ID: 1173564063

View in Genome Browser
Species Human (GRCh38)
Location 20:44026822-44026844
Sequence CTCACCCCACAGAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 0, 3: 31, 4: 307}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173564063_1173564073 18 Left 1173564063 20:44026822-44026844 CCTTCCTTCTTCTGTGGGGTGAG 0: 1
1: 1
2: 0
3: 31
4: 307
Right 1173564073 20:44026863-44026885 TGAGCACCCACAACTCTCCTGGG 0: 1
1: 0
2: 2
3: 11
4: 148
1173564063_1173564074 23 Left 1173564063 20:44026822-44026844 CCTTCCTTCTTCTGTGGGGTGAG 0: 1
1: 1
2: 0
3: 31
4: 307
Right 1173564074 20:44026868-44026890 ACCCACAACTCTCCTGGGAAAGG 0: 1
1: 0
2: 0
3: 20
4: 176
1173564063_1173564077 29 Left 1173564063 20:44026822-44026844 CCTTCCTTCTTCTGTGGGGTGAG 0: 1
1: 1
2: 0
3: 31
4: 307
Right 1173564077 20:44026874-44026896 AACTCTCCTGGGAAAGGATCTGG 0: 1
1: 0
2: 1
3: 16
4: 171
1173564063_1173564072 17 Left 1173564063 20:44026822-44026844 CCTTCCTTCTTCTGTGGGGTGAG 0: 1
1: 1
2: 0
3: 31
4: 307
Right 1173564072 20:44026862-44026884 CTGAGCACCCACAACTCTCCTGG 0: 1
1: 0
2: 1
3: 25
4: 239
1173564063_1173564078 30 Left 1173564063 20:44026822-44026844 CCTTCCTTCTTCTGTGGGGTGAG 0: 1
1: 1
2: 0
3: 31
4: 307
Right 1173564078 20:44026875-44026897 ACTCTCCTGGGAAAGGATCTGGG 0: 1
1: 0
2: 4
3: 13
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173564063 Original CRISPR CTCACCCCACAGAAGAAGGA AGG (reversed) Intronic
900370290 1:2329189-2329211 ATAACCCCACAGCAGACGGAGGG - Intronic
901001066 1:6149065-6149087 CTCCTCCCCCAGGAGAAGGAGGG - Exonic
901742816 1:11353344-11353366 CTCTGCCCACTGAGGAAGGAAGG - Intergenic
903239739 1:21974834-21974856 CTTACGCCAGGGAAGAAGGAGGG - Intergenic
903572162 1:24313997-24314019 CTGACCCCACTGAAGCATGATGG + Intergenic
903826409 1:26148769-26148791 CTTCCCCCAAGGAAGAAGGAAGG - Intergenic
904317444 1:29674798-29674820 CTCACCCCTCAGATGGAGGCCGG - Intergenic
904643746 1:31950271-31950293 CTAACCCGCCTGAAGAAGGAAGG + Intergenic
905401641 1:37707954-37707976 CAGACCCCACAGAAGGATGAGGG - Intronic
908788912 1:67761773-67761795 CTCACCCGACAGAAAGCGGATGG - Intronic
910407432 1:86904173-86904195 CACATCCAGCAGAAGAAGGACGG + Intronic
910713173 1:90202896-90202918 CTCACACAGCAGAAGAATGATGG + Intergenic
914830873 1:151169952-151169974 CTCACCCCAAAGCCCAAGGAAGG + Exonic
915089890 1:153416914-153416936 CTGCCCCCACAGAGGGAGGAGGG + Intronic
915461151 1:156071273-156071295 CTGATCCCAAAGAAGAAGGATGG + Intergenic
915992676 1:160532400-160532422 CTCACCTCCCAGATGAAGGGCGG - Intergenic
917883853 1:179364947-179364969 CTCCCCCCAGAGCACAAGGAAGG - Intergenic
919149280 1:193674552-193674574 CTCTCCCCACAGAATCAGTAAGG - Intergenic
919181138 1:194083499-194083521 ATCACCCCATAAAAGAAGGTGGG - Intergenic
919421938 1:197380486-197380508 ATTTCCCCACAGAAGCAGGAAGG + Intronic
919496850 1:198283263-198283285 CTTAGCCCAAAGAAGAACGAAGG - Intronic
919793953 1:201309996-201310018 CTCACCCCACAGACATAGAATGG - Intronic
919794429 1:201312689-201312711 CTCACCCCACAGACACAGAACGG - Intronic
920203921 1:204277728-204277750 CTGTCCACACAGAAGAAGGCTGG - Intronic
920243261 1:204569301-204569323 ATCACTCCACAGGGGAAGGAGGG - Intergenic
