ID: 1173565580

View in Genome Browser
Species Human (GRCh38)
Location 20:44036035-44036057
Sequence CATGGTTACAAGCCCTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173565580_1173565591 19 Left 1173565580 20:44036035-44036057 CCTTGGAAGGGCTTGTAACCATG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1173565591 20:44036077-44036099 CCACAGGCAATTCCTGGAGAGGG 0: 1
1: 2
2: 5
3: 43
4: 282
1173565580_1173565589 18 Left 1173565580 20:44036035-44036057 CCTTGGAAGGGCTTGTAACCATG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1173565589 20:44036076-44036098 GCCACAGGCAATTCCTGGAGAGG 0: 1
1: 1
2: 3
3: 27
4: 194
1173565580_1173565586 3 Left 1173565580 20:44036035-44036057 CCTTGGAAGGGCTTGTAACCATG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1173565586 20:44036061-44036083 GAAGCAGCTCCATCAGCCACAGG 0: 1
1: 0
2: 4
3: 14
4: 201
1173565580_1173565588 13 Left 1173565580 20:44036035-44036057 CCTTGGAAGGGCTTGTAACCATG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1173565588 20:44036071-44036093 CATCAGCCACAGGCAATTCCTGG 0: 1
1: 0
2: 2
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173565580 Original CRISPR CATGGTTACAAGCCCTTCCA AGG (reversed) Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
903579111 1:24357811-24357833 AAGGCTTACAGGCCCTTCCATGG - Exonic
904068976 1:27778091-27778113 AATGGGTACAAGTCCTTGCAGGG - Intronic
907085012 1:51663748-51663770 CATGGGTATGAGCCCTTCAATGG - Intronic
909762449 1:79308338-79308360 CATGGTCAGAAGCTCTTTCATGG + Intergenic
914901540 1:151713838-151713860 GATTGTCCCAAGCCCTTCCATGG - Intronic
918052542 1:180987091-180987113 CATGCTGACAAGGCCTTCCCTGG + Intronic
918154304 1:181830882-181830904 CATGGTTACAGGGCCTTGTATGG - Intergenic
918572205 1:186010096-186010118 CATGGATCCGAACCCTTCCATGG + Intronic
919082731 1:192886471-192886493 CATGGTGGCAGGCGCTTCCAAGG + Intergenic
920457977 1:206115863-206115885 CAGGGTTACAATGCCTCCCAGGG - Intronic
920797908 1:209158447-209158469 AATGTTTACAACCACTTCCAGGG + Intergenic
922880294 1:228975520-228975542 CATGGCTCCAAGCCCTGCCTAGG + Intergenic
923904598 1:238369874-238369896 CATGGGGACAGGCCTTTCCAAGG - Intergenic
1064118239 10:12597098-12597120 CAAGGTTACAAGCTCCTGCACGG - Intronic
1070491236 10:76978768-76978790 CATGGGTGTGAGCCCTTCCAGGG - Intronic
1072734368 10:97869155-97869177 CATGGCTCCAAGTCCTTCCCTGG - Exonic
1075242821 10:120793460-120793482 CCTGATTAGAAGCCCTTCTAAGG - Intergenic
1079250039 11:18780543-18780565 TGTGGTTTCCAGCCCTTCCAAGG + Intronic
1080355386 11:31438419-31438441 CATGGATACAAGTCCTTTGATGG + Intronic
1087682627 11:101233307-101233329 CATGGTTACAGGGCCTTGTATGG + Intergenic
1089001371 11:115054967-115054989 CATGGTGACAAACCTTTCCCTGG - Intergenic
