ID: 1173565957

View in Genome Browser
Species Human (GRCh38)
Location 20:44038945-44038967
Sequence CCTCCGTGTCTCCTCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173565953_1173565957 -6 Left 1173565953 20:44038928-44038950 CCGCCTCGTTCCTGCTGCCTCCG 0: 1
1: 0
2: 1
3: 27
4: 414
Right 1173565957 20:44038945-44038967 CCTCCGTGTCTCCTCCTTCCTGG 0: 1
1: 0
2: 1
3: 38
4: 360
1173565952_1173565957 11 Left 1173565952 20:44038911-44038933 CCTAATTACATTCACAGCCGCCT 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1173565957 20:44038945-44038967 CCTCCGTGTCTCCTCCTTCCTGG 0: 1
1: 0
2: 1
3: 38
4: 360
1173565954_1173565957 -9 Left 1173565954 20:44038931-44038953 CCTCGTTCCTGCTGCCTCCGTGT 0: 1
1: 0
2: 2
3: 13
4: 200
Right 1173565957 20:44038945-44038967 CCTCCGTGTCTCCTCCTTCCTGG 0: 1
1: 0
2: 1
3: 38
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173565957 Original CRISPR CCTCCGTGTCTCCTCCTTCC TGG Intronic
900096946 1:943676-943698 CCTCCCTCCCTCCCCCTTCCAGG + Exonic
900137870 1:1126093-1126115 CCTCCGTCCCCCGTCCTTCCCGG - Intergenic
900195983 1:1375652-1375674 CCTCCCCGACTCCTCATTCCTGG + Intergenic
900362764 1:2297895-2297917 CCTCAGCGTCTTCTCCTGCCAGG - Intronic
901063185 1:6483148-6483170 CCTCCGTGTCTCCATCTGACAGG + Intronic
901123942 1:6916196-6916218 CCTCCGGGTCTCACCCTGCCTGG + Intronic
901241795 1:7698555-7698577 CCTCAGTGCCTCCTTCTTCCTGG + Intronic
901438882 1:9265494-9265516 CATCCCTGTCTCCTCCATCCTGG + Exonic
901501493 1:9655185-9655207 CTTCCTTGTCTCCTCCATCCCGG - Intronic
901776136 1:11561470-11561492 CCTCTGTGTCTCCGCGTTCCCGG + Intergenic
901832114 1:11898912-11898934 CCTCCGTGGCCCCTCCATCCTGG - Intergenic
902395059 1:16128034-16128056 CCTCCTTTTCTCCTTTTTCCTGG - Intronic
902648231 1:17819050-17819072 CCTCCCAGCCTCCTCCTCCCAGG + Intronic
903294611 1:22335791-22335813 CCTGCATGCCTGCTCCTTCCTGG + Intergenic
903642842 1:24871523-24871545 CCTCCCTGGCTTCTCCATCCTGG - Intergenic
905243896 1:36599082-36599104 CCTCCCTGTGTCTTCCCTCCGGG - Intergenic
906661503 1:47586028-47586050 CCTCCTTGTCCCCTCCTTCAGGG - Intergenic
907242557 1:53088828-53088850 CCTGCGTGGCTCCACCCTCCTGG + Intronic
907277619 1:53326099-53326121 CCTCCTGGTACCCTCCTTCCTGG + Intronic
907327435 1:53648819-53648841 CCTCCCTGCCTCCTTCTTCAAGG - Intronic
912390652 1:109300374-109300396 CCTCTGGGCCTCCTCCCTCCAGG - Intronic
914750815 1:150533894-150533916 CCTCCCTCTCTCCTCCTCCAAGG - Intergenic
914885486 1:151581072-151581094 CCTCCTTCTCCCCTCCTCCCTGG - Intronic
915565033 1:156708295-156708317 CCTCCGTGCCTGCTGCTCCCTGG - Intergenic
915796750 1:158743208-158743230 TATCAGTGTCTTCTCCTTCCTGG - Intergenic
916165375 1:161962186-161962208 CCTCCGTGTCAACTTCTTACTGG - Exonic
916850243 1:168695983-168696005 CCTCCCAGTCTCCTCACTCCTGG + Exonic
918276381 1:182957068-182957090 CCTCCTTCTCTCCTCCTTTTTGG - Intergenic
919100510 1:193091439-193091461 GCTCCCTGTCCCCTCCTTTCAGG - Intronic
919775258 1:201190317-201190339 TCCCAGGGTCTCCTCCTTCCTGG + Intergenic
919883144 1:201914195-201914217 CCTGTGTGGCTCCTCCTCCCAGG + Intronic
919943305 1:202303175-202303197 CCTCCGGGACTCCTCCTTTGGGG - Intronic
920106292 1:203555893-203555915 TCTCCGTCTCTCCTGCTCCCGGG - Intergenic
920259922 1:204682264-204682286 CCTCCCTGCCTCCTCATTCAGGG + Intronic
922705220 1:227787053-227787075 ACTCCGAGTCGCCTCCGTCCAGG - Intergenic
923783376 1:237044611-237044633 CCACTGTGTCACCTCCTTCAAGG - Intronic
924251649 1:242139359-242139381 CCTCTGCTTTTCCTCCTTCCTGG + Intronic
924549197 1:245058831-245058853 CCTTAGTGTATCCCCCTTCCTGG + Intronic
924644073 1:245860788-245860810 CCTCCGTGGCTTTTCATTCCAGG + Intronic