920560822 1:206937223-206937245 CTCAACCCCCAGGACAAGGATGG - Exonic
922236455 1:223726256-223726278 CAGACCCCACAGAAGAAGGGAGG - Intronic
922349094 1:224721288-224721310 CTCTCCTCTCAGAATAAGGAGGG - Intronic
923018405 1:230144756-230144778 CTCACCCCACATAAGAACACTGG - Intronic
923041607 1:230323724-230323746 CGCCCCCGACAGAAGCAGGAGGG + Intronic
924812523 1:247415953-247415975 GGCACCCCACAGAAGCAGGGTGG - Intergenic
1062801190 10:381783-381805 CTCACCCCACAGGAAAGGAATGG + Intronic
1063377875 10:5564874-5564896 CTGACCCCACAGAGTAAGGCTGG + Intergenic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1067432088 10:46251519-46251541 TCCACCCCACAGAAGTGGGAAGG - Intergenic
1067833066 10:49621361-49621383 GTCTCCCCAGGGAAGAAGGAAGG + Intronic
1068697197 10:59980200-59980222 CTCACATAACAGAAGATGGAAGG - Intergenic
1069408356 10:68126636-68126658 GACACACCACAGAAGAAGGATGG + Intronic
1069674593 10:70238744-70238766 CTCACCTCCCAGATGAAGGGCGG + Intergenic
1069960240 10:72075148-72075170 TCCACCCCACAGGAGATGGAGGG + Intronic
1071134560 10:82438274-82438296 CCCAGCCCACTGAGGAAGGATGG + Intronic
1071567521 10:86679505-86679527 CTCACCCTGCAGAAGTAGGTGGG + Exonic
1072015996 10:91347091-91347113 CTCCAACCACAGAAGACGGAAGG + Intergenic
1072221372 10:93330438-93330460 CTCACCCCACAGAAGCACAGGGG + Intronic
1073068574 10:100779168-100779190 CTCACCCTGCAGAAAAAGAAAGG + Intronic
1073475031 10:103747189-103747211 CTCACCCCACACATTAGGGACGG + Intronic
1074163176 10:110851145-110851167 CTCAAACCACAGAAGAAGGGCGG - Intergenic
1074360050 10:112818377-112818399 ATCAACCCATAGAAGAAGGGAGG + Exonic
1074384420 10:113005648-113005670 CTCACCCCGAAGTACAAGGAGGG - Intronic
1075316665 10:121458823-121458845 CTCACCCCACAGCCAGAGGATGG + Intergenic
1075533732 10:123252763-123252785 CTCACCCCAGGGGAGAAGGGTGG + Intergenic
1076639649 10:131905637-131905659 TTCACACCACCGAAGAAGGAAGG + Intronic
1079241855 11:18727311-18727333 GTCACCCCAGGGCAGAAGGAGGG - Intergenic
1080943328 11:36943838-36943860 CTAACCCCAGAAAAGAGGGAAGG + Intergenic
1081279926 11:41196737-41196759 CCCATCCCACATAAGCAGGATGG - Intronic
1082966221 11:58968555-58968577 CTCACCCCACAGCGGCAGAATGG + Intronic
1083541608 11:63515484-63515506 CTCAGCCCCCAGGGGAAGGATGG - Intronic
1083965613 11:66042196-66042218 CTCAGCCCCCAGAAAAAGGCAGG + Exonic
1085168892 11:74430953-74430975 TTCCCCTCACAGGAGAAGGAGGG + Intergenic
1085457945 11:76676028-76676050 CTCACCCCACCTAAGATGGGAGG - Intergenic
1085491589 11:76924095-76924117 CTCAAGCCACAGCATAAGGAGGG - Intronic
1085789325 11:79483378-79483400 CTTACCACAAAGAAGGAGGAAGG + Intergenic
1087160768 11:94946103-94946125 CTCACACGGCAGAAGATGGAAGG + Intergenic
1088483270 11:110316486-110316508 CTCACATGACAGAAGATGGAAGG + Intergenic
1090036523 11:123254150-123254172 CTCACCCGTCAGAAGGAGGCTGG + Intergenic
1091482810 12:851608-851630 ATCAGCCCACAGCATAAGGAAGG - Intronic
1091797643 12:3306361-3306383 CGCTCCCCAGGGAAGAAGGAAGG + Intergenic
1092518583 12:9241940-9241962 CTCGCACCACAGAATAAGGAAGG + Intergenic
1093632823 12:21430501-21430523 GTCACCCCACAGTATCAGGAAGG - Intergenic
1093900876 12:24630655-24630677 CTCAGCCCAGAGGGGAAGGAGGG + Intergenic
