Intergenic
1120979481 14:90277767-90277789 CACGCTGCCCCTCCAGCTCCAGG + Exonic
1121080264 14:91102475-91102497 CCCCCTCCTCCTCCGGCCCCGGG + Intronic
1122939248 14:104973879-104973901 CTCCCCTCCCCTCCGGCTGCGGG - Intronic
1123448173 15:20344533-20344555 CTTGCTTCTCCTTAGTCTCCAGG + Intergenic
1123553152 15:21400963-21400985 GTGGCTGCTCCACCGGCTCCTGG - Intergenic
1123589398 15:21838351-21838373 GTGGCTGCTCCACCGGCTCCTGG - Intergenic
1123787846 15:23690484-23690506 CTGGCCTCTCCTCCTGTTCCTGG - Intergenic
1125746578 15:42001161-42001183 CTCCCTCTTCCTCCGCCTCCTGG + Exonic
1126464045 15:48944342-48944364 CTCACATCTCCTTGGGCTCCTGG - Intronic
1129081078 15:73041697-73041719 CTCGGCTCACCTCCGCCTCCCGG + Intergenic
1129233930 15:74212497-74212519 CTCTCTTGGCCTCCTGCTCCGGG - Intergenic
1129328165 15:74812887-74812909 CTGCCTTCTCCTCCTGCTCCTGG + Exonic
1129538454 15:76332918-76332940 CAGGCTTCTCCTCTTGCTCCAGG - Intergenic
1130926834 15:88391845-88391867 CTCATTTCTCCTCAGCCTCCAGG + Intergenic
1131945118 15:97610982-97611004 ATCACTCCTCCCCCGGCTCCAGG + Intergenic
1132333085 15:101026077-101026099 GCCGCTCCCCCTCCGGCTCCAGG + Exonic
1132390479 15:101434838-101434860 CTTGCTTCTCACCCAGCTCCAGG + Intronic
1202961501 15_KI270727v1_random:128183-128205 GTGGCTGCTCCACCGGCTCCTGG - Intergenic
1133256492 16:4519699-4519721 CTCGCTTCTCCTCCACCCCAGGG - Intronic
1133328323 16:4956001-4956023 CTCCCTCCTCCTCCAGCCCCAGG - Intronic
1134039242 16:11055354-11055376 CTGGCTCCTCCTCATGCTCCAGG - Intronic
1134110637 16:11513503-11513525 CTCACTGCACCTCCGCCTCCCGG + Intronic
1135109467 16:19679577-19679599 CTCGCTCATCCTCCACCTCCTGG + Intronic
1135198639 16:20417535-20417557 TTCCCTCCTCCTCCAGCTCCTGG - Intronic
1135458932 16:22624255-22624277 CTCACCTGTCCTCAGGCTCCTGG - Intergenic
1135461987 16:22652317-22652339 CTCGCTGCAACTCCGCCTCCCGG - Intergenic
1135743915 16:24999488-24999510 CTCACTGCAGCTCCGGCTCCTGG + Intronic
1136183836 16:28573303-28573325 CTCCCTTCTCCTCTGGCTTCAGG - Intronic
1136396506 16:29995384-29995406 CCTGCTTCTCCTCGGGCTCCAGG + Exonic
1138058380 16:53860588-53860610 CTCTCTCTTCCTCCTGCTCCGGG - Intronic
1138196704 16:55057551-55057573 CTGGCTTCTCCTCTGAGTCCTGG - Intergenic
1138461377 16:57149970-57149992 CTCACTTAGCCTCCGCCTCCTGG + Intergenic
1138560590 16:57798564-57798586 CTGGCTTGTCCTCAGGCTCCAGG - Intronic
1139670351 16:68488719-68488741 CTCCCATCTCCACCGTCTCCAGG + Intergenic
1142112191 16:88338861-88338883 CACGCTCCTCCTGAGGCTCCAGG - Intergenic
1142129122 16:88424732-88424754 CTGGCTTCTCCTCGGGCTCTTGG + Intergenic
1142358903 16:89617015-89617037 CTCCCTTCCCCTTCTGCTCCAGG - Intronic
1142761905 17:2047458-2047480 CTCACTGCACCTCCGTCTCCTGG + Intergenic
1142860026 17:2755729-2755751 AGCGCTTCTCCCCCGGCGCCCGG - Intergenic
1143600792 17:7944521-7944543 CCCGCTGCTCCTCCAGCTGCTGG - Exonic