1089227391 11:116937139-116937161 CATGGATATAAACCCATCCATGG - Intronic
1094664193 12:32502102-32502124 CATGGTAACCAGCCCTCCTAAGG - Intronic
1095315259 12:40753101-40753123 CATGGTTGCAGGCCCCTGCAAGG - Intronic
1095396882 12:41771854-41771876 CATGGAGCCAGGCCCTTCCATGG + Intergenic
1100318834 12:93470857-93470879 CATGGAAACAAGCCCATCAATGG - Intronic
1101207634 12:102504632-102504654 CACGGTTATAACCCTTTCCAGGG - Intergenic
1106659551 13:31784406-31784428 CATGGCAACAAACCCATCCAGGG + Intronic
1107015949 13:35707796-35707818 CAAGGTCACACCCCCTTCCAGGG + Intergenic
1107407809 13:40131044-40131066 CATGGAGACAAGATCTTCCATGG + Intergenic
1108795144 13:54021839-54021861 CAAGTTTACAAGTTCTTCCATGG + Intergenic
1111924199 13:94445710-94445732 CATGGTTACCAGCACATGCAGGG + Exonic
1112816209 13:103276681-103276703 GAAGCTTTCAAGCCCTTCCAAGG + Intergenic
1114132430 14:19807528-19807550 CAGGGTTTCAATCTCTTCCAGGG - Intronic
1115397082 14:32920376-32920398 CATGAATACTTGCCCTTCCATGG - Intergenic
1115583538 14:34786894-34786916 CATGGTGACCAGCCCTTTTATGG + Intronic
1117472366 14:56058963-56058985 CATGGTTGAAATCACTTCCATGG + Intergenic
1117506937 14:56413765-56413787 CAAGGTTACACTTCCTTCCAAGG + Intergenic
1119711847 14:76828154-76828176 CAAGGTGCCAAGCCCTGCCAGGG - Intronic
1121693687 14:95895615-95895637 AATGATTTAAAGCCCTTCCAAGG + Intergenic
1122453537 14:101831959-101831981 CATGGTTCCAAGGCTATCCATGG - Intronic
1123575503 15:21663284-21663306 CAGGGTTTCAATCTCTTCCAGGG - Intergenic
1123612123 15:22105756-22105778 CAGGGTTTCAATCTCTTCCAGGG - Intergenic
1124415155 15:29467582-29467604 CCTAGTTATAGGCCCTTCCAAGG + Intronic
1124633813 15:31352581-31352603 CATGCTGACAGGCCCTTCCACGG - Intronic
1128530530 15:68442252-68442274 CACTGTGCCAAGCCCTTCCAAGG - Intergenic
1131613341 15:93987976-93987998 CTTGGTTATGAGCCCTTTCAAGG - Intergenic
1202984371 15_KI270727v1_random:397529-397551 CAGGGTTTCAATCTCTTCCAGGG - Intergenic
1132467773 16:85437-85459 CATGGTCTCCAGACCTTCCAGGG - Exonic
1134127221 16:11624400-11624422 CATGATAACAAGCCCCTCCCTGG + Intronic
1136776758 16:32875908-32875930 CATGGTGCCCAGCCCTTTCAGGG + Intergenic
1137433542 16:48437267-48437289 TATGGTTCCAAGCCCTTCTGTGG - Intronic
1140382608 16:74504083-74504105 CATGGTTACAAGGACTTCATAGG - Intronic
1141756852 16:85997029-85997051 CAGGGTGCCAGGCCCTTCCAGGG - Intergenic
1203079173 16_KI270728v1_random:1138017-1138039 CATGGTGCCCAGCCCTTTCAGGG + Intergenic
1147156048 17:38544916-38544938 CATGGGCACAGGCCCTGCCATGG - Intronic
1149410317 17:56398287-56398309 CATGTTCACAGGCACTTCCAGGG - Intronic
1151086127 17:71382938-71382960 CATGGTTAGAAGGGCTTCAAAGG - Intergenic
1153740971 18:8127311-8127333 AATGCTTAGAATCCCTTCCAGGG + Intronic