1095709090 12:45269101-45269123 CTGGCCCCAGAGAAGAAGGGAGG - Intronic
1097240035 12:57568866-57568888 CTCAGTCCACGGAGGAAGGAAGG - Intronic
1100010578 12:89947922-89947944 CACACTCTACAGATGAAGGAAGG + Intergenic
1101170708 12:102089587-102089609 CTCACCTCCCAGACGAAGGGCGG + Intronic
1101245947 12:102884582-102884604 CCCACCCCAAAGAAGGAGGCAGG - Intronic
1101442834 12:104716243-104716265 GCCATCCCAGAGAAGAAGGACGG - Intronic
1103915100 12:124372136-124372158 CTCAAGGCAGAGAAGAAGGAGGG - Exonic
1103938139 12:124487223-124487245 CTCACTCGCCAGGAGAAGGATGG + Intronic
1104256385 12:127143044-127143066 CCCCGCCCACTGAAGAAGGATGG + Intergenic
1105287204 13:19014083-19014105 CTCACTCCACACATGCAGGAAGG + Intergenic
1106433027 13:29699736-29699758 CTCAGCCCAGAGATGCAGGATGG + Intergenic
1112463029 13:99619738-99619760 CTCACCCATCAAAAGGAGGATGG + Intronic
1113867505 13:113536915-113536937 CTCACGGCACAGCAGCAGGACGG - Intronic
1113882237 13:113633731-113633753 CCCACCCCACAGATGACGCAGGG - Intronic
1113889561 13:113728787-113728809 CTCATCCCTATGAAGAAGGAGGG + Intronic
1114193618 14:20458990-20459012 CTCATCCTACAGAGAAAGGAAGG + Intronic
1114705980 14:24726928-24726950 CCCAGCCCACTGAGGAAGGATGG - Intergenic
1117467989 14:56013511-56013533 CTGACCCTAGAGAAGAAGCAGGG + Intergenic
1118430864 14:65717506-65717528 CTCACCTCCCAGACGAAGGGCGG + Intronic
1119693400 14:76694240-76694262 CACAGCCCCCAGAAGAAAGAAGG - Intergenic
1120155417 14:81088048-81088070 CTCCCCCCAGAAAAGTAGGATGG - Intronic
1120724910 14:87927638-87927660 CACATGCCACAGAAGCAGGAAGG - Intronic
1121126003 14:91407089-91407111 CCCACCCAACAGGAGGAGGACGG + Intronic
1121816211 14:96931098-96931120 CACCCCCCAGAAAAGAAGGAGGG - Intronic
1123500235 15:20875366-20875388 CTCACCACACACATGAAAGAGGG - Intergenic
1123557481 15:21449060-21449082 CTCACCACACACATGAAAGAGGG - Intergenic
1123593708 15:21886322-21886344 CTCACCACACACATGAAAGAGGG - Intergenic
1124971015 15:34489811-34489833 ATCACCCCGCAGAATATGGAGGG - Intergenic
1125476487 15:40051167-40051189 CACAGCCAACAGAGGAAGGAGGG + Intergenic
1126936451 15:53714269-53714291 CTCACCCCTGGGAAGATGGATGG + Intronic
1127048438 15:55052914-55052936 CTCACACCACAGAAGTAGAAGGG - Intergenic
1127687697 15:61364841-61364863 CTCACCCCAGTGAGGAAGGATGG + Intergenic
1130865558 15:87930487-87930509 CTCACTCCTCAGAAGGAGGAAGG + Intronic
1132020547 15:98358148-98358170 CTCACATGACAGAAGAAGCAAGG - Intergenic
1132075339 15:98815407-98815429 CTCTCCCCACTGTAGAAGGATGG - Intronic
1132096296 15:98987573-98987595 ATCACCCCATAGAACAAGGTGGG - Intronic
1202965830 15_KI270727v1_random:176233-176255 CTCACCACACACATGAAAGAGGG - Intergenic
1132875779 16:2136253-2136275 CCCACACCACAGGAGAAGGGCGG - Intergenic
1134519206 16:14911100-14911122 CCCACACCACAGGAGAAGGGCGG + Intronic
1134554719 16:15155126-15155148 CCCACACCACAGGAGAAGGGCGG - Intergenic
1134639102 16:15814814-15814836 CACACCCCACAGAAGGTGGTGGG + Intronic
1134706876 16:16309755-16309777 CCCACACCACAGGAGAAGGGCGG + Intergenic
1134960664 16:18402369-18402391 CCCACACCACAGGAGAAGGGCGG - Intergenic
1136586331 16:31187949-31187971 CTCACCCGAGAGAAGAGAGATGG - Intronic