1144021134 17:11240969-11240991 CGCGGTTCTCCTCCTGCTCCCGG + Intergenic
1144094024 17:11883653-11883675 CTCGCCTCTCCTCCGCCTCTGGG + Exonic
1145021486 17:19435069-19435091 CTCACTGCACCTCCGCCTCCTGG + Intergenic
1145211208 17:21014663-21014685 ATCGCTTCTCATCCGTCTCAAGG - Intronic
1146728850 17:35176945-35176967 CTCGCCTATCCTCCTGCTCCAGG - Intronic
1146941235 17:36845813-36845835 CTCGCATCCCCTCCTTCTCCTGG + Intergenic
1147155700 17:38543636-38543658 CTCCCTCCTCCTCCCGATCCCGG - Intronic
1148262385 17:46194131-46194153 ATCACTTCCCCTCTGGCTCCCGG - Intronic
1148688062 17:49511870-49511892 CTGGCCTGTCCTCTGGCTCCAGG + Exonic
1149113428 17:53062577-53062599 CTCACTGCGCCTCCGCCTCCCGG + Intergenic
1149759216 17:59214482-59214504 CTCACTGCACCTCCGCCTCCTGG + Intronic
1150279081 17:63918499-63918521 CTGGTTTCTCCCCAGGCTCCCGG - Exonic
1151343018 17:73484092-73484114 CTCCCCGCTCCTCCGGCTCGGGG + Intronic
1151679407 17:75615671-75615693 CTGGCTGCTCCTCCTGCTTCAGG + Intergenic
1151763328 17:76119751-76119773 CTCGCCCCTCCTCCTCCTCCTGG - Intronic
1152144805 17:78561752-78561774 CTAGCCTCTCCTGCAGCTCCAGG + Exonic
1152340622 17:79722047-79722069 CTTGCTTCTCCTTAGTCTCCAGG - Intergenic
1152623831 17:81379431-81379453 CCTGCTTCCCCTCCAGCTCCTGG - Intergenic
1152740832 17:82017674-82017696 CTAGCTCCTCCCCCAGCTCCTGG - Intergenic
1152820678 17:82436172-82436194 CTGGCTGCTCCTCCAGCCCCTGG + Intronic
1152859732 17:82689211-82689233 CTCACTGCTCCTCCTGCCCCAGG - Intronic
1152924164 17:83079902-83079924 CCCGCTGCTGCTCCTGCTCCTGG + Exonic
1203166509 17_GL000205v2_random:102007-102029 CTGGCTTCTCCTTCTGTTCCTGG - Intergenic
1153618899 18:6957853-6957875 CTCACTGCACCTCCGCCTCCCGG + Intronic
1153778833 18:8476869-8476891 CTGGCTTCTCCTCTGGACCCAGG + Intergenic
1155333167 18:24738308-24738330 CTGCTTTCTCCTCCAGCTCCAGG - Intergenic
1157483339 18:48069907-48069929 CTTCCCTCTCCTCCCGCTCCAGG - Intronic
1157870453 18:51225734-51225756 CTCTCTACTCCTCCTGCTCAAGG + Intergenic
1158985221 18:62808624-62808646 CTCACTGCACCTCCGCCTCCTGG + Intronic
1159091917 18:63859879-63859901 GTCACTTCTCCCCCAGCTCCAGG - Intergenic
1159889892 18:73943468-73943490 CTGCCTTCCCCTCTGGCTCCGGG - Intergenic
1160589812 18:79937279-79937301 CTCGCTTCTACACAGGATCCTGG - Intronic
1161384468 19:3983633-3983655 CTCACTTCTGCCCCTGCTCCAGG + Intronic
1161434463 19:4254423-4254445 CCCTCTTCTCCTCCTCCTCCAGG - Exonic
1162453676 19:10769595-10769617 CTCAGTTCTCTTCTGGCTCCAGG - Intronic
1163030002 19:14537818-14537840 CTCGCTGCACCTCCGCCTCCCGG + Intronic
1164109132 19:22138088-22138110 CTCCCGGCTGCTCCGGCTCCCGG + Intergenic
1165107603 19:33481944-33481966 CTCACTGCACCTCCGCCTCCTGG - Intronic
1165261546 19:34623462-34623484 CTCCCATCTCCTCTGGGTCCTGG + Intronic
1165597926 19:37026392-37026414 CTCACTGCACCTCCGCCTCCTGG + Intronic
1166706043 19:44908599-44908621 CCCGCGTCTCCTCCGCCACCGGG - Exonic