1157674133 18:49555913-49555935 CATGCTTACACCGCCTTCCATGG - Intergenic
1166567243 19:43772671-43772693 CAATGTTTCAACCCCTTCCATGG - Intronic
1167356128 19:49005377-49005399 CATGGACACGATCCCTTCCAAGG + Intronic
926296677 2:11573982-11574004 CAGGCTTAGAAGCCCTTCCAGGG + Intronic
927649127 2:24900614-24900636 CATGGTTTCCAGACCTTACATGG - Intronic
928875152 2:36029588-36029610 CATAGTTCTAAGTCCTTCCATGG + Intergenic
930763067 2:55057080-55057102 CATGTTTCAAAGCCCATCCATGG + Intronic
933821110 2:86112868-86112890 CATTTCAACAAGCCCTTCCAGGG - Intronic
933942344 2:87254955-87254977 CATGGGCACAGGCCCTTCCCAGG + Intergenic
934140627 2:89043910-89043932 CATGTTTACAGGACCTTCTAAGG + Intergenic
936012894 2:108936399-108936421 CATGGGCACAAGCTCTTCCATGG + Intronic
936337882 2:111606614-111606636 CATGGGCACAGGCCCTTCCCAGG - Intergenic
944001660 2:194846060-194846082 CATGATTACAAGACCATGCATGG - Intergenic
944981463 2:205125637-205125659 CATGGCCACAAGCTCTTCCTGGG - Exonic
1169741320 20:8897947-8897969 CATTGTTACAAACCCTTCTAGGG + Intronic
1170049128 20:12122283-12122305 CCTGGTTAGAAGCCCTTAGATGG - Intergenic
1170398690 20:15956758-15956780 TATGCTAGCAAGCCCTTCCAGGG + Intronic
1173513240 20:43646737-43646759 AGTGGTCACAAGCCCTGCCATGG + Intronic
1173565580 20:44036035-44036057 CATGGTTACAAGCCCTTCCAAGG - Intronic
1176929630 21:14792537-14792559 CATGGTTCCAACCTCTTGCAAGG - Intergenic
1178810652 21:35878345-35878367 ATTGGATACAAGCCCTTCAAAGG + Intronic
1181633925 22:24165667-24165689 CACGCTTCCAAGCCCTTCCCAGG + Intronic
1182125326 22:27811611-27811633 CATGGGCACAACCCCTGCCAGGG - Intergenic
949902035 3:8823526-8823548 CATATTTACAATTCCTTCCACGG - Intronic
950730293 3:14950404-14950426 CATGTTTAAAAACCTTTCCAAGG + Intronic
951040221 3:17981530-17981552 CATGGTTACAACCCCTTCTCAGG - Intronic
954705452 3:52478146-52478168 CTTGGTGTGAAGCCCTTCCAAGG - Exonic
957464159 3:80564642-80564664 CAAGGTGACAAGCCCTTGAAAGG - Intergenic
960823877 3:121762094-121762116 TATGCTTAAAAGCACTTCCATGG + Intergenic
962157752 3:132966463-132966485 CATGCTGAGAACCCCTTCCAGGG + Intergenic
962196107 3:133365053-133365075 CAAGGTTACACGCCTTTCCTGGG - Intronic
962636328 3:137335539-137335561 CAGGGGTACACTCCCTTCCAAGG - Intergenic
964717352 3:159736619-159736641 CATGGCTACCTACCCTTCCAAGG + Intronic
965254223 3:166383240-166383262 CATAGCCACAAGCCTTTCCATGG - Intergenic
967457088 3:189700967-189700989 CCTGGTTAAAAGCGCTACCAAGG + Intronic
973576675 4:52296729-52296751 CATCATAAGAAGCCCTTCCAGGG - Intergenic
973737561 4:53887693-53887715 GATGGTTACCAGCCCTTGCAAGG + Intronic
974357362 4:60830487-60830509 CATGCATTCAAGTCCTTCCATGG + Intergenic
974483576 4:62476499-62476521 AAGGGTGACAAACCCTTCCACGG - Intergenic