1063005897 10:1970364-1970386 CCTCCCACTCTCCTCTTTCCTGG + Intergenic
1066321021 10:34304030-34304052 CCTCCGGCTCTCTTCCTTCTAGG - Intronic
1066976994 10:42378223-42378245 TCTCTTGGTCTCCTCCTTCCAGG - Intergenic
1067047278 10:42991746-42991768 CCTCTGGGTCTCCTGATTCCAGG + Intergenic
1067232442 10:44421554-44421576 CCTGCCTGTCACCTCCTTCCAGG + Intergenic
1069230353 10:66001266-66001288 CCTCCCTCTCTCCTTCTCCCTGG + Intronic
1070280343 10:75043836-75043858 CCTCAGTGTCTTCTTCTACCCGG - Exonic
1070690112 10:78518104-78518126 TCTGGCTGTCTCCTCCTTCCAGG - Intergenic
1070968519 10:80544588-80544610 CTTCCGTGTGTCCTCTTTCCAGG + Intronic
1072036426 10:91566900-91566922 CCTCAGCCTCTCCTCTTTCCTGG + Intergenic
1072533167 10:96338768-96338790 GCTCAGTGCCTGCTCCTTCCCGG + Intergenic
1072537085 10:96371908-96371930 CCTCTCTGTCTCCAGCTTCCAGG + Intronic
1072596625 10:96878548-96878570 CCACCCAGTCTCCTCCTTCTTGG - Intronic
1073302758 10:102480965-102480987 CCTCTGGGTTTCCTCCCTCCAGG - Exonic
1073439636 10:103544871-103544893 TCTCCGTGGCTTCTCCCTCCTGG - Intronic
1073636239 10:105201427-105201449 CCTCAGCCTGTCCTCCTTCCAGG - Intronic
1074114004 10:110442210-110442232 CCTGCCTGTCTCCACCATCCAGG - Intergenic
1075545008 10:123348591-123348613 CCACAGCCTCTCCTCCTTCCTGG - Intergenic
1075637841 10:124042457-124042479 CCTCAGTATCTCCTGCTTCTTGG - Intronic
1075855564 10:125626635-125626657 CCTCTGTGTCTGCTCCATCATGG - Intronic
1076854565 10:133109477-133109499 CCTTCCTGTCTGCCCCTTCCTGG + Intronic
1076870790 10:133192839-133192861 CCTCCTTCTCTTCTCTTTCCAGG - Intronic
1077211246 11:1371877-1371899 CCTCCATGACTCCTCCCACCCGG - Intergenic
1077563495 11:3281184-3281206 CCCCAGTGCCACCTCCTTCCAGG - Intergenic
1077569387 11:3326999-3327021 CCCCAGTGCCACCTCCTTCCAGG - Intergenic
1080481739 11:32658284-32658306 CCACCGTGCCACCTCTTTCCTGG + Intronic
1080590903 11:33722463-33722485 CCTTCCTGTCCCTTCCTTCCAGG - Exonic
1082167333 11:48964198-48964220 ACTCCCTGTCTCCTGCTCCCAGG + Intergenic
1082236246 11:49822500-49822522 ACTCCCTGTCTCCTGCTCCCAGG - Intergenic
1082239698 11:49857008-49857030 ACTCCCTGTCTCCTGCTCCCAGG - Intergenic
1082242459 11:49887343-49887365 ACTCCCTGTCTCCTGCTCCCAGG + Intergenic
1082609736 11:55282377-55282399 ACTCCCTGTCTCCTGCTCCCAGG - Intergenic
1082641855 11:55670526-55670548 CCTCCTTCTATCCTCCTTCTAGG - Intergenic
1082656947 11:55868148-55868170 ACTCCCTGTCTCCTGCTCCCAGG + Intergenic
1083580887 11:63824631-63824653 CCACCTTGGCTGCTCCTTCCTGG + Intronic
1083852400 11:65375984-65376006 CCTCCGCCTTTCCACCTTCCGGG - Exonic
1084123509 11:67083382-67083404 CCTCCCTCACTCCTCCTACCCGG + Intergenic
1084353128 11:68618079-68618101 CCTCGGTCTCTCCTCCTTGGCGG - Intergenic
1084441973 11:69179687-69179709 CTTCAGTGTCTCCACCTTTCAGG - Intergenic
1084724407 11:70931558-70931580 CGTCCTTGTGTTCTCCTTCCTGG + Intronic
1085084164 11:73655761-73655783 CCTCCCTCCCTCCTCCTTCTTGG + Intronic
1085391676 11:76185358-76185380 CTTCCGTGTCACCTCCCTCATGG - Intergenic
1086455670 11:86956329-86956351 CCACCGTGACTCCTCTCTCCCGG + Intergenic
1089321051 11:117626917-117626939 CCACCCTCTCTCTTCCTTCCTGG - Intronic
1089498404 11:118919158-118919180 CCTCCTCCTCTCCTGCTTCCAGG - Intronic
1089584902 11:119504118-119504140 CCTCTGTCTCTGCTCCTTCAAGG + Intergenic
1089863720 11:121613437-121613459 TCTTCCTGTCTCCTCCTTCTAGG + Intronic
1090736503 11:129615983-129616005 CTTCCGTCTCTTCTCCTTCCAGG + Intergenic
1091741062 12:2960332-2960354 CCTCCAGGTCTCTCCCTTCCAGG - Intronic
1092891715 12:12975250-12975272 CCTCTGTGTCTCCTTCCTCGGGG - Exonic
1093448117 12:19283441-19283463 CCTCCGTTTCTCCTCCGCTCCGG - Exonic