1167383389 19:49150850-49150872 TCCCCTTCTCCTCTGGCTCCGGG + Exonic
1167626781 19:50595564-50595586 CTCACTGCTGCTCCGCCTCCCGG + Intergenic
1167682430 19:50932246-50932268 CTCCCTGCTCCTCAGCCTCCTGG + Intergenic
1168353303 19:55688328-55688350 CTCCCTTCCCCTCCTGCTCTTGG + Intronic
925146614 2:1586993-1587015 CTCGCTGCGGCCCCGGCTCCTGG + Intergenic
925196343 2:1929069-1929091 CACGCTTCTCCGCCTGGTCCTGG - Intronic
926060013 2:9799432-9799454 CTCGGGTCCCCTCTGGCTCCAGG + Intergenic
926419799 2:12685448-12685470 CTAGCCTCTCCCCCAGCTCCTGG - Intergenic
926650796 2:15342505-15342527 ATAGCTTCTCCTCTGTCTCCTGG - Intronic
927143579 2:20145849-20145871 CTTGCTCCTCCTCCAGCTTCCGG - Intergenic
927145585 2:20163498-20163520 CTCACTGCACCTCCGCCTCCTGG - Intergenic
927494432 2:23543070-23543092 CTTGGTTCTTCTCGGGCTCCTGG - Intronic
931317277 2:61144568-61144590 CTCACTGCACCTCCGCCTCCCGG - Intergenic
931867325 2:66426524-66426546 CGCGCTCCTGCTCCGGCTCCCGG + Intergenic
932356070 2:71069139-71069161 CTCGCAGCTGCTCCAGCTCCCGG - Intronic
932752959 2:74383618-74383640 CTTTCTTCTCCTCCTGATCCTGG - Intronic
933666791 2:84971073-84971095 CGCCCCTCTCCCCCGGCTCCCGG - Exonic
935682091 2:105647045-105647067 CTCCCTCCTCCTCGGGCTTCTGG + Intergenic
935718540 2:105959936-105959958 CTCTGTTCTCCTCAGACTCCTGG + Intergenic
937283471 2:120736006-120736028 CCGGCTCCTCCTGCGGCTCCTGG - Intronic
938414530 2:131093341-131093363 CCCGCGTCTCCGCCGCCTCCCGG + Exonic
940971813 2:159904182-159904204 CTCGCTTTTCCTTCGGCCCTTGG - Intronic
942348408 2:175027729-175027751 CTCTCTTCTCATCCTCCTCCAGG - Intergenic
944650480 2:201825237-201825259 CTCGCTGCACCTCTGCCTCCTGG - Intronic
945919192 2:215738046-215738068 CTCTCTCTTCCTCCTGCTCCAGG + Intergenic
945988162 2:216371437-216371459 CGCCCTCCTCCTCCGGCTCCGGG + Exonic
946248057 2:218398436-218398458 CTCGGCCCTCCTCCTGCTCCTGG - Intronic
947550374 2:231041356-231041378 CTGGTTCTTCCTCCGGCTCCAGG - Exonic
948671369 2:239570819-239570841 CTCATTTATCCTCTGGCTCCAGG - Intergenic
948850080 2:240701543-240701565 CGCGCTGCTCCAGCGGCTCCTGG + Intergenic
948992761 2:241563152-241563174 CTCCCTGCTCCTGCTGCTCCCGG + Intronic
949075635 2:242055709-242055731 CTTGCTCCTCCGCCTGCTCCTGG - Intergenic
1168831049 20:845434-845456 CTCTCGCCTCCTCCGGGTCCAGG - Exonic
1169005200 20:2200949-2200971 CTCGCTCCTCCTCCACCTTCCGG + Intergenic
1169136946 20:3203330-3203352 CTCTCGGCTCCTCAGGCTCCAGG + Exonic
1170593332 20:17787505-17787527 TGGGCTTCTCCTCCTGCTCCTGG + Intergenic
1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG + Intronic
1174075421 20:47932043-47932065 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1174282456 20:49449081-49449103 CTGGCCTCACCTCTGGCTCCAGG + Intronic
1175128096 20:56767395-56767417 CTCACTACACCTCCGCCTCCTGG - Intergenic
1175466139 20:59192207-59192229 GCCGCTTCTTCTCCAGCTCCAGG - Exonic
