ID: 1173569259

View in Genome Browser
Species Human (GRCh38)
Location 20:44066169-44066191
Sequence TGGCAGGGCCAGGGTTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173569259_1173569266 5 Left 1173569259 20:44066169-44066191 CCTTTCAAACCCTGGCCCTGCCA 0: 1
1: 0
2: 3
3: 35
4: 368
Right 1173569266 20:44066197-44066219 CAGTGATATAACCTCAGCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173569259 Original CRISPR TGGCAGGGCCAGGGTTTGAA AGG (reversed) Intronic
900151968 1:1182748-1182770 GCGCAGGGCCAAGGTTGGAATGG + Intronic
900948308 1:5843678-5843700 TGGGAGGGCCAGGGGGTGCAGGG + Intergenic
900954121 1:5876286-5876308 GGGCAGGGCCAGGGCATGACTGG - Intronic
900960557 1:5916600-5916622 TGGAAGGACCAGGAGTTGAACGG - Intronic
901659461 1:10789318-10789340 TGGCAGGCCCAGGGTTTGGGAGG - Intronic
901930740 1:12595226-12595248 TGTCAGGGCCAGGGTTGGGACGG - Intronic
902503536 1:16925621-16925643 TGGCAGAGCTAGGGTTGGCATGG + Intronic
902630379 1:17701237-17701259 GGGCAGGGTGAGGGTTGGAAGGG + Intergenic
903192744 1:21666042-21666064 AGGCAGGGCCAGGCTTGGACAGG + Intronic
904609679 1:31718581-31718603 TGTCAGGGCCAGTGGTTGATGGG - Intergenic
905144430 1:35876693-35876715 TGGCAGTGACAGTGTTTGAGAGG + Intronic
905178916 1:36155153-36155175 GGGCAGGGCCAGGGTGGGCAGGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906377173 1:45304679-45304701 TGGCAGGGCCCCGGTTTTGATGG - Intronic
906678349 1:47709018-47709040 TGGCAGGGCCAGGCTCTGAAAGG - Intergenic
908389863 1:63674699-63674721 TCCCAGGGCCAGGTTTTTAAAGG + Intergenic
912876876 1:113369060-113369082 AAGCAGTGGCAGGGTTTGAAAGG + Intergenic
913328782 1:117650365-117650387 TGGCAGGGGCAGGGGGTGGATGG + Intergenic
917504269 1:175613948-175613970 TGGCTGGGCTAGGATTTGACCGG - Intronic
917993656 1:180411287-180411309 AAGCAGTGGCAGGGTTTGAAAGG + Intronic
918293648 1:183134332-183134354 TGGCAGGCACAGTGTTGGAAAGG + Intronic
918319968 1:183355048-183355070 TGGGTGGGCCAGGGGTTGCATGG - Intronic
919801180 1:201355531-201355553 GGGCAGAGCCAGAGTTTGATGGG + Intergenic
920232937 1:204482264-204482286 AGCCAAGGCCAGGGTTTGGAGGG - Intronic
920267688 1:204736487-204736509 TGGGATGGCAAGGGTCTGAAAGG + Intergenic
920512510 1:206561384-206561406 AGGCTGGGTCAGGTTTTGAAAGG + Intronic
922194888 1:223351423-223351445 GGTCTGGGCCAGGGTTTGCATGG - Intronic
922586901 1:226740195-226740217 TGGCAGTGCCAGGGCTTAGAAGG - Intergenic
922624024 1:227019130-227019152 GGGCAGAGGCAGGGTTTGAGAGG - Intronic
922903021 1:229152263-229152285 AGGCAGCAGCAGGGTTTGAAAGG - Intergenic
922972702 1:229756490-229756512 TTGCAGGGTCAGAATTTGAATGG + Intergenic
924443882 1:244110321-244110343 TAGCAGAGCCAGGATTGGAAGGG - Intergenic
924749808 1:246875465-246875487 GGGCAGAGGCAGGGTTTGAGAGG + Intronic