1093646196 12:21587931-21587953 CCTCCCTATGTCCTCCTACCTGG - Intronic
1095148704 12:38764015-38764037 CATCCGTGCCTTCTCCTTCCAGG + Intronic
1095530420 12:43180851-43180873 CCTCCATGACTCCTACTTCTTGG + Intergenic
1096625799 12:52895368-52895390 CCTCCCTGCTTGCTCCTTCCAGG - Intergenic
1097167809 12:57094898-57094920 CCTCCTTGTGTCCTCTCTCCAGG - Exonic
1097892480 12:64792251-64792273 GCTCCCTGTGTGCTCCTTCCTGG + Intronic
1098474966 12:70890036-70890058 CCTCTGGGTTCCCTCCTTCCTGG + Intronic
1100748140 12:97667942-97667964 CCTCCTTCTTCCCTCCTTCCTGG - Intergenic
1101616706 12:106344947-106344969 CCTCAGTGTCTCCTGATTCTTGG + Intronic
1103409481 12:120700503-120700525 CCTCAGTCTCTCCTTCCTCCGGG - Exonic
1103558472 12:121779779-121779801 CCTGTCTGTCTCCTCCATCCTGG + Exonic
1103994406 12:124819797-124819819 CCTCCAAATCTGCTCCTTCCGGG - Intronic
1104748272 12:131223230-131223252 CTTCCTTGTCCCCTCTTTCCAGG + Intergenic
1106319585 13:28625062-28625084 CCTCCCTTTCTCCTTCTTCCAGG - Intergenic
1108313493 13:49217733-49217755 CCTCCCTGTCTCCTCCCCCTAGG - Intergenic
1108491996 13:50991326-50991348 TCTCCCTGTCTTCTCCTTCGTGG - Intergenic
1109094722 13:58098192-58098214 TCTCCCTGTCTCCTCAATCCAGG + Intergenic
1113747859 13:112757625-112757647 CCTCCTTGTCTCATCCCTCAAGG + Intronic
1113811321 13:113144241-113144263 CCTGCCTGTCCCCTCCCTCCGGG + Intronic
1114393398 14:22334682-22334704 CCTCTGTGTCTCATCCCTCATGG - Intergenic
1114590345 14:23858963-23858985 CTTCCCTTTCTCCTCCTCCCAGG + Intergenic
1117344497 14:54818978-54819000 CTTCCGTCTCTCCTGCTTTCTGG + Intergenic
1117791067 14:59342851-59342873 CCTCCTTGACACCACCTTCCCGG - Intronic
1118598496 14:67454448-67454470 CCTTCGTGTCTCCTTCTTCTTGG + Intronic
1119171137 14:72537203-72537225 CATCCCTTTCTCCTCCCTCCTGG + Intronic
1119474660 14:74920145-74920167 GCTCCCTTCCTCCTCCTTCCTGG - Intronic
1119546141 14:75472921-75472943 CCTCAGTGTGCCCTCCTGCCAGG + Intronic
1121273586 14:92653084-92653106 CCTCCCTGCCACCTCCTCCCAGG - Intronic
1122534012 14:102449607-102449629 TTTGCTTGTCTCCTCCTTCCAGG + Exonic
1122636356 14:103131617-103131639 CCTCTCTGCCTCCACCTTCCAGG + Exonic
1122837659 14:104437957-104437979 CCTGCCTGTCTGCTCCCTCCAGG + Intergenic
1123020320 14:105394981-105395003 CCTCTGTGTCCTGTCCTTCCTGG + Exonic
1123116964 14:105899219-105899241 CCTCCCTGGTTCCTCCTTCGGGG - Intergenic
1124395126 15:29294185-29294207 CCTCCCTGTTTCCTCATTCCTGG - Intronic
1126664058 15:51059875-51059897 CCTCCCTCTCTGCTCCTTCTGGG + Intronic
1127217969 15:56844909-56844931 TCTCCCTGTCTTTTCCTTCCAGG - Intronic
1127765022 15:62177249-62177271 CTTCCCTATTTCCTCCTTCCTGG + Intergenic
1128109647 15:65068202-65068224 GCTCCTTCTCTGCTCCTTCCCGG - Intronic
1128150774 15:65362350-65362372 CCTCCCTGGCTCCCACTTCCAGG - Intronic
1128735161 15:70049473-70049495 CCTCCCTGTCTCCTCTTCCCAGG + Exonic
1128774716 15:70311382-70311404 CCCTCGTGTCTCTTCCTTCCTGG + Intergenic
1129155809 15:73716907-73716929 CCTCCCAGTCTCCTCCTTCTGGG - Intergenic
1129376822 15:75138736-75138758 CTTCCCTGTGTCCCCCTTCCAGG - Intergenic
1129411835 15:75354631-75354653 GACCCGTGTCTCCTCCATCCAGG + Exonic
1130689145 15:86065332-86065354 CCTCCCTATCTCCTCTTTTCAGG - Intergenic
1130872688 15:87983742-87983764 CCTCCATTTCACCCCCTTCCTGG - Intronic
1132227709 15:100155325-100155347 CATCCCTCTCTCCTCCTTCTTGG - Intronic
1132242547 15:100269766-100269788 CCTTCATCTCTCCTGCTTCCTGG + Intronic
1133119602 16:3597936-3597958 CTTCCGTGGCTCCTTCTTGCTGG + Exonic
1133933573 16:10251589-10251611 CCCACGTGTCACCCCCTTCCAGG + Intergenic
1134678428 16:16106818-16106840 CTTCCAGGTCTCCTCCTTCTTGG - Exonic