1175834629 20:61985718-61985740 CTCACTTCTCCTCAGGCCTCAGG - Intronic
1176300596 21:5097211-5097233 CACGCTTGACCTCAGGCTCCTGG - Intergenic
1176405246 21:6357089-6357111 CTGGCTTCTCCTTCTGTTCCTGG + Intergenic
1176431911 21:6632014-6632036 CTGGCTTCTCCTTCTGTTCCTGG - Intergenic
1176820328 21:13650216-13650238 GTGGCTGCTCCACCGGCTCCTGG + Intergenic
1178323280 21:31622490-31622512 ATGGCTTCTACTCAGGCTCCAGG + Intergenic
1179054131 21:37916073-37916095 CTCGCGGCTGCTCCGGCTCCAGG + Exonic
1179856447 21:44164770-44164792 CACGCTTGACCTCAGGCTCCTGG + Intergenic
1180054688 21:45351751-45351773 CTAGTTTCCCCTCTGGCTCCGGG + Intergenic
1180168068 21:46040359-46040381 CTCACTTCACCTCTGGCACCAGG + Intergenic
1182428688 22:30288108-30288130 CTAGCTCCTCCTCCTGCTGCTGG - Intronic
1182608670 22:31528037-31528059 CTCGTTTAACCTCCGCCTCCCGG - Intronic
1182744630 22:32596111-32596133 CTCTCTCTTCCTCCTGCTCCAGG + Intronic
1183359780 22:37377436-37377458 CTCTCTCCTCCTCCTCCTCCTGG + Intronic
1183725188 22:39584645-39584667 CTCTCTTCCCCTTGGGCTCCAGG - Intronic
1184408348 22:44312815-44312837 CTGGCCTCTTCCCCGGCTCCTGG + Exonic
1184796670 22:46737216-46737238 CTCACTGCACCTCCGCCTCCTGG - Intronic
1184854383 22:47138442-47138464 CTCGCTTCTCCCCAGCCTGCAGG - Intronic
1185364675 22:50432003-50432025 CTCCCTTCTCCTCCAACTCCTGG - Intronic
1185383001 22:50518722-50518744 CTCTCTTCTCACCTGGCTCCTGG - Exonic
950517170 3:13474886-13474908 CACCCTTCACCTCCGGCCCCAGG - Intergenic
951214806 3:20014026-20014048 CCAGCTTTTCCTCCAGCTCCAGG + Intergenic
952354819 3:32574281-32574303 GTCTCTTGTCCTCTGGCTCCTGG - Intergenic
952838452 3:37624679-37624701 CTCACTGCACCTCCGCCTCCTGG + Intronic
953349291 3:42202580-42202602 CGCCCTTCTCCGCCAGCTCCTGG - Exonic
953721975 3:45364011-45364033 CTCTTTTCTCCTAGGGCTCCTGG + Intergenic
954616536 3:51971527-51971549 TTCGCTTCTCCTCCGAGACCTGG - Exonic
954619578 3:51987938-51987960 CTCGGCTCACCTCCGCCTCCCGG + Intronic
954951427 3:54477690-54477712 CTGGCTTGTCCTCTGGCTCCAGG + Intronic
956296460 3:67720060-67720082 CTCACTGCACCTCCGCCTCCTGG + Intergenic
956634806 3:71353234-71353256 CCCGCTGCTCCTCAGGCACCAGG + Intronic
958941232 3:100317006-100317028 CTCACTGCACCTCCGCCTCCTGG - Intronic
961101451 3:124202599-124202621 CTCCCTCCTCCTCCTCCTCCTGG + Intronic
961344715 3:126256530-126256552 TTCCCTTCTCCTCTGGCCCCAGG - Intergenic
961576092 3:127837645-127837667 CAAGCTTCTCCTCCGGCTGTTGG - Intergenic
961939360 3:130621827-130621849 CCTGCCTCTCCTCCGGGTCCTGG - Exonic
962130526 3:132669339-132669361 CTCACTGCACCTCCGCCTCCCGG + Intronic
963160918 3:142149757-142149779 CCCGCTTCCCCGCCGCCTCCAGG + Intergenic
963558837 3:146834126-146834148 CTTGCCTCTCTTCCAGCTCCTGG + Intergenic
965099694 3:164279256-164279278 TTCACATCTCCTCCAGCTCCAGG + Intergenic
965170275 3:165254071-165254093 CTCACTGCACCTCCGCCTCCAGG - Intergenic