1137375601 16:47949388-47949410 CTCACTGCACAGAAGAAGTTGGG - Intergenic
1138110565 16:54320534-54320556 CTGTCCCCAGAGAAGATGGAAGG + Intergenic
1140351336 16:74264553-74264575 CATAACCCCCAGAAGAAGGACGG + Intergenic
1141224318 16:82100792-82100814 CTCAGGCTACAGAAGAAGCAGGG + Intergenic
1142400994 16:89858732-89858754 CTCCTCCCACAGACGATGGAAGG + Intronic
1144642275 17:16944123-16944145 GCCACTCCACAGAAGCAGGAGGG - Intronic
1145834900 17:27947178-27947200 TTCAACCAACAGAGGAAGGATGG + Intergenic
1145990124 17:29074331-29074353 CCCACCCCACACGAGAGGGAAGG + Exonic
1146917849 17:36689561-36689583 CTGACCCCACAGAGGCAGGGTGG + Intergenic
1147038218 17:37697749-37697771 CTCACCCAATAGAAGATGAAAGG - Intronic
1147443543 17:40461741-40461763 TTCAACCCACAGAAGAAAGAAGG - Intergenic
1148634923 17:49141724-49141746 CTCACCCCACCATAAAAGGAGGG - Intronic
1151361522 17:73592146-73592168 CTTGCACCACAGAAAAAGGAAGG + Intronic
1154943459 18:21137675-21137697 CTCACCTCCCAGACGAAGGGTGG + Intergenic
1159415989 18:68150417-68150439 CTCACCCCACTCAAAAAGGCAGG + Intergenic
1159852375 18:73539878-73539900 CTCAACCCAGGGAACAAGGAGGG + Intergenic
1161379223 19:3955886-3955908 GTCACCCCACTGAGGAAGGCTGG + Intergenic
1161535237 19:4815147-4815169 CAGACCCCAAAGAAAAAGGAAGG + Intergenic
1161709286 19:5838761-5838783 CACACCACGCAGCAGAAGGAAGG + Exonic
1162019798 19:7863173-7863195 CGCACCCCGCAGAGGGAGGAAGG + Exonic
1162182519 19:8879853-8879875 CTCTGCCCACTGAGGAAGGATGG - Intronic
1163720839 19:18897449-18897471 CTCACCCCACAGAGGTGAGAAGG + Intergenic
1164016616 19:21260363-21260385 CTCACCTCCCAGATGAAGGGCGG + Intronic
1165844163 19:38807516-38807538 CTCACCTCCCAGACGAAGGGCGG - Intronic
1166274920 19:41746674-41746696 GTCACCTCACAGGAGAAAGAAGG + Intronic
1167278012 19:48550487-48550509 CTCACCTAACAGATGCAGGAAGG - Intergenic
1168008344 19:53509219-53509241 CGCAGCTCACAGAGGAAGGAGGG - Intergenic
925119710 2:1408749-1408771 CTCACCAAATAGAAGTAGGAAGG + Intronic
925402030 2:3581668-3581690 TTCACCCTATAGAAGCAGGAAGG - Intergenic
926437166 2:12849890-12849912 CTCATCACACCGAAGAAGGCTGG + Intergenic
926704210 2:15825392-15825414 CTGACCCAGCAGAGGAAGGAAGG - Intergenic
931432590 2:62220134-62220156 CTCAGCCCCCTGAACAAGGAAGG + Intronic
932446934 2:71787087-71787109 CGCACCCCACGGGTGAAGGAGGG - Intergenic
933868292 2:86544977-86544999 CTCACCTCCCAGACGAAGGGCGG + Intronic
937691651 2:124762772-124762794 CTCACACCACAGAAGAGACAGGG - Intronic
937851451 2:126639711-126639733 CTCACCTCGCATACGAAGGATGG + Intergenic
938230788 2:129656991-129657013 CTTAAGCCACAGAAGAAGGTGGG + Intergenic
939119800 2:138102521-138102543 CTCATCCCACATAAGAAGCTCGG + Intergenic
939992645 2:148889685-148889707 CACACCTCCCAGAAGAAGGATGG - Intronic
942924089 2:181411498-181411520 CTCCCCCAGCTGAAGAAGGATGG - Intergenic
943592711 2:189818397-189818419 CTCACATGGCAGAAGAAGGAAGG - Intronic
943915538 2:193627589-193627611 CCCACCCCACAGCAGAGGCATGG + Intergenic
944369990 2:198971788-198971810 CTCATTCCACAAAAGAAGGTGGG + Intergenic
945311437 2:208318143-208318165 TTCACCAGACAGAAGGAGGAAGG + Intronic
945985678 2:216351761-216351783 CTCATCTCAAAGATGAAGGAAGG + Intronic