1063725693 10:8635287-8635309 TGGCAGCTCCAGGATTTGAATGG - Intergenic
1064544432 10:16436832-16436854 GGGCGTGGCAAGGGTTTGAAGGG + Intergenic
1065170508 10:23022704-23022726 TGGCAGGTCTAGGGGTAGAAGGG - Intronic
1065936833 10:30527913-30527935 TAGCAGAGACAGGGTTTCAAGGG + Intergenic
1066309612 10:34183653-34183675 TGGGAGGGCCAGGTTTTCACGGG + Intronic
1066687440 10:37994199-37994221 TGACAGGTCCAGAGTCTGAAAGG - Intergenic
1066962199 10:42233997-42234019 AGGCAGGACCAGGGCTGGAAAGG + Intergenic
1067450021 10:46376380-46376402 AGGCAGGGCCAGGTCCTGAAAGG + Intronic
1067587224 10:47483383-47483405 AGGCAGGGCCAGGTCCTGAAAGG - Intronic
1067634281 10:47991150-47991172 AGGCAGGGCCAGGTCCTGAAAGG - Intergenic
1067697902 10:48548755-48548777 TGGGAGGGGCAGGGTTTGCCAGG + Intronic
1068583575 10:58771208-58771230 TGGCTGTGCCAGAGTCTGAAGGG + Intronic
1068869977 10:61932757-61932779 AGGCAGTGGCAGGGTTTGAGAGG - Intronic
1070105628 10:73428161-73428183 TGCTAGGGCCAGGTTTTGAGGGG + Exonic
1073838507 10:107471491-107471513 TGGGAGGGCCAGGTTTTTCACGG - Intergenic
1074452042 10:113567344-113567366 TGGCTGGGCTAGAGGTTGAAGGG - Intronic
1075646677 10:124101364-124101386 TGGGAGGCCCACGGTCTGAAAGG + Intergenic
1076870164 10:133189100-133189122 TGGCAGGGCTAGGCTTTGACGGG - Intronic
1077099672 11:816525-816547 AGGGAGGGCCAGGGTATGGAGGG - Intergenic
1077124802 11:928105-928127 TGCCAGGGCCTGCGTTTGACAGG + Intronic
1077347174 11:2067293-2067315 AGGCAGTGGCAGGGTTTGAGAGG - Intergenic
1077891896 11:6424603-6424625 TGGGAGGGGCAGGGATGGAAGGG + Intergenic
1081314909 11:41620366-41620388 TGACAGGGTCAGTGTTTGAAGGG + Intergenic
1082792912 11:57359499-57359521 AGGCAGGGCCAGAGTTTTCAGGG - Intronic
1083902862 11:65652161-65652183 TGGCAGGGCCAGGGCTGACAGGG + Intergenic
1084026332 11:66452376-66452398 TGGCAGGGGCTGGATCTGAAGGG + Intronic
1084428036 11:69096199-69096221 TGGGAGGCCCAGGGGGTGAAGGG + Intergenic
1084607831 11:70182735-70182757 TGGGAGAGCCTGGGTTTGGACGG + Intronic
1085046602 11:73357140-73357162 TGGCTGGGCCGGGGTTTGGGTGG + Intronic
1085410765 11:76289077-76289099 TGGCAGTGCCTGGGGTGGAAGGG + Intergenic
1085903048 11:80724972-80724994 TATCAGGGCCAGGGGTGGAATGG - Intergenic
1086058491 11:82675992-82676014 TGGGAGGGCCAGGTTTTTCATGG - Intergenic
1086615385 11:88811789-88811811 TGGAAGGGGCAGGGTGTGATTGG - Intronic
1087104739 11:94398291-94398313 AGGCGGGGCCAGGTTGTGAAGGG - Intronic
1088169104 11:106975540-106975562 TTGCATGGCCAGAGTTTCAAGGG + Intronic
1088533387 11:110834766-110834788 AAGTAGAGCCAGGGTTTGAAGGG + Intergenic
1088797711 11:113277738-113277760 TGGCAGAGCCAGGGTTCTAGGGG - Exonic
1089359668 11:117877339-117877361 TGGCAGGGCCAGAGGTGGATGGG - Intronic