966413307 3:179665011-179665033 CTCACTGCACCTCCGCCTCCTGG - Intronic
966660559 3:182410073-182410095 CTTCCTTCTCCTCCAGCCCCGGG - Intergenic
967930592 3:194687660-194687682 CACGGTTCTCCTCCTCCTCCGGG - Exonic
968083655 3:195864062-195864084 CCCGCTGCTCCTGCTGCTCCCGG - Exonic
968770730 4:2504805-2504827 CTCAGTTCACCTCCGCCTCCCGG + Intronic
969067358 4:4497124-4497146 CAGGCTCCCCCTCCGGCTCCAGG + Intronic
969112954 4:4855029-4855051 CTCTCTTCTCCTGCTGATCCTGG + Intergenic
969666545 4:8560643-8560665 ATCGCTTCTCCACCGGGCCCGGG + Intronic
971207372 4:24583952-24583974 CCACCCTCTCCTCCGGCTCCAGG + Intronic
973015056 4:45127682-45127704 CTCTCTCTTCCTCCTGCTCCAGG + Intergenic
973981856 4:56314441-56314463 TTCGCTCCTCCTCCGCCTCCAGG - Exonic
975556753 4:75673088-75673110 GCCGCTACACCTCCGGCTCCCGG + Intronic
975737180 4:77392572-77392594 CTCGCTTCTGCTCCTGCTGACGG - Intronic
976441911 4:85085596-85085618 CTCCCTTGCCCTCCGGCTTCTGG - Intergenic
977716303 4:100187764-100187786 GTCGCTTCTCCTCTGGTTTCAGG - Exonic
979547179 4:121951611-121951633 CTTCCTCCTCCTCCGGCGCCGGG + Exonic
979930084 4:126619074-126619096 CTCACTGCACCTCCGCCTCCTGG + Intergenic
980493766 4:133564114-133564136 CTCTCTTCTTCTCCTTCTCCAGG - Intergenic
983579355 4:169292314-169292336 CTCACTGATCCTCCGCCTCCAGG - Intergenic
990954288 5:61328561-61328583 CTCACTTCTCCCTTGGCTCCTGG + Intergenic
992681387 5:79156864-79156886 CTCGCTTGTCAACTGGCTCCTGG - Intronic
995854475 5:116577138-116577160 CTGGCTTTTCTTCCAGCTCCGGG - Intergenic
997818326 5:137039328-137039350 CTCTGTTCTCCTAGGGCTCCGGG - Intronic
998055673 5:139074897-139074919 CTCACTGCACCTCCGCCTCCCGG + Intronic
999307912 5:150532599-150532621 CTCACTGCACCTCCGCCTCCCGG + Intronic
1000066795 5:157700308-157700330 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1000517943 5:162262694-162262716 GTCACTTCTCCCCCAGCTCCAGG + Intergenic
1001379032 5:171290292-171290314 CTCACTGCACCTCCGCCTCCCGG - Intronic
1001470106 5:172006222-172006244 CTCGCTTCTCCCCCTCCCCCTGG - Intronic
1002130885 5:177080905-177080927 TTGGCTTCTCCACAGGCTCCAGG - Intronic
1002172722 5:177384418-177384440 CTCAGTTCTCCTCAGGGTCCTGG + Intronic
1002173090 5:177386114-177386136 CTGGCTTCTGCTCCTCCTCCAGG - Exonic
1003569441 6:7246611-7246633 CATGCTCCTCCTCCGGCTCATGG - Exonic
1003840055 6:10111032-10111054 CTCCCTTGTCCTCTGGCTGCTGG + Intronic
1003868885 6:10386049-10386071 CTCCCTCCTCCTCCTCCTCCTGG - Intergenic
1005450347 6:25965844-25965866 CTCACTGCACCTCCGCCTCCCGG - Intronic
1005728954 6:28677003-28677025 CTCACTGCTCCTCCACCTCCCGG - Intergenic
1005934783 6:30512557-30512579 CTCACTGCGCCTCCGCCTCCCGG - Intergenic
1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG + Intronic
1006305132 6:33214058-33214080 CTGACTTCTCTTCTGGCTCCAGG + Intergenic
1007378051 6:41469675-41469697 CCCGCCTCACCTCCAGCTCCTGG - Intergenic