976017935 4:80581908-80581930 CATTCTTACAACCCCTTTCAGGG - Intronic
978313668 4:107413599-107413621 CATGATTACATTCCCCTCCAGGG + Intergenic
986349857 5:6867324-6867346 CATGGTGAGACGCCCCTCCAAGG - Intergenic
986507906 5:8471746-8471768 CATGTTTACTTCCCCTTCCACGG - Intergenic
992210117 5:74470900-74470922 CATGGTCAGATGCCCTTTCACGG - Intergenic
993083479 5:83332874-83332896 CATGGGTTCAAGTCCTTCCTTGG + Intronic
1000334685 5:160233347-160233369 CATGGTTTCAAACCCAGCCAAGG - Intronic
1002945983 6:1761091-1761113 CATGTGGACAGGCCCTTCCATGG - Intronic
1005310964 6:24558565-24558587 CATGCTCACCACCCCTTCCAGGG - Intronic
1009828949 6:68904735-68904757 CATGGTTAGAAGCATCTCCATGG - Intronic
1010891144 6:81312411-81312433 CAGGCTCACAAGCACTTCCATGG + Intergenic
1012769831 6:103418269-103418291 CAAGGTGACAATTCCTTCCAAGG + Intergenic
1016831309 6:148436170-148436192 CAGAGTCACAAGCCCTCCCAGGG - Intronic
1020398058 7:7740268-7740290 AATGTTTACAAGCACCTCCAAGG + Intronic
1022520753 7:31005378-31005400 CCTGGTGACAGGCCCTTCCTTGG - Intergenic
1025137884 7:56436011-56436033 CATGGATACAAGCTCAGCCACGG + Intergenic
1027263365 7:76480515-76480537 CATGGCCCCAAGCCCTTCCCTGG + Exonic
1027314743 7:76978622-76978644 CATGGCCCCAAGCCCTTCCCTGG + Intergenic
1032121933 7:129162772-129162794 CATGGCAGCAACCCCTTCCAGGG - Intronic
1035936480 8:3847049-3847071 CAGGTTTAGAAGCCCTTCCAGGG + Intronic
1038150492 8:24939118-24939140 CATGGCTAGAAACCCTCCCAGGG + Intergenic
1038958660 8:32494928-32494950 CATGACTACAAGCCATTCCCTGG - Intronic
1043764957 8:84119598-84119620 CATGGTCACAGGCTCTTGCATGG - Intergenic
1046346800 8:112939707-112939729 CATGATTACAAACCCTTGAAAGG + Intronic
1048210877 8:132453281-132453303 CATGGTTCAAAGCCCTTCAGGGG - Intronic
1052774671 9:32721554-32721576 CATGGTTCTAAGACCTTTCATGG - Intergenic
1053117084 9:35514448-35514470 CATGCTTAAAAACCCTTCGAAGG - Intronic
1055353456 9:75413227-75413249 CAAGGTGACAAGACCTACCATGG - Intergenic
1056331851 9:85527878-85527900 CATGCTGACAAGCTGTTCCAGGG + Intergenic
1059526067 9:114992113-114992135 CATGGTCAGGAGCCCCTCCACGG - Intergenic
1059739650 9:117137249-117137271 CATGGTTAAAAGCAGCTCCAAGG - Intronic
1061396351 9:130345946-130345968 CATGCTTACTGGTCCTTCCAAGG + Intronic
1062206528 9:135340749-135340771 CATGGTGAGAAGCCATTCAATGG - Intergenic
1188389296 X:29600394-29600416 CATGGATACCAGCCCTTCTCTGG + Intronic
1189000035 X:36933965-36933987 CCTATGTACAAGCCCTTCCAAGG - Intergenic
1191890286 X:65932415-65932437 CATGATTACATTCCCCTCCAGGG - Intergenic
1192192695 X:69001966-69001988 TATGGTTACACGTCCTTCCCTGG - Intergenic
1192444634 X:71201610-71201632 CATGGTTACCCACTCTTCCAAGG - Intergenic
1193457972 X:81754763-81754785 CATGGTTCCATGCCGCTCCAGGG - Intergenic