946711493 2:222511517-222511539 CTCAACCCAAAGAAGTATGATGG + Intronic
947514147 2:230786343-230786365 CCCACCCCCCAAAAAAAGGAAGG - Intronic
947961122 2:234238324-234238346 CTCTCCTCCCAGAAGAAGCAAGG + Intergenic
948410314 2:237754883-237754905 CTCACTCCAGAGAAGCTGGATGG + Intronic
1169264213 20:4157831-4157853 CTCACACCACAGAGGAAAGGAGG - Intronic
1169470207 20:5878489-5878511 CTCACACCACAGAACTAGAATGG - Intergenic
1169902475 20:10567403-10567425 CTCACACGGCAGAAGGAGGAAGG - Intronic
1170509640 20:17063558-17063580 CTCACCCAACAGAGGATGGAAGG - Intergenic
1170800546 20:19586549-19586571 CTCACCCCACAGCAGCGGCAAGG + Intronic
1171051158 20:21860484-21860506 CTCAACCCACTGAAGAGGGCAGG + Intergenic
1172125730 20:32624142-32624164 CTTAACCCACAGTAGAGGGAGGG - Intergenic
1172188747 20:33048970-33048992 CCCATGCCACAGAGGAAGGAGGG + Intergenic
1173162807 20:40664625-40664647 GTCAGCTCACAGAAGAGGGAGGG - Intergenic
1173564063 20:44026822-44026844 CTCACCCCACAGAAGAAGGAAGG - Intronic
1174362480 20:50037682-50037704 CTCACCCCGCAGAAGAAGATGGG - Intergenic
1174442700 20:50568706-50568728 CGCACCACACAGGAGAAGGCGGG - Intronic
1176042480 20:63072707-63072729 CACTCCCCACAGAGGAAGGGAGG + Intergenic
1176300891 21:5098451-5098473 CTCACCCCACAGAAGGATCTGGG - Intergenic
1178318951 21:31590381-31590403 CTCCCCCCACAGCAGGAGGATGG + Intergenic
1179606962 21:42522919-42522941 GTCACCCCGCAGAGGAAGGCAGG + Intronic
1179856145 21:44163502-44163524 CTCACCCCACAGAAGGATCTGGG + Intergenic
1180749713 22:18115888-18115910 TTCACCCCCCAGAAGAAGTTGGG + Intronic
1180785362 22:18544042-18544064 CTAACCCAAGAGATGAAGGACGG - Intergenic
1181242266 22:21483395-21483417 CTAACCCAAGAGATGAAGGACGG - Intergenic
1182349675 22:29692260-29692282 CTGCCCACACAGAAGTAGGAAGG - Intronic
1182685441 22:32119546-32119568 CTCAGGCCCCAGAAGGAGGAGGG + Intergenic
1183477314 22:38042736-38042758 CTGACCACACAGAAGAGGGCTGG + Intergenic
1183759744 22:39805270-39805292 TTCACCTCACAGCTGAAGGATGG + Intronic
1184346367 22:43915965-43915987 CTCACACTGCAGAAGATGGAAGG - Intergenic
1184804965 22:46788883-46788905 CTCACTCCACAGAGGAAGATTGG - Intronic
1184857778 22:47155965-47155987 CACACACCACAGACGTAGGAGGG - Intronic
950554510 3:13687141-13687163 CTCCCTCCACACAAGGAGGAAGG - Intergenic
953743128 3:45554042-45554064 TTAGCCTCACAGAAGAAGGAAGG - Intergenic
954654823 3:52187649-52187671 CTCACCCCACATAAGGAAGCAGG + Intergenic
954684934 3:52365251-52365273 CTCAGCCCACACGGGAAGGAGGG - Intronic
954751031 3:52813793-52813815 GTGACCCCACAAAAGATGGATGG - Intronic
957742558 3:84290559-84290581 CTCTCTCCAGAGAAGAATGATGG + Intergenic
957769832 3:84676299-84676321 CACACCCCACAGAAGTTGGATGG + Intergenic
958406861 3:93763384-93763406 CCCACCTCCCAGAAGAAGGGTGG + Intergenic
958407042 3:93764027-93764049 CTCACCTCCCAGAAGATGGGCGG + Intergenic
959408917 3:105996784-105996806 CTCACCACACAGAATAAATAAGG - Intergenic
960413749 3:117359142-117359164 CCCTGCCCACTGAAGAAGGATGG - Intergenic
961145943 3:124593399-124593421 CTCACCCCACAACTGAGGGATGG + Intronic
961498582 3:127314057-127314079 CTCCCCCCACAGAAGACTGCAGG + Intergenic
962141088 3:132791630-132791652 CCCACCCCACAAAAGGAGGATGG - Intergenic