1007408516 6:41648498-41648520 CTCCCCTCTCCTTGGGCTCCAGG + Intronic
1009615012 6:65992536-65992558 CTCTCTCCTCCTCCTGCTCTGGG - Intergenic
1010363889 6:75027417-75027439 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1014598386 6:123374699-123374721 CTCACTGCACCTCCGCCTCCTGG - Intronic
1014974047 6:127856493-127856515 CTCGCTTGTCCTCTGGCTTCTGG - Intronic
1015629728 6:135219689-135219711 CTCCCTTGTCCTCCAGCTTCTGG - Intergenic
1016517658 6:144913255-144913277 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1016849603 6:148603617-148603639 CTCCCTCCACCTCCAGCTCCTGG + Intergenic
1016975899 6:149807443-149807465 CTCACTGCACCTCCGCCTCCTGG + Intronic
1018826221 6:167409625-167409647 CTAGCTTCACCTCCTGCTCAAGG + Intergenic
1018836450 6:167487825-167487847 CTCCCTTCTCCTCCCGCCGCAGG + Intergenic
1019606169 7:1911311-1911333 CTCCCTCCTCCTCAGGCCCCAGG + Intronic
1019699442 7:2467220-2467242 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1019975056 7:4574466-4574488 CTCTCTCTTCCTCCTGCTCCAGG + Intergenic
1020086595 7:5313741-5313763 CTCGCTTGTCCACAGGCTCTGGG + Exonic
1020275430 7:6621924-6621946 CTTCCTCCTCCTCGGGCTCCAGG - Exonic
1021225739 7:18023744-18023766 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1022241991 7:28521375-28521397 CTCACTTCTCCCCAGGCTCGCGG + Intronic
1024307289 7:47939542-47939564 CACGCTTCTCCTCCATCTCCAGG + Intronic
1024993529 7:55254541-55254563 CCCGCTCCACCTCCCGCTCCCGG + Intronic
1025207718 7:57003397-57003419 CTCGCTTGTCCACAGGCTCTGGG - Intergenic
1025664218 7:63573475-63573497 CTCGCTTGTCCACAGGCTCTGGG + Intergenic
1025949392 7:66131834-66131856 CTCGGCTCACCTCTGGCTCCCGG + Intronic
1026280746 7:68919789-68919811 CTCTCTCTTCCTCCTGCTCCAGG - Intergenic
1026543862 7:71304816-71304838 CTCGGTTCACCTCCGCCTCTTGG + Intronic
1026744609 7:73001271-73001293 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1027030717 7:74885936-74885958 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1027099128 7:75363821-75363843 CTCACTGCACCTCCGCCTCCCGG + Intergenic
1029281669 7:99439356-99439378 CTCCCACCTCCTCCGGGTCCTGG + Intronic
1029400228 7:100340601-100340623 CTCACTGCACCTCCGCCTCCCGG + Intronic
1031001613 7:116421918-116421940 CTCACTGCACCTCTGGCTCCCGG - Intronic
1032281730 7:130508653-130508675 CTCCCTTCTCCTCCAGTTGCAGG - Exonic
1033927420 7:146480755-146480777 CTCGGCTCACCTCCGCCTCCCGG + Intronic
1034956536 7:155338734-155338756 CGCGCTTCTGTCCCGGCTCCAGG - Intergenic
1035143584 7:156788971-156788993 CTCGCTGCACCTCCATCTCCCGG - Intronic
1035274283 7:157737994-157738016 CTCTCTTCTCATCCATCTCCTGG + Intronic
1035449224 7:158964934-158964956 GTGGCTGCTCCTCCAGCTCCTGG + Intergenic
1036375050 8:8192775-8192797 CTCGCTTCAACTCTGCCTCCTGG - Intergenic
1036772960 8:11591713-11591735 CTCTCATCTCCTCTGGCCCCAGG - Intergenic