1136554431 16:30999491-30999513 CCTCCTTGTCTGCTCATACCAGG - Intronic
1136571487 16:31100110-31100132 CCTCAGTGATTCCTGCTTCCTGG + Intergenic
1136922762 16:34345704-34345726 CCTCCTTCTCCCCTCATTCCAGG - Intergenic
1136981811 16:35066102-35066124 CCTCCTTCTCCCCTCATTCCAGG + Intergenic
1137702624 16:50507861-50507883 CCTCTTGGTCTCCTTCTTCCTGG - Intergenic
1139354168 16:66357404-66357426 CCTCTGTGCCTCCCCCTGCCTGG + Intergenic
1139661355 16:68423169-68423191 CCTCCTTGTCACCTCCTTTATGG + Intronic
1139917931 16:70439412-70439434 CCTCCGTCTCCCCTCCTGCACGG - Intergenic
1139958652 16:70705318-70705340 CCTCGGCCTCTCCTCCTCCCAGG - Intronic
1140917780 16:79509320-79509342 CCTCACTGCCTCCTCCTTCCTGG - Intergenic
1141322030 16:83020232-83020254 CCTCAATGTATTCTCCTTCCTGG + Intronic
1141445608 16:84055893-84055915 TCTCCCTGTCTCTGCCTTCCTGG - Intronic
1141461278 16:84180028-84180050 CCCCCCAGTCTCTTCCTTCCAGG - Exonic
1141935520 16:87235721-87235743 CCTCCTTCCTTCCTCCTTCCAGG - Intronic
1142346377 16:89556739-89556761 CCTCCGTGCCTCCGCTTCCCTGG + Intronic
1143173228 17:4942217-4942239 CCTCACTTCCTCCTCCTTCCTGG - Intronic
1143381035 17:6496487-6496509 CCTCAGTGTTCCTTCCTTCCGGG + Intronic
1145125954 17:20300250-20300272 CCTCTCTGGCTGCTCCTTCCTGG - Intronic
1147328256 17:39680571-39680593 CCTCTGTGTCTCCAGATTCCGGG + Intronic
1147602522 17:41755130-41755152 CCTCCCTGTCTCCAGCTGCCTGG - Exonic
1151357015 17:73565191-73565213 CCTCTGGCTCTCCTCCTTCTGGG - Intronic
1151364983 17:73611449-73611471 CCTCTGTGGCCCCTCCTTGCTGG + Intronic
1151559458 17:74862663-74862685 CCAGCGTCTCTCCTCCCTCCTGG - Exonic
1151745271 17:76008528-76008550 GCGCCGTGCCTCCTCCTCCCGGG + Exonic
1152550337 17:81026652-81026674 CCCTGGTGCCTCCTCCTTCCCGG - Intergenic
1152738001 17:82006910-82006932 CCGCTGTGGCTCCCCCTTCCTGG + Intronic
1152834571 17:82520527-82520549 CCCCCGTCTTTCCCCCTTCCTGG + Intronic
1152875333 17:82783166-82783188 CCTCAATGTCTGCTGCTTCCCGG + Intronic
1153688530 18:7568409-7568431 CCTCCCTGTCGCCCCCTGCCCGG + Intronic
1153820163 18:8825577-8825599 CACCCGTGTCGTCTCCTTCCCGG + Exonic
1153997371 18:10454345-10454367 CCTCCTCCTCTCCTCCCTCCAGG - Intergenic
1154339893 18:13494032-13494054 CCACAGTGCCTCCTCCTTCCTGG + Intronic
1155196450 18:23479322-23479344 CTTCCTTGACTCCTCCTTTCTGG - Exonic
1158383303 18:56959880-56959902 CCTCCTGGTCTGCTCTTTCCTGG - Intronic
1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG + Intronic
1160571076 18:79818106-79818128 CCTCTGTGGCTCGTTCTTCCTGG - Intergenic
1160870240 19:1274627-1274649 CCTCCCTTCCTCCTCCTTCCAGG + Intronic
1161060739 19:2213594-2213616 CCTCCTGATCTCCTCCTTCTGGG - Exonic
1161133959 19:2608701-2608723 CCTCCGTGTCTGCCCCATGCAGG - Intronic
1161245766 19:3250963-3250985 CCCCCGTTTCTCTCCCTTCCAGG + Exonic
1161290937 19:3492971-3492993 CCTCAGTCTCTCCTCCTCCGGGG - Intronic
1162520703 19:11177919-11177941 CACCTGTGTCTCCTCCTTCTGGG + Intronic
1162764283 19:12908903-12908925 CCTCCATGCCTCCTCCCTGCTGG + Intronic
1162777429 19:12988164-12988186 CCTCCCTCTCTCCCCCTCCCCGG - Intergenic
1163419413 19:17205817-17205839 CCTCCCTGTCTCCTTCTGCGTGG - Intronic
1163440065 19:17318126-17318148 CCTCCCAGTCTCCACCTCCCAGG + Intronic
1163529441 19:17841304-17841326 CCTCAGTGTCCTCACCTTCCAGG - Intronic
1163810688 19:19429619-19429641 CCTGCCTGTCTCCTCCTTCAAGG + Intronic
1164625190 19:29723223-29723245 CCACCGTGTCTCCATGTTCCTGG + Intergenic
1164872357 19:31656616-31656638 CCACCGTGCCGCCTCCTTCCCGG - Intergenic
1165124020 19:33581379-33581401 CCTCTGCCACTCCTCCTTCCTGG + Intergenic
1165489643 19:36115728-36115750 CCTCCCAGCCTCCCCCTTCCGGG - Intronic