962453696 3:135545506-135545528 CTCACACTACAGAAGATGGAAGG - Intergenic
962856914 3:139355262-139355284 TTCATCCCACATAAGCAGGAGGG - Intronic
962906412 3:139807349-139807371 CTCTTCCCAAAGAAGTAGGAAGG + Intergenic
963117645 3:141745497-141745519 CACACACCACAGAGGTAGGAAGG - Exonic
963225365 3:142856603-142856625 CCGAACCCACAGAAGCAGGAAGG + Intronic
964485118 3:157178800-157178822 CTCACCTCCCAGAAGAAGGGCGG + Intergenic
964485195 3:157179108-157179130 CTCACCTCCCAGACGAAGGGTGG + Intergenic
964485261 3:157179369-157179391 CTCACCTCCCAGACGAAGGGTGG + Intergenic
964526031 3:157616077-157616099 CCCATCCCAAAGAAGAAGAAAGG - Intronic
966475648 3:180342407-180342429 CTTACCCCACAGATGGAGAAGGG - Intergenic
966694800 3:182778611-182778633 CTCACCCCAAAGCAGCAGCAGGG - Intergenic
968401857 4:305060-305082 CTCACCCCACAGCCCAGGGAAGG + Intronic
968410579 4:386541-386563 CTCACCCCACAGCCCAGGGAAGG - Intergenic
968952210 4:3701086-3701108 TTCATCCCTCAGAAGAAGAAGGG - Intergenic
969566104 4:7979157-7979179 TTAACCCCACAGAAGAGGAAAGG - Intronic
969833302 4:9816532-9816554 CTCACCACACATAAAAAGAAAGG + Intronic
970280098 4:14445569-14445591 CCCACCCCTCAGAAGAACAAAGG - Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
970407143 4:15774631-15774653 ACCACCTCACAGAAGAAAGATGG - Intergenic
970863063 4:20725998-20726020 TCCACTCCACAGAAGAAGAAAGG - Intronic
971448992 4:26782142-26782164 ATCACCCCGCAGAGGCAGGATGG + Intergenic
972641954 4:40933393-40933415 CTCAACCCACAGCAGATGGGTGG + Intronic
973021395 4:45208318-45208340 CTCACCTCCCAGATGAAGGGCGG - Intergenic
973618677 4:52706025-52706047 CTCACCCCACAGCAGAGGTCAGG + Intergenic
973785499 4:54328976-54328998 CTCAGCCCACAGTAGAAAAAGGG - Intergenic
974848739 4:67381280-67381302 CTCACCTCCCAGATGAAGGGTGG - Intergenic
975357764 4:73428251-73428273 CTCTCCCCACACAAACAGGATGG - Intergenic
976536567 4:86223990-86224012 GTCACCCTCCAGAGGAAGGATGG - Intronic
976878630 4:89890118-89890140 CTACCCCAACAGAAGAATGAGGG + Intronic
978420091 4:108522833-108522855 CTCATCCCTCACAAGAAGAATGG + Intergenic
978593759 4:110354910-110354932 CCCACCACACAGAAGAATGTAGG - Intergenic
981367765 4:143923164-143923186 CTCACATGGCAGAAGAAGGAAGG - Intergenic
983621057 4:169761184-169761206 CTCAACCCACTGAAGAGGTATGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984038973 4:174705263-174705285 ATCACCCCACAGAAGACAGAAGG - Intronic
985041690 4:185897300-185897322 CCCACCCCACACCAGAAGGAAGG + Intronic
985832035 5:2240884-2240906 CTCTCCCGGCAGAAGCAGGAGGG - Intergenic
986433879 5:7709200-7709222 CTCACCCCAAGGGAGAACGACGG + Exonic
987466834 5:18282061-18282083 CTCTCCAGACAGAAGGAGGAGGG - Intergenic
991221632 5:64225521-64225543 CTCACCTCCCAGACGAAGGGCGG - Intronic
991970283 5:72134376-72134398 CTTACCCTGCAGAAGAAGGGAGG - Intronic
992447946 5:76850718-76850740 CTCAGCCTACAGAAGAAGAGAGG + Intronic
993033164 5:82727895-82727917 CTCACTTTACAGAAGAAAGAGGG + Intergenic
996281814 5:121739265-121739287 CTCACCCCAAGGAAGAATGAAGG - Intergenic
996410642 5:123155327-123155349 CTCACCTCAAAGAAGATGTAGGG - Intronic
997026106 5:130063765-130063787 CTCACCTGGCAGAAGATGGAAGG + Intronic
998824466 5:146086924-146086946 CTCATCCCACAGAACACTGATGG - Intronic
