ID: 1173564655

View in Genome Browser
Species Human (GRCh38)
Location 20:44030110-44030132
Sequence TCCAAGTGGGGGTTTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173564655_1173564664 9 Left 1173564655 20:44030110-44030132 CCACCTGGAAACCCCCACTTGGA No data
Right 1173564664 20:44030142-44030164 CAAGTTCAGCTGTCTACAGCTGG No data
1173564655_1173564665 27 Left 1173564655 20:44030110-44030132 CCACCTGGAAACCCCCACTTGGA No data
Right 1173564665 20:44030160-44030182 GCTGGCCACTCTCCCCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173564655 Original CRISPR TCCAAGTGGGGGTTTCCAGG TGG (reversed) Intronic