1165882379 19:39053242-39053264 CCCACTTGCCTCCTCCTTCCAGG + Intergenic
1166168181 19:41007212-41007234 TCACCGTCTCTCCTCCCTCCAGG - Intronic
1166312262 19:41969580-41969602 GCTTCCTCTCTCCTCCTTCCAGG - Exonic
1166863974 19:45825297-45825319 CTTCACTGTCTCCTCCGTCCAGG + Exonic
1167017491 19:46850595-46850617 CCGCCCTGTGCCCTCCTTCCCGG + Intronic
1167107335 19:47437927-47437949 CCTCCGAGCCTCCTCCTCCTCGG + Exonic
1167163842 19:47784716-47784738 CCCCTGTGCCTCCTCCCTCCAGG + Intergenic
1168152816 19:54458081-54458103 CCTCGGTGCCTCTGCCTTCCAGG + Exonic
925003237 2:422785-422807 GCTCAGGGTCTCCTCCTACCAGG + Intergenic
925104754 2:1281896-1281918 CGTCCGTGTCTCCTCAAGCCCGG + Intronic
925183790 2:1833526-1833548 TCTCCCTGACTCCTCCGTCCTGG + Intronic
925194447 2:1911952-1911974 TCTCCATGCCTTCTCCTTCCTGG - Intronic
925611218 2:5705295-5705317 CCTCCCTGGATCCTCCATCCCGG - Intergenic
926130950 2:10302874-10302896 CCTTCGCGTCCCTTCCTTCCCGG + Intronic
926698702 2:15788432-15788454 CCCCCATGGCTGCTCCTTCCTGG + Intergenic
927030813 2:19118763-19118785 CCTCTGTGTCTTTTTCTTCCTGG - Intergenic
928471950 2:31583592-31583614 CCTCCTTACATCCTCCTTCCAGG + Intergenic
934589107 2:95530408-95530430 ACTCCTTGTCTCCTGCTCCCAGG - Intergenic
935891750 2:107686710-107686732 CTTCTGTGTTTCCTCCTCCCTGG - Intergenic
936839707 2:116754587-116754609 CCACAGAGTCTCCTCCTCCCCGG + Intergenic
937316372 2:120934367-120934389 CCTTCCTTTCTCCTCCTGCCTGG + Intronic
937690506 2:124749810-124749832 CCTCAGTGTCTCCTCTTACTTGG + Intronic
938946894 2:136220597-136220619 CCTCTCTTTCTCCTCTTTCCTGG - Intergenic
939958437 2:148546009-148546031 ACCATGTGTCTCCTCCTTCCAGG - Intergenic
940169749 2:150815705-150815727 CTTCCCTGTCTTCACCTTCCTGG + Intergenic
940963002 2:159806066-159806088 CTTCGGTGTCTCCTGCTTCTAGG + Intronic
943139281 2:183958740-183958762 CCTCCTTCTTTCCTACTTCCTGG - Intergenic
944682275 2:202087922-202087944 CCTCCATGTCTTCACTTTCCTGG + Intronic
946436986 2:219663716-219663738 CCTTCATGGCTCTTCCTTCCTGG + Intergenic
946438298 2:219674079-219674101 CCATCGTCCCTCCTCCTTCCTGG + Intergenic
946776592 2:223148703-223148725 CATCTGCGTCTCCTCCTTCTGGG + Intronic
947389891 2:229628184-229628206 CCTCGGTGTCTCATGCTTCAGGG - Intronic
948015854 2:234690090-234690112 CCTTCGTGCTTCCTCCATCCTGG + Intergenic
948504659 2:238420587-238420609 TCTCTGGGTCTCCTGCTTCCAGG - Intergenic
948787927 2:240362741-240362763 CCTCTGTGGGTGCTCCTTCCTGG - Intergenic
1170572597 20:17640955-17640977 CCTCCCTGCCTTCTCCATCCCGG - Intronic
1170712555 20:18805568-18805590 CACACGTGTCTCATCCTTCCTGG + Intergenic
1171194663 20:23187619-23187641 CCTGGTTATCTCCTCCTTCCGGG - Intergenic
1172109873 20:32538490-32538512 CCTCCCTCCCTCCTCCTTCATGG + Intronic
1172362606 20:34324555-34324577 CCACAGTGTCTCCTACCTCCTGG - Intergenic
1172621354 20:36320231-36320253 CCTCTGTGTCTCCCTCTCCCAGG + Intronic
1172774353 20:37398422-37398444 CCGCCGTCTCTCCTCCACCCTGG - Intronic
1172871488 20:38138309-38138331 CATCCCTGTCTCCTCCTTCTCGG + Exonic
1172895922 20:38300006-38300028 CCTCTGTGTGTCCGGCTTCCAGG - Intronic
1173012056 20:39191497-39191519 CCTGCGTGTCTGCCCCTTGCAGG + Intergenic
1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG + Intronic
1173565957 20:44038945-44038967 CCTCCGTGTCTCCTCCTTCCTGG + Intronic
1173655999 20:44700760-44700782 CCTCTGTGCCTCCTCCCTGCTGG + Intergenic
1173943828 20:46934327-46934349 CCTCTGTGTCACCTTCCTCCTGG + Intronic
1174672199 20:52318738-52318760 CTTCAGTGTTTCCTCCTGCCAGG - Intergenic
1175317986 20:58065060-58065082 TTTCCCTGTCTCTTCCTTCCCGG + Intergenic
1175656531 20:60775921-60775943 CCTCAATCTCTTCTCCTTCCTGG + Intergenic