1089364991 11:117916005-117916027 TGGCAGAGCCAGGGTCTGTGTGG + Intronic
1089700588 11:120241659-120241681 AGAGAAGGCCAGGGTTTGAATGG + Intronic
1091222128 11:133935889-133935911 TGCCAAGGCCAGGGTCTGCATGG - Intronic
1091838377 12:3601944-3601966 TGGCAGGGCCAGGGCTTATCTGG - Intergenic
1096461830 12:51825964-51825986 TGGAAGGGCCAGGTAATGAAGGG - Intergenic
1096634730 12:52950922-52950944 TGGCCAGGCCAGGGATTGAGGGG + Intronic
1096957326 12:55539894-55539916 TGGGAGGGCCAGGTTTTTCAGGG - Intergenic
1098103569 12:67045029-67045051 TGGCAGAGCCAAGATTTGAATGG + Intergenic
1098998393 12:77148135-77148157 GGGCAGGGCCAGTGTTTGAATGG + Intergenic
1100384193 12:94090872-94090894 TGGCAGGCACAGGGTTATAAAGG - Intergenic
1101641796 12:106591036-106591058 TGGCAGAACCAGGATTTGAGCGG + Intronic
1101820100 12:108177431-108177453 AGGCAGAGCCAGGATTTGACTGG - Intronic
1101840334 12:108323486-108323508 TTTGAGGGCTAGGGTTTGAATGG - Intronic
1101930047 12:109006500-109006522 TGGCAGCCCCAGGGTTTGTCAGG + Intronic
1104114305 12:125734687-125734709 TGGCAGGGCCACAGTATGCAAGG + Intergenic
1106149147 13:27081237-27081259 TAGCAGCGTCAGGGTTTGAGAGG - Intronic
1109508840 13:63341566-63341588 AAGCAGTGGCAGGGTTTGAAAGG - Intergenic
1109532922 13:63676504-63676526 AAGCAGTGGCAGGGTTTGAAAGG - Intergenic
1110540865 13:76705398-76705420 TGGCAGGGCCCTGGGTAGAAAGG - Intergenic
1111996818 13:95173593-95173615 TTGCATGGCAAGGGTTGGAAAGG + Intronic
1113641914 13:111963661-111963683 GGGCAGGGGCAGGGTTTGTTGGG + Intergenic
1114808215 14:25862781-25862803 TGGTTGGGCAAGGGTTTAAAGGG + Intergenic
1115523143 14:34252900-34252922 TTGCAGAGCCAGGTTTGGAAAGG + Intronic
1116121404 14:40725319-40725341 AGGCAAGGCCAGGGTTTGTGTGG + Intergenic
1116390169 14:44381863-44381885 TGGCTGGGCTAGGCTTTAAAAGG - Intergenic
1117169368 14:53076554-53076576 AGGCAGTGGCAGGGTTTGACAGG + Intronic
1118060708 14:62135142-62135164 GGGAAGGGCCAGGGGTAGAATGG - Intergenic
1118583886 14:67332626-67332648 TGGCCGTGACAGGGTTGGAAAGG + Intronic
1118654108 14:67928514-67928536 TGGGAGGGCCAGGTTTTTCACGG - Intronic
1118692931 14:68357121-68357143 AAGCAGTGGCAGGGTTTGAAAGG - Intronic
1119539572 14:75429088-75429110 TGGCAGAGCCAGGCTTTGCCTGG + Intronic
1121122213 14:91383210-91383232 TGGCAGAGCCAGGGTTCGAGGGG - Intronic
1121337254 14:93085000-93085022 TGCCAGGCCCAGGGTCTGCAGGG - Intronic
1121798757 14:96756136-96756158 TGGCAGGGCCAGGGAGGGGATGG - Intergenic
1122556589 14:102583922-102583944 AGGCAGGTGCAGGGTGTGAAGGG + Intergenic
1123708561 15:22968484-22968506 TGGCAAGTCCAGCGTTTGCAAGG - Intronic
1124093210 15:26625211-26625233 TGGCAGGGTGGGGCTTTGAAAGG + Intronic
1124639390 15:31387122-31387144 AAGCAGTGCCAGGGTTTGAGAGG + Intronic
1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG + Intergenic
1125928168 15:43580514-43580536 TGGGAGGGGCAGTGTTAGAAAGG + Intronic
1125941312 15:43680072-43680094 TGGGAGGGGCAGTGTTAGAAAGG + Intergenic
1125941333 15:43680348-43680370 TGGGAGGGGCAGTGTTAGAAAGG + Intergenic
1128335109 15:66780684-66780706 AGGCAGGGGCAGGGTGTGCATGG + Intronic
1128455392 15:67828727-67828749 TGGCAGGGCCGGGGCTTGAGGGG + Intronic
1128760758 15:70214771-70214793 TGGCAGGACCAGGTTGGGAAGGG - Intergenic
1129705814 15:77793461-77793483 TGGCAGGGCCAGGGCTGGCATGG - Intronic
1129727648 15:77909680-77909702 TGGGAGGGCCAGGGTGGGGAGGG - Intergenic
1130652894 15:85772383-85772405 TGGCAGGGCCAGGGTGGGGCAGG - Intronic
1131898752 15:97064513-97064535 TGGCAGTGGCAGGCTTTGAGCGG + Intergenic
1134693058 16:16203669-16203691 CGGCAGGGCCAGGCATTAAAGGG + Intronic
1134978789 16:18591026-18591048 CGGCAGGGCCAGGCATTAAAGGG - Intergenic
1135294305 16:21265900-21265922 TGGCAGAGCTGGGATTTGAACGG - Intronic
1135404973 16:22191065-22191087 GGGCAGGGCCAGGGCCTGGAGGG - Exonic
1135422567 16:22314923-22314945 TGGGAGGGACACGGTTGGAACGG + Intronic
1135487794 16:22881080-22881102 TGGCAGAGCTAGAATTTGAATGG - Intronic
1135685449 16:24494956-24494978 TGGCAGAGCGAGGATTTGAACGG - Intergenic
1135740835 16:24973932-24973954 TGGCTGGCACAGGGTGTGAACGG + Intronic
1136342964 16:29656891-29656913 TGGCAGGGCCATGGGTGGAAGGG + Intergenic
1137416297 16:48284292-48284314 AGGCAGCAACAGGGTTTGAAAGG + Intronic
1138596059 16:58029571-58029593 TGGCAAGGGCTGGGTGTGAAGGG - Intronic
1141899900 16:86984383-86984405 GGGCAGAGCCAGGGTCTGAGCGG + Intergenic
1142770873 17:2095824-2095846 TGGGTGGGCGAGGGTTTGCAAGG - Intronic
1142996506 17:3763771-3763793 AGGCAGGGCTGGGGTTGGAATGG + Intronic
1143326132 17:6099676-6099698 TGGGAGGGCCAGGTTTTTCAAGG + Intronic
1146256183 17:31392409-31392431 GGGCCGGGCCAGGGGGTGAAAGG + Intronic
1146445188 17:32927806-32927828 TGGCAGAGGCAGGGTTTCAATGG + Intergenic
1147342848 17:39764978-39765000 TGGCAGAGCAAGGGTATAAAGGG - Exonic
1147499094 17:40945120-40945142 CGGCAGGGCAAGGGTATGCAAGG + Intergenic
1147554844 17:41471262-41471284 AGGCAGTGGCAGGGTTTGAGAGG - Intergenic
1148149814 17:45389870-45389892 TGGGAGGGCCAGGGGTTGGAGGG + Intergenic
1148680595 17:49471238-49471260 GGGCAGGGCTAGGGGTTGGAAGG + Intronic
1148710367 17:49676416-49676438 TGTAAGGGCCAGGGTTAAAAGGG + Intronic
1149007885 17:51824342-51824364 TAGCAGGGCCAGGGATTGGCTGG + Intronic
1149298280 17:55281074-55281096 TGGCAGGGTAAGGCTTTTAAAGG + Intronic
1149299538 17:55292158-55292180 TAGCAGTGGCAGGGTTTGAGAGG + Intronic
1150158785 17:62876207-62876229 GGGCAGGCCCAGGCTGTGAAGGG - Intergenic
1150174382 17:63034956-63034978 AAACAGTGCCAGGGTTTGAAAGG + Intronic
1150250957 17:63704266-63704288 GGGTAAGGCCAGGGTGTGAAGGG - Intronic
1150299433 17:64036268-64036290 TGACAGGGTCAGGGGTTGGAGGG - Intergenic
1152890410 17:82878399-82878421 TGGCAGTGCCAGGCTTGGAGCGG - Intronic
1154139561 18:11811097-11811119 TGGCAAGGCCCGGATTTCAATGG - Intronic
1154192954 18:12245696-12245718 TGGCATGGCCGTGGTTTGAGAGG - Intergenic
1155934422 18:31740335-31740357 TGGCAGGGCCAGTTTTTTCACGG - Intergenic
1156098300 18:33562802-33562824 TGGCTGGGCTAGGCTTTAAAAGG - Intergenic
1156180437 18:34597460-34597482 TGGCAGGGTGAGGGTGTGGATGG - Intronic
1156181915 18:34614854-34614876 AGGCAGTGACAGGGTTTGAGAGG + Intronic
1156527813 18:37783769-37783791 TGGAAGAGCCATGGTTTGTAAGG - Intergenic
1159659020 18:71070496-71070518 TGGCAGGGCAATGGTTTGTCCGG + Intergenic
1160298402 18:77657874-77657896 CAGCAGGGCCAGGGACTGAAGGG + Intergenic
1160512443 18:79460114-79460136 TGGCATGGCCAGGGCTTGGCTGG + Intronic
1160686093 19:437538-437560 TGGCTGGGCCGGGGTTGGCAAGG - Intronic
1161352814 19:3803381-3803403 TGGCAGGGGCTGGGTGTGCAGGG - Intergenic
1161501964 19:4621160-4621182 TGTCAGGGCCGGGGCTGGAAAGG - Intergenic
1161939905 19:7395592-7395614 GGGCAGGACCAGGGATGGAATGG + Intronic
1162013060 19:7829793-7829815 TGCCAGGGCCCAGGTTTGAGGGG + Intergenic
1162059501 19:8086081-8086103 TGGGAGGGACAGGGAGTGAAGGG + Intronic
1163349994 19:16770552-16770574 TGGCAGCGCCAAGATTTCAATGG - Intronic
1163488278 19:17602426-17602448 TGGCAGGGCAAGGGTTAAAGGGG - Exonic
1163844110 19:19628804-19628826 GGGCAGGGCCGGGCTTTGCAGGG - Exonic
1164064117 19:21699426-21699448 TGGGAGGGCCAGCCTTTGCATGG + Intergenic
1164762280 19:30737058-30737080 TGGCATGGCCAGGGATGGGAGGG + Intergenic
1165258159 19:34592444-34592466 AGGGAGGGACAGGGTTTGGAGGG + Intergenic
1165266179 19:34665053-34665075 GGGCAGGTCCAGGGTCAGAAAGG - Intronic
1165568449 19:36753825-36753847 TAGCAGAGCTAGGATTTGAATGG + Intronic
1165912569 19:39238096-39238118 GGGCAGGACTAGGGTTTGAGGGG + Intergenic
1166046991 19:40235608-40235630 TGGCAGAGCCAGGATAGGAACGG - Intronic
1166144761 19:40826353-40826375 AGGCAGGGACAGGGTCTCAAAGG + Intronic
1166182981 19:41121854-41121876 AGGCAGGGACAGGGTCTCAAAGG - Intronic
1166258848 19:41624309-41624331 TGGCTGGTGCAGGGTGTGAATGG + Intronic
1166810178 19:45509546-45509568 TGGGAGGGCCAGGGCTTCCAGGG - Intronic
1167385472 19:49160634-49160656 GGGCAGGGCCAGAGCTTGCAGGG + Intronic
1167488215 19:49775872-49775894 GGGCAGGGCCCAGGTTTGACAGG + Intronic
1167552182 19:50168980-50169002 TTGCATGGCCTGGGATTGAATGG + Intergenic
1167710154 19:51105440-51105462 AGGCAGGACCAGGATTTGACTGG - Intronic
925316551 2:2931033-2931055 TACCAGGGCCAGGGGGTGAAGGG + Intergenic
925530032 2:4849300-4849322 TTGCAGGGGCAGGGTTTGCATGG + Intergenic
926145144 2:10392764-10392786 TGGCAAGGCCAGGGGCTGCATGG - Intronic
927250082 2:20989355-20989377 TGGCTGGGCCTGGGTTTCACGGG - Intergenic
927914243 2:26924782-26924804 AGGCAGGGCCTGTCTTTGAATGG + Intronic
928096750 2:28409562-28409584 CTGCAGGGCCAGGCTCTGAAGGG - Intronic
928127485 2:28626574-28626596 GGGCAGGGCCAGGGATGGATGGG - Intronic
928638348 2:33271133-33271155 TGGCAGGGACAGCCTTAGAATGG - Intronic
929757953 2:44783571-44783593 AAGCAGGGGCAGGGTTTCAAAGG + Intergenic
930381384 2:50634745-50634767 TGGAAGGGCCAGGTCTTGAGGGG - Intronic
932640305 2:73439345-73439367 TGGGAGGATCAGGCTTTGAAAGG - Intronic
933775816 2:85770620-85770642 TGGCAGGGCCTGGGCTGGAGGGG + Intronic
934020926 2:87951112-87951134 TTACAAGGCTAGGGTTTGAATGG - Intergenic
935064267 2:99634358-99634380 TGGCAGAGCCAAGGCTTGAAGGG + Intronic
935086864 2:99855822-99855844 TGGCAGAGACAGTGTTTGACAGG - Intronic
935700794 2:105810028-105810050 TGGCAGGGCCAGGGCTGAGAGGG + Intronic
936022092 2:109002574-109002596 TGGCTGGGCCAGGTTGTGAAGGG - Intergenic
938729012 2:134131381-134131403 TGGCAGAGCCAGGGTACAAAAGG + Intronic
939828043 2:147039300-147039322 TGTCAAGGCCAGGGTAGGAATGG - Intergenic
940286901 2:152041502-152041524 TGGCCAGGCCAGGGGCTGAAGGG + Intronic
940827396 2:158428307-158428329 TGGTAGGGTCAGGGATTGCACGG + Intronic
941199901 2:162495423-162495445 TGGCTGGGCTAGGCTTTAAAAGG + Intronic
941644694 2:168027301-168027323 TGTAAGGGCAAGGGTTTGGAGGG - Intronic
941754813 2:169173773-169173795 TTGCAGTGCCAGAGTTTGCAGGG + Intronic
942833082 2:180260141-180260163 AGGCAGTGGCAGGGTTTAAAAGG - Intergenic
944003709 2:194875864-194875886 AGGCAGCAGCAGGGTTTGAAAGG + Intergenic
945841215 2:214890162-214890184 TAGCAGCCCCAGGGTTTGATGGG - Intergenic
946404253 2:219484164-219484186 GGGCAGCGCTAGGGTTTGCAGGG - Exonic
947035365 2:225847655-225847677 AGGCAGTGGCAGGGTTTGAGAGG - Intergenic
947678803 2:232010828-232010850 TGGCAGGGCCAGGACTACAATGG - Intronic
948702667 2:239770039-239770061 TGCCAGGGCCAGGGTGTCATGGG - Intronic
948869701 2:240791889-240791911 AGGCAGGGCCAGGGTGGGATGGG - Intronic
948869745 2:240792004-240792026 TGGCAGGGCCAGGGTGGGGTGGG - Intronic
948888803 2:240896987-240897009 TGGCAGGGCCAAGGGTCGATGGG - Intergenic
948901778 2:240959956-240959978 TGGGAGGGCCAGCATGTGAAAGG + Intronic
1168973451 20:1946798-1946820 AGGCAGGGCCTGGGTTCAAATGG + Intergenic
1169220743 20:3820977-3820999 TGGCCGGCCCGGGGGTTGAAAGG - Intronic
1169576390 20:6966608-6966630 TGGCAGGGCCATGCTTTGTCTGG - Intergenic
1169807074 20:9570615-9570637 CAGCAAGGCCAGGGTGTGAAGGG + Intronic
1172446526 20:34996320-34996342 TGCCAGGGCCAGGGCCAGAATGG - Intronic
1173185124 20:40834561-40834583 TTCCAGGGCCAGGTTGTGAAAGG + Intergenic
1