999142579 5:149372142-149372164 CTCACCCCACAGAAAAGGCTTGG + Intronic
1000992790 5:167928110-167928132 CATACCCCAGAGAAGAAGGAGGG - Intronic
1001114700 5:168929895-168929917 GACACCCCACAGAATAAGGCAGG - Intronic
1001408695 5:171495263-171495285 CATGCCCCACAGAGGAAGGAAGG + Intergenic
1001506206 5:172283151-172283173 CCAACTCCACAGAACAAGGAAGG + Intronic
1002907788 6:1464875-1464897 CTAACCCCACACAATAAGCAGGG + Intergenic
1003596912 6:7481907-7481929 ATCACCCCACAGAATATGGAGGG - Intergenic
1004274617 6:14224709-14224731 CTCACCCCGCAGAAGAAGGAAGG - Intergenic
1004497970 6:16182254-16182276 CTCAACCCACCGAAGAAGGGAGG + Intergenic
1004583848 6:16980249-16980271 TTCTCCCCACCGTAGAAGGATGG + Intergenic
1005335622 6:24793297-24793319 CTCACTCCCCAGAAGAAGAAGGG - Intergenic
1009392829 6:63164259-63164281 CCCACCTCCCAGACGAAGGACGG - Intergenic
1009639201 6:66308698-66308720 ATCACCCCTCAGAGGAGGGATGG + Intergenic
1011346810 6:86379210-86379232 GTCACCCCACAGAAGTGGGATGG - Intergenic
1014369265 6:120584338-120584360 CCCCACCCACTGAAGAAGGATGG + Intergenic
1014923344 6:127239538-127239560 CTCACCCCACTGGTGAAGAAGGG - Intergenic
1015479623 6:133693316-133693338 CCCATCCCACACAAAAAGGATGG + Intergenic
1017518800 6:155183221-155183243 CTCAGCCCTGAGAAAAAGGAAGG - Exonic
1017855657 6:158348893-158348915 CTCACCTCCCAGACGAAGGGCGG + Intronic
1017855668 6:158348932-158348954 CTCACCTCCCAGATGAAGGGCGG + Intronic
1017855825 6:158349502-158349524 CTCACCTCCCAGACGAAGGGTGG + Intronic
1018089974 6:160337856-160337878 CTAAGCCCACAGAAAAAGTATGG - Intergenic
1019163171 6:170082305-170082327 ACCACCCCACAGCAGAAGGTGGG - Intergenic
1020594193 7:10183646-10183668 CTTTACCCACAGAAGAAGGGAGG + Intergenic
1023091141 7:36618621-36618643 CTCACCCCTCAGAGCATGGAGGG + Intronic
1023373210 7:39532204-39532226 CTCACCCCACAATAGAAGTTTGG + Intergenic
1026185835 7:68082146-68082168 CTCACCTCCCAGATGAAGGGCGG - Intergenic
1026185885 7:68082330-68082352 CTCACCTCCCAGATGAAGGGCGG - Intergenic
1026185906 7:68082406-68082428 CTCACCTCCCAGATGAAGGGTGG - Intergenic
1026664956 7:72334320-72334342 CACACACCACAACAGAAGGAAGG + Intronic
1026767957 7:73172395-73172417 CTAACCCCAAAGAAGAAGTGTGG - Intergenic
1026937278 7:74265170-74265192 CTGACCCCAGAGACGATGGATGG + Intergenic
1027044423 7:74982105-74982127 CTAACCCCAAAGAAGAAGTGTGG - Intronic
1027045337 7:74987437-74987459 ATCCTCCCATAGAAGAAGGAAGG + Intronic
1027079216 7:75220255-75220277 CTAACCCCAAAGAAGAAGTGTGG + Intergenic
1028548270 7:92027506-92027528 CTCACCTCCCAGACGAAGGGCGG - Intronic
1029001535 7:97160028-97160050 CTCACCTCCCAGACGAAGGGTGG - Intronic
1029127895 7:98307722-98307744 CTCATCCCCGAGGAGAAGGATGG - Exonic
1029388448 7:100258835-100258857 CTAACCCCAAAGAAGAAGCGTGG + Intronic
1029666095 7:101996198-101996220 CTTACCCCACAGACCCAGGAAGG + Intronic
1031022021 7:116638723-116638745 CTCACCTCCCAGACGAAGGGCGG - Intergenic
1031185942 7:118480519-118480541 CTCACATGACAGAAGAAAGAAGG + Intergenic
1032129528 7:129216652-129216674 CTCACCTCCCAGACGAAGGGGGG - Intergenic
1032189025 7:129752258-129752280 CTCACCCCAGTGTAAAAGGAAGG + Intronic