1175887708 20:62302203-62302225 CTTCCCTGACTCCTCCCTCCCGG + Intronic
1176009642 20:62886034-62886056 CCTCAGTCTCTGCACCTTCCCGG - Intronic
1176093619 20:63329706-63329728 CCTCAGGAGCTCCTCCTTCCTGG - Intronic
1176119441 20:63447408-63447430 GCTCCGTTTCTCCTTCCTCCCGG + Intronic
1176209486 20:63911449-63911471 CCTGCCTGTCTGCTCCTCCCTGG + Intronic
1177675302 21:24290199-24290221 CCTTGGTGTATCCTTCTTCCAGG - Intergenic
1178265343 21:31137791-31137813 GCTCCTTGTCTCTTCCTTCCAGG - Intronic
1178507085 21:33171203-33171225 TCTCCCTGACTCCTGCTTCCTGG + Intergenic
1178630727 21:34259040-34259062 TCTCCATGGCTCCTCTTTCCCGG - Intergenic
1178661979 21:34514513-34514535 CCACCGTTTCTCCTTCTTTCAGG - Intronic
1179149370 21:38796852-38796874 CCTCCCTCTCTCTCCCTTCCAGG + Intergenic
1179586246 21:42375739-42375761 CACCCGTGTCACCTCCTTCCTGG - Exonic
1180869364 22:19137692-19137714 CCTGAGTGTCTCCTCCTGCGTGG - Intronic
1181835497 22:25604296-25604318 CATCCGTATCTCTTCCATCCTGG + Intronic
1182903719 22:33920012-33920034 CTTCCGTGTCTCCCTCTGCCTGG - Exonic
1184510575 22:44930850-44930872 CCTCGGTATCTTCTCCTGCCAGG + Intronic
1184729305 22:46364251-46364273 TTGCCGTGTCTCCTCCTCCCAGG - Exonic
1184801767 22:46765275-46765297 CCTCTGTGACTCCTCCTTCAGGG - Intronic
1184835493 22:47018707-47018729 CCACCGTGTCTCCTGCTCACCGG + Intronic
1184841178 22:47053188-47053210 CCTGCGTGTCCCCTCCGGCCTGG + Intronic
1185009635 22:48305927-48305949 CCGCCGTGTCTCCTCCTCAAGGG + Intergenic
1185122007 22:48976948-48976970 CCTTCGTTTCACCTCCTGCCAGG + Intergenic
1185148781 22:49152808-49152830 CCTCCCTGTCACCCCCTCCCAGG + Intergenic
1185281533 22:49971970-49971992 CCCCCGGGTCTCCTCCCTCCTGG + Intergenic
951455377 3:22886401-22886423 CCTCCATGTCTCTTCCCTCTTGG - Intergenic
951557716 3:23937293-23937315 CCTCCATCTCTCCTCCTCCCAGG - Intronic
952796451 3:37243345-37243367 CCGCCGCGTCTCTTTCTTCCGGG - Exonic
953034218 3:39198059-39198081 CCTCCGAGCCTCCACCTCCCCGG + Intergenic
953250623 3:41243423-41243445 TCTCCCTGTCTCCTCCTGCAAGG - Intronic
953671206 3:44963806-44963828 CCTCCCTGTCTCCTTCACCCCGG + Intronic
954814960 3:53273212-53273234 CCTCAGAGTCTGCCCCTTCCAGG - Intergenic
955728775 3:61961169-61961191 CCTTCCTGGCCCCTCCTTCCAGG - Intronic
957365881 3:79223193-79223215 CTTTCGTGTCCCCTGCTTCCTGG - Intronic
960144817 3:114189784-114189806 CCACAGTGTCACCTTCTTCCAGG - Intronic
961034434 3:123632529-123632551 CCTCTGGCACTCCTCCTTCCTGG + Intronic
961322116 3:126083679-126083701 CGGCCCTGTCTCCTCCTTCCTGG - Intronic
961477312 3:127156939-127156961 CCTCCGTGGCCCTTGCTTCCCGG + Intergenic
961604463 3:128083439-128083461 CCTCTGGCTCTCCTCCCTCCTGG - Intronic
962327305 3:134446811-134446833 GCTCTCTGCCTCCTCCTTCCTGG - Intergenic
962645684 3:137436808-137436830 CCTCTGTTCCTCCTCCTTCCTGG - Intergenic
963231337 3:142911223-142911245 CCTACACCTCTCCTCCTTCCTGG - Intergenic
966481290 3:180411878-180411900 CCTCCATGCCTGCTCCCTCCTGG - Intergenic
967844914 3:194035667-194035689 CTTTCAAGTCTCCTCCTTCCAGG - Intergenic
969425179 4:7120077-7120099 CTTCCCTCTCTCCTCCTCCCAGG - Intergenic
969623821 4:8292496-8292518 CCTTGGTCTTTCCTCCTTCCAGG - Intronic
969705464 4:8789074-8789096 CCTCCATGTCTCCCTCCTCCCGG - Intergenic
971228070 4:24773308-24773330 CCTCCAGGTCTCCTGCCTCCTGG + Intergenic
977662771 4:99609970-99609992 CCCCACTGTCTCCTCTTTCCGGG - Intronic
978224745 4:106320675-106320697 CTTCCTTGTCACCTCCTTTCAGG - Intronic
979439518 4:120734667-120734689 CCTCTTTGGCTGCTCCTTCCTGG + Intronic
979711731 4:123787829-123787851 TCTCAGTGTCTCCTCCATCCAGG - Intergenic
