ID: 1173564504

View in Genome Browser
Species Human (GRCh38)
Location 20:44029291-44029313
Sequence GGTGCTTGTTATCACCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173564504_1173564509 6 Left 1173564504 20:44029291-44029313 CCTGCTTGGTGATAACAAGCACC 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1173564509 20:44029320-44029342 TTTCAGGCACTCTGTAACCGTGG 0: 1
1: 0
2: 0
3: 5
4: 121
1173564504_1173564512 20 Left 1173564504 20:44029291-44029313 CCTGCTTGGTGATAACAAGCACC 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1173564512 20:44029334-44029356 TAACCGTGGGTAAGAGGATGTGG 0: 1
1: 0
2: 1
3: 5
4: 88
1173564504_1173564514 25 Left 1173564504 20:44029291-44029313 CCTGCTTGGTGATAACAAGCACC 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1173564514 20:44029339-44029361 GTGGGTAAGAGGATGTGGTGAGG 0: 1
1: 0
2: 0
3: 44
4: 431
1173564504_1173564511 14 Left 1173564504 20:44029291-44029313 CCTGCTTGGTGATAACAAGCACC 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1173564511 20:44029328-44029350 ACTCTGTAACCGTGGGTAAGAGG 0: 1
1: 0
2: 1
3: 7
4: 95
1173564504_1173564510 7 Left 1173564504 20:44029291-44029313 CCTGCTTGGTGATAACAAGCACC 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1173564510 20:44029321-44029343 TTCAGGCACTCTGTAACCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 67
1173564504_1173564505 -10 Left 1173564504 20:44029291-44029313 CCTGCTTGGTGATAACAAGCACC 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1173564505 20:44029304-44029326 AACAAGCACCATACCCTTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173564504 Original CRISPR GGTGCTTGTTATCACCAAGC AGG (reversed) Intronic
901322042 1:8345902-8345924 GGTCCCTGTTGTCGCCAAGCTGG + Intergenic
910721812 1:90295010-90295032 GCTCCTTGTTGTCACCAAGGTGG + Intergenic
910821417 1:91353116-91353138 GGTGCTGCTTATCATCATGCTGG - Exonic
911786663 1:101958607-101958629 GGTGTTTGTGATCTCCAATCAGG + Intronic
913294090 1:117302007-117302029 GGTCCTTGTGCTCACCCAGCAGG - Intergenic
920328629 1:205187645-205187667 GGTGCTTCCCACCACCAAGCTGG - Exonic
921949852 1:220918024-220918046 GGTTTTTGTTTACACCAAGCAGG - Intergenic
923384451 1:233452797-233452819 GGAGCTGGTTTTCACCAAGTAGG - Intergenic
1064749621 10:18513850-18513872 GTTGTTTGTTATCTCAAAGCTGG + Intronic
1065820020 10:29516840-29516862 TGTCCTTGTTCTCAACAAGCAGG - Intronic
1065952897 10:30668045-30668067 AGTCCTTGTTCTCACCAAGCAGG + Intergenic
1069071873 10:63998010-63998032 GGTGCATGGTATCTCCATGCAGG - Intergenic
1070465736 10:76721692-76721714 GGTGATTCTTATAATCAAGCTGG - Intergenic
1075445622 10:122510628-122510650 TGTGCTTGTTTTCCCCGAGCTGG + Intronic
1081849388 11:46264815-46264837 GGTGCTTGCCATCTCAAAGCGGG + Intergenic
1093788443 12:23218873-23218895 GCTTCTTGTCGTCACCAAGCTGG - Intergenic
1094527646 12:31242989-31243011 GGTGCTTGTTTTCCCCATCCAGG - Intergenic
1100285718 12:93164685-93164707 GGTGCTTGCTGTCAGAAAGCCGG - Intergenic
1107574325 13:41701042-41701064 GGTTCATGTAATCACCAAACTGG + Intronic
1107990288 13:45813435-45813457 AGGGCTTGTGGTCACCAAGCTGG - Intronic
1109672554 13:65628042-65628064 GGTGCTCATTCTCACTAAGCCGG - Intergenic
1113310442 13:109127069-109127091 TGTGCTTTTCATCACAAAGCCGG + Intronic
1117494911 14:56293571-56293593 GCTGGTTGTTATTACTAAGCAGG + Intronic
1123126933 14:105953602-105953624 GGTGCTTGGCATCCCCATGCAGG - Intergenic
1124659223 15:31531808-31531830 GGTGCTTATTACCACCCAGTGGG - Intronic
1131481067 15:92782294-92782316 GGAGCTTGTCACCAACAAGCTGG - Intronic
1133932028 16:10240502-10240524 ACTGCTTATTATCACCAAGGAGG + Intergenic
1134174937 16:11998051-11998073 GGTGGTTGTTATCAACCAGCTGG + Intronic
1139131133 16:64147085-64147107 GGGGCTTCTTATCAGAAAGCAGG + Intergenic