1036854492 8:12230374-12230396 CTCGCTTCAACTCTGCCTCCTGG + Intergenic
1036875851 8:12472873-12472895 CTCGCTTCAACTCTGCCTCCTGG + Intergenic
1037835108 8:22211035-22211057 CCCGCCTCTCCTCTGGCACCTGG - Intronic
1037865697 8:22440914-22440936 CTCTCGGCTCCTCCGGCTCCGGG - Intronic
1038337262 8:26655593-26655615 CTCTCTTCTCCTCTCCCTCCAGG + Exonic
1038542486 8:28401832-28401854 CCCGCCCCACCTCCGGCTCCGGG + Intronic
1041040674 8:53843183-53843205 CCCGCTTCACTTTCGGCTCCCGG - Exonic
1041656464 8:60355758-60355780 CTGGATTCTCCTCCCTCTCCAGG - Intergenic
1044729781 8:95220524-95220546 CTCCCTGCTCCTCCTGCTCCTGG + Intergenic
1044934195 8:97277622-97277644 CGCGCAGCTCCTCCGGCTCGGGG - Exonic
1045277367 8:100720885-100720907 CCTGCTTCTGCTCCTGCTCCTGG - Intronic
1045965978 8:108024943-108024965 CTCGCTGCCCCTCTGCCTCCTGG - Intronic
1047038108 8:120962097-120962119 ATCTCCTCTCCTCCAGCTCCAGG + Intergenic
1047673572 8:127174868-127174890 CTCACTTCTCCTCCCACTCCAGG + Intergenic
1047716122 8:127596741-127596763 TTGGCTTTTCCTCTGGCTCCTGG - Intergenic
1049926677 9:415734-415756 CTTGCTTTTCCTCCAGCTCAAGG + Intronic
1052888880 9:33677162-33677184 GCCGCTTCTCCCCCCGCTCCAGG + Intergenic
1053509172 9:38672667-38672689 CCTGCTGCTCCTCCGGCTCACGG + Intergenic
1058847942 9:108980570-108980592 CTTGCTTCCCCTCCTGCTCTTGG + Intronic
1059119206 9:111627033-111627055 CACGCCTCTCCCCAGGCTCCTGG + Intergenic
1059163088 9:112053438-112053460 CTCACTGCACCTCCGCCTCCTGG - Intronic
1059387260 9:113974337-113974359 CTTGCTGCTACTCCAGCTCCAGG - Intronic
1060301048 9:122374843-122374865 CTCCCTCCTCCTCCTACTCCTGG - Intronic
1060385704 9:123226210-123226232 CTCTCTTCACCTCCTGCTCCTGG - Intronic
1060881348 9:127120407-127120429 CCCCCCTCTCCTCAGGCTCCTGG + Intronic
1060904696 9:127294376-127294398 CTCACTGCACCTCCGCCTCCTGG + Intronic
1061093332 9:128439326-128439348 CTCACTTCTCTCCAGGCTCCAGG + Intergenic
1061992146 9:134165168-134165190 CTCGCGTGTCCTCCGGCTCCAGG + Intergenic
1062255318 9:135618069-135618091 CCCTCTTCCCGTCCGGCTCCAGG - Intergenic
1203439628 Un_GL000195v1:176694-176716 CTGGCTTCTCCTTCTGTTCCTGG + Intergenic
1203527032 Un_GL000213v1:99335-99357 GTGGCTGCTCCACCGGCTCCTGG - Intergenic
1187421609 X:19139325-19139347 CTCACTTAACCTCCGCCTCCTGG + Intergenic
1192056643 X:67780464-67780486 TTCTCTTTTCCTCTGGCTCCAGG - Intergenic
1195090032 X:101450099-101450121 CTCGCTTAACCTCCAGCTCCAGG - Intronic
1195156061 X:102125734-102125756 CTCGCTGCTCCCCCGCCGCCTGG - Exonic
1195158055 X:102142403-102142425 CTCGCTGCTCCCCCGCCGCCTGG + Exonic
1195387645 X:104328410-104328432 CTCACTTAGCCTCCGCCTCCTGG + Intergenic
1197059168 X:122156017-122156039 CTCGCTGCACCTCCATCTCCTGG - Intergenic
1198261938 X:134972853-134972875 CTCTCTCTTCCTCCTGCTCCAGG + Intergenic
1199579233 X:149344813-149344835 CTGGCTTCTCCACGTGCTCCAGG + Intergenic