981399642 4:144298665-144298687 GTTCCGTGAGTCCTCCTTCCTGG - Intergenic
981938870 4:150260797-150260819 CCGCCTTGTCTCCGCCTTGCTGG - Intergenic
982411665 4:155084698-155084720 CTTCCCTGGCTCCACCTTCCCGG - Intergenic
983784614 4:171715841-171715863 CCTGCGTATCTCATTCTTCCTGG + Intergenic
984573441 4:181420732-181420754 CCTCCTTTTCTACTCCATCCTGG + Intergenic
985769858 5:1802073-1802095 CCTCCTTAGCTCCACCTTCCCGG + Intronic
985985280 5:3510641-3510663 GCTTCGTGCCTCCTCCTGCCTGG - Intergenic
986690295 5:10308073-10308095 CCTCCCTGCCTCCTCCCTCAAGG - Intergenic
988124197 5:27008055-27008077 AATCCGTATCTCCTCATTCCAGG - Intronic
988898854 5:35709317-35709339 ACTCCATGTCTCCTCCTACATGG - Intronic
989240878 5:39202025-39202047 CCTCAGGGACTCCTCCTGCCAGG - Exonic
990155965 5:52877683-52877705 GCTCCGTGACTGCTCCTGCCAGG - Intronic
990964070 5:61425686-61425708 CCTCCTCTTCTCTTCCTTCCTGG - Intronic
992581735 5:78184765-78184787 CCTCTGTCTCTTCTCCTTCCAGG - Intronic
992608629 5:78488041-78488063 CCTCACTGTTTCCTCCTTCCAGG - Exonic
994287057 5:97982065-97982087 CCTTTGTGACTCCTGCTTCCTGG + Intergenic
994823826 5:104687034-104687056 CCTTCCTGTTTCCTGCTTCCAGG - Intergenic
997579046 5:135005835-135005857 CCTCCCTGCCTCCTCCTCCTGGG + Intronic
997590112 5:135067157-135067179 CCTCCCTGACCCCTCCTTGCCGG + Intronic
997888797 5:137657187-137657209 CCTCCCTGCCTGCTTCTTCCAGG - Intronic
998386201 5:141758445-141758467 CATCCGTTTCTCTTCCTTCCAGG - Intergenic
999147401 5:149405483-149405505 AATCCCTCTCTCCTCCTTCCAGG - Intergenic
999224505 5:150010073-150010095 TCTGCTTGTCTCCCCCTTCCTGG + Intronic
1001403064 5:171457675-171457697 CCTCTGTGTCTCATGCTTTCTGG + Intergenic
1001858208 5:175031121-175031143 CCTCCCTGGCTGCTCCTTCTCGG - Intergenic
1002393575 5:178935926-178935948 GCTGCGTGTCCCCTCCTTTCTGG - Intergenic
1003121196 6:3320153-3320175 CCTCTGTGTCTGCTCCTGCTGGG + Intronic
1003199611 6:3947033-3947055 TCTCCTTTTCTCCTCCTTGCAGG - Intergenic
1003973841 6:11324262-11324284 TCTGCCTGTCTCCTCTTTCCTGG + Intronic
1006402665 6:33826838-33826860 CCTCTGGGTCTCCTGATTCCTGG + Intergenic
1007286805 6:40753720-40753742 CCTCCCTCTCTCCACCATCCTGG - Intergenic
1007507645 6:42348551-42348573 CCTCCCTGGCTCCTCTTTACAGG + Intronic
1008536227 6:52508311-52508333 CCCCCTTGTCTCCAGCTTCCAGG - Exonic
1009975995 6:70671492-70671514 CCTCCGCCTCTCCGCCTCCCAGG - Intronic
1012170800 6:96015493-96015515 CCTCCTTCTCTCCTCTTTCTGGG - Intergenic
1013402247 6:109810046-109810068 ACTCTGTGTCTCCTCCTTAGGGG + Intronic
1014467017 6:121768322-121768344 TCTCAGTCTCTCCTCTTTCCAGG + Intergenic
1015317261 6:131830358-131830380 CCAAAGTCTCTCCTCCTTCCTGG - Intronic
1016590006 6:145734788-145734810 CCTCCGAGTCCCCCCCTTCGCGG - Intronic
1018788846 6:167130950-167130972 CCTCCGGGACTCCTCCCTCTGGG + Intronic
1019595976 7:1858592-1858614 CCGCGGTGCCTCCTCCTACCTGG + Intronic
1022088103 7:27088243-27088265 GTTCCGTTTCTCCTGCTTCCTGG - Intergenic
1022299478 7:29089779-29089801 ACTCCGTGTCTGCTCCTGCAGGG - Intronic
1022336341 7:29425343-29425365 GCTCCGTGTCTCCTCCCTCCGGG - Intronic
1023131953 7:37012295-37012317 CCTCCCTGTCACCTTCTCCCTGG - Intronic
1023515201 7:40994718-40994740 CCTCCCAGTCACCTCCTACCAGG - Intergenic
1024499803 7:50093086-50093108 CCTCTTTATCTCCGCCTTCCTGG - Exonic
1026038355 7:66845845-66845867 CCCCTGCGTCTCCTCTTTCCAGG + Intergenic
1027160490 7:75798864-75798886 CCTCCTCCTCTCCTCCTCCCTGG - Intergenic
1027421409 7:78020390-78020412 CCTCCGGGCCTGCTCCTCCCGGG - Intronic
1027779480 7:82504496-82504518 CCTCTTTGTATACTCCTTCCTGG - Intergenic
1029251008 7:99236347-99236369 CCTCCAGTTCCCCTCCTTCCTGG + Intergenic