1032422472 7:131793711-131793733 GTGACCCCAAAGCAGAAGGAGGG - Intergenic
1032508340 7:132452629-132452651 CTCTCCCCACAGAAGCGAGAGGG - Intronic
1035395259 7:158530799-158530821 CTCGCCCCTCAGGAGCAGGAAGG - Intronic
1037573040 8:20174671-20174693 GTCACCACACAGCAGATGGAAGG + Intronic
1037754180 8:21700725-21700747 CTTCCCCCAAGGAAGAAGGAAGG + Intronic
1038275506 8:26117667-26117689 CTGGCCCCAAAGAAGAAGGCTGG - Intergenic
1038393424 8:27227489-27227511 TTAACCCCAAAGTAGAAGGAAGG - Intergenic
1038408312 8:27339352-27339374 CTCACCCCAGAGAAGGTAGAAGG - Intronic
1039428339 8:37505491-37505513 CACATCCCACAGAAGGAGGGAGG + Intergenic
1039941829 8:42097914-42097936 CCCAACCCACAGAAGATGGGTGG - Intergenic
1040916856 8:52573149-52573171 CTCACCTCCCAGATGAAGGGCGG + Intergenic
1041662466 8:60413265-60413287 CTCACACCACAGACGAACGAAGG + Intergenic
1041708774 8:60874456-60874478 CTCACACAACACTAGAAGGAAGG - Intergenic
1043853429 8:85239698-85239720 CCCACCCCAAAGAAGAATCAGGG + Intronic
1045666475 8:104492567-104492589 TTCCCCTCACAGAAGAAAGAAGG + Intronic
1046984344 8:120370723-120370745 CTCTCCCCACACAGGATGGATGG + Intronic
1047032257 8:120895666-120895688 CTTACCACACTGAATAAGGATGG - Intergenic
1049316912 8:141974270-141974292 CCTACCCCACAGAAGCATGATGG + Intergenic
1051250800 9:15157064-15157086 CTCCCCCCAGAGAAGAAGGCAGG + Intergenic
1052347594 9:27425974-27425996 TTCACCCAGCAGAAGGAGGAGGG + Intronic
1052643288 9:31197703-31197725 ATCATCCCACAGAGGTAGGATGG + Intergenic
1053453240 9:38210949-38210971 CCCACCACACAGAGAAAGGAAGG + Intergenic
1056094921 9:83243059-83243081 GTCACTTCACAGAAGAAGAAAGG - Intronic
1056131014 9:83586514-83586536 CTCAGGCCACAGAGGCAGGAAGG + Intergenic
1057515636 9:95718079-95718101 CTGACCACACATAAGATGGAGGG + Intergenic
1057672626 9:97107532-97107554 GTCACCCCAAAAAAGCAGGAGGG + Intergenic
1057896560 9:98913549-98913571 CTCATGCCACAGAGGAAGGTAGG + Intergenic
1057959136 9:99438078-99438100 CTCAGCACCCAGAAGATGGAAGG + Intergenic
1058049708 9:100393217-100393239 CTCACCTCCCAGACGAAGGGTGG - Intergenic
1059285864 9:113170995-113171017 CTCTAACCACAGAAGAAGAATGG - Intronic
1059749313 9:117232960-117232982 CTCATCCCTGAGCAGAAGGAAGG - Intronic
1060682991 9:125582273-125582295 CTCACCAAACAGATGAAGGAAGG - Intronic
1060743861 9:126117117-126117139 CTCAGCCGCCAGAAGCAGGAGGG + Intergenic
1186594315 X:10964426-10964448 CCCACGTCACAGAAAAAGGAAGG + Intergenic
1188615393 X:32152109-32152131 CTCATTCAACAGAAGAAAGAAGG + Intronic
1188894036 X:35644296-35644318 CTCACCTCACACAAAAAAGATGG + Intergenic
1190398254 X:50006500-50006522 CTCACCCCACAGTAAAACCAGGG - Intronic
1194973245 X:100367577-100367599 CTCACAAGACAGAAGATGGAAGG + Intronic
1195001165 X:100644707-100644729 CTCAGCCCACAGCAGAGGGATGG + Intronic
1196020876 X:110989795-110989817 CTCAACCCTCAGCAGAAGGGAGG - Intronic
1196820381 X:119695753-119695775 CACACCCCACCGAAGGAGGCTGG - Intergenic
1201641643 Y:16184639-16184661 TTCACCACCCAGAAGAGGGAGGG + Intergenic
1201661172 Y:16400683-16400705 TTCACCACCCAGAAGAGGGAGGG - Intergenic
1202028880 Y:20552164-20552186 CTCACCTCCCAGACGAAGGGCGG - Intergenic
1202029006 Y:20552571-20552593 CTCACCTCCCAGAAGATGGGCGG - Intergenic