1142165016 16:88581815-88581837 GGAGCTTGTCATCTCCCAGCAGG - Intronic
1151481014 17:74370101-74370123 CGTGCTTGTAATCAGCAACCTGG - Intronic
1154380478 18:13845676-13845698 GGGGCTCTTTATCACCAGGCAGG - Intergenic
1156102152 18:33609329-33609351 GGTGCTTTTTATGTCCAAGTTGG - Intronic
1156935734 18:42704697-42704719 AGTGCTTGTTATCTCAAAGTGGG + Intergenic
1157953295 18:52064673-52064695 GGGGCTTGTTATCATCTAGCAGG - Intergenic
1159564316 18:70031856-70031878 GGTGCTTGGTAGCCCCGAGCAGG - Intronic
1160670868 19:362352-362374 GGTGCTGGATGTCACCAAGAAGG - Exonic
941705561 2:168655134-168655156 GGTGCTCAATATCACTAAGCAGG + Intronic
942383089 2:175413180-175413202 AGTGCTTGTCTGCACCAAGCTGG + Intergenic
1172597086 20:36156865-36156887 GGTGCTTGTTAGCACCTGCCGGG + Intronic
1173564504 20:44029291-44029313 GGTGCTTGTTATCACCAAGCAGG - Intronic
1176247457 20:64104284-64104306 GGGGCTTGTAATCAGCCAGCAGG - Intergenic
1179916806 21:44482994-44483016 AGTGCTTGTTAAAACCATGCTGG + Intergenic
1181824266 22:25501552-25501574 GTTTCTTGTTATTACCAAGTGGG + Intergenic
1184343004 22:43896334-43896356 GGTGCTTGGTGTTACCAAGTGGG + Intergenic
949507837 3:4743539-4743561 TGTGCCTCTTATCACCAACCTGG - Intronic
949965767 3:9354743-9354765 GGTGCTTGTTCCCACAAACCTGG - Intronic
952595154 3:35008619-35008641 GGTGGTTGTTACAACCAAGAAGG - Intergenic
953960752 3:47264001-47264023 GGTCCTTGTCTTCACAAAGCTGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955750164 3:62178870-62178892 GGTGCTTGTGAACAGCAATCTGG + Intronic
961559360 3:127718068-127718090 GATGCTGGTTTTCAACAAGCTGG - Intronic
967352603 3:188530634-188530656 GGTCGTGGTTATCATCAAGCTGG - Intronic
970251671 4:14122928-14122950 GGAGCTTGTTATCATAAATCAGG - Intergenic
981676119 4:147345011-147345033 GGTGGTTGTTATCCTCAAGAGGG - Intergenic
981694131 4:147542314-147542336 AGAGCCTGTTATCACCAGGCAGG - Intronic
982156544 4:152527748-152527770 GTTGCTTGTTGTCACCAGGCTGG - Intronic
985231655 4:187824694-187824716 GCTGCTTGTTATCTCCAAGCTGG + Intergenic
986301425 5:6481352-6481374 GGTGCTCATTATCCCCATGCAGG + Intronic
990134744 5:52631566-52631588 GGTGCTTGGTAACCCCATGCAGG + Intergenic
1000136040 5:158351953-158351975 GATGCTTTTTGTCACCAGGCTGG - Intergenic
1013251177 6:108334949-108334971 GGAGCATGTGGTCACCAAGCAGG - Intronic
1013668407 6:112371867-112371889 TGAGCTTGTTAACTCCAAGCAGG - Intergenic
1018163641 6:161073036-161073058 GGTACTTTTTACCACAAAGCAGG - Intronic
1019022937 6:168934003-168934025 GGTGCATGTTAGCACTGAGCGGG - Intergenic
1030903715 7:115155991-115156013 GGTGGTTATTATGGCCAAGCAGG + Intergenic
1032189863 7:129758502-129758524 GGTGCTGATTGTCACCATGCAGG + Intergenic
1035785890 8:2260798-2260820 GGTGCTTGCTAACATCAGGCCGG - Intergenic
1035806917 8:2460918-2460940 GGTGCTTGCTAACATCAGGCCGG + Intergenic
1035949855 8:4008033-4008055 TTTGCTTGTTTTCAGCAAGCAGG + Intronic
1039096616 8:33893783-33893805 GGAGGGTGTTAACACCAAGCTGG + Intergenic
1042847655 8:73184834-73184856 GGAGCTTATTATCTCCAAGCAGG - Intergenic
1046273136 8:111921984-111922006 GAGGCTTGTTATAACCTAGCAGG + Intergenic
1047399094 8:124531064-124531086 ACTACTTGTCATCACCAAGCTGG + Intronic
1053087371 9:35237193-35237215 GGTCCATGTTAACACCAAACAGG - Intronic
1062153356 9:135032794-135032816 GGTGATTTTTTTCACCAAACAGG + Intergenic
1187719322 X:22134868-22134890 GGTGATTGTTATCACTAGGCAGG + Intronic
1189599214 X:42604137-42604159 AGTGCTTCTTATGACCAGGCAGG + Intergenic
1189897652 X:45672824-45672846 GGTGCTTCATAGCACCATGCAGG - Intergenic
1190460456 X:50668205-50668227 GCTCCTTGTTACCGCCAAGCGGG - Intronic
1192829390 X:74735370-74735392 CATGCTTGCTATTACCAAGCTGG - Exonic
1195300473 X:103525059-103525081 GATGCTTTGTTTCACCAAGCTGG - Intergenic
1199757364 X:150877624-150877646 GGCTCTTGTTATGCCCAAGCTGG - Intronic