1029913340 7:104179027-104179049 CATCTGTGTCTCCTACTTACTGG - Intronic
1031195599 7:118609574-118609596 CCTCTGTATCTTCACCTTCCTGG - Intergenic
1032792599 7:135253430-135253452 CCTCCCCGCCTTCTCCTTCCAGG - Intronic
1033535483 7:142308283-142308305 CCTCCCTCCCTGCTCCTTCCCGG - Intergenic
1033763806 7:144465455-144465477 TCTCTTGGTCTCCTCCTTCCAGG + Intronic
1034264708 7:149775222-149775244 CCACCCTGTCTCCTTCTTCGAGG - Intergenic
1034940366 7:155226665-155226687 CCTCAGTGTCTCCTGCACCCAGG - Intergenic
1035171967 7:157021879-157021901 CCTCCGGGTTTCCTCCCGCCGGG + Intergenic
1035274321 7:157738291-157738313 CCTCTGGGGCGCCTCCTTCCCGG - Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037902747 8:22697153-22697175 CCTCCTGGTTTCCTCCCTCCTGG + Intergenic
1038238051 8:25781107-25781129 CCCCCTTCTCTCCTCCTTCTTGG + Intergenic
1040072068 8:43196510-43196532 GCTCCGTGGCTCTTACTTCCAGG - Intronic
1040112001 8:43570763-43570785 GCTCCTTGTCTCCTTCTTCCAGG + Intergenic
1040986248 8:53297095-53297117 CCTCCATGTATCCCCCTTCTAGG + Intergenic
1042750654 8:72154261-72154283 CCTTCCTGCCTCCTCCTCCCTGG + Intergenic
1044076817 8:87832099-87832121 CCTCCATCTTTCCTGCTTCCTGG - Intergenic
1044855099 8:96467677-96467699 CCTCCGTATGTCCTCCAGCCTGG - Intergenic
1045005794 8:97915549-97915571 CCTCCTCCCCTCCTCCTTCCAGG + Intronic
1045833811 8:106496480-106496502 GCTCCATGTCTCCTCAATCCAGG + Intronic
1046920476 8:119722876-119722898 CCTCTCTTTTTCCTCCTTCCCGG - Intergenic
1048080901 8:131125426-131125448 CCTCCCTCTCTCCTTCTTCTTGG + Intergenic
1048524490 8:135189497-135189519 CCTCTGTGTAACCTCCTTCCTGG + Intergenic
1051742235 9:20263214-20263236 TCTCTCTGTCTCCTCCATCCAGG - Intergenic
1051748440 9:20317604-20317626 CCTCTTTCTCTCCTCCTGCCTGG - Intergenic
1053150143 9:35738036-35738058 CCTCAGTGTCTCCTTCTCCTAGG + Exonic
1053535788 9:38924115-38924137 CCTCCTTCTCTCCCCCTTCTAGG - Intergenic
1054208010 9:62148528-62148550 CCTCCTTCTCTCCCCCTTCTAGG - Intergenic
1054630344 9:67439822-67439844 CCTCCTTCTCTCCCCCTTCTAGG + Intergenic
1056765342 9:89441595-89441617 CCTCCCTGCCTGCTGCTTCCAGG - Intronic
1060552728 9:124493149-124493171 CCCGCGTGCCTCTTCCTTCCAGG - Exonic
1061116430 9:128615978-128616000 CCTCAGTGTCTTCTGCTTTCCGG + Intronic
1061920233 9:133778622-133778644 CCCCTGTGCCTCCTCCTCCCTGG + Intronic
1061973449 9:134056682-134056704 CCTCCTGGTCTCCTCCTGCCCGG - Intronic
1062021013 9:134319451-134319473 CATCACTGTCTCCTCCTGCCCGG - Intronic
1062581450 9:137230894-137230916 GCCCCGTGTCTCCTCCCTGCAGG + Exonic
1062681564 9:137784823-137784845 CCTCCGTGGCTCCTCCTGCATGG - Intronic
1185729583 X:2450693-2450715 TTTCTGTGTCTCCTCCTTCTTGG + Intronic
1185731122 X:2462770-2462792 TTTCTGTGTCTCCTCCTTCTTGG + Intronic
1186001003 X:5010486-5010508 CCTTCATGGCTCCTCCTTCATGG - Intergenic
1187118947 X:16384531-16384553 CCTCCCTCTCTCCTCCTTTTTGG + Intergenic
1190076851 X:47323054-47323076 CCTCCGCCTCTCCTGCCTCCCGG - Intergenic
1191250659 X:58258639-58258661 CCTCAATGTCTCCTTCCTCCGGG - Intergenic
1195291394 X:103434302-103434324 CCACCCTGTCTCCACTTTCCTGG - Intergenic
1195687996 X:107602731-107602753 CCTCCGTGTGTCCACCTTCGAGG + Exonic
1198197047 X:134373506-134373528 CCTCCTTGTCTTCTCCCGCCGGG - Intronic
1199986658 X:152957554-152957576 TCTCCTTGTCTCTACCTTCCAGG - Intronic
1200056782 X:153465768-153465790 CCACTGGGTCTCCTCCTTCAGGG + Intronic
1200292155 X:154885053-154885075 CCTCGGCGTCTCCTCCTCCTCGG - Exonic
1200338993 X:155380790-155380812 CCTCGGCGTCTCCTCCTCCTCGG - Exonic
1200347476 X:155459902-155459924 CCTCGGCGTCTCCTCCTCCTCGG + Exonic
1201550804 Y:15214560-15214582 CCACCCTGTTTCCTGCTTCCAGG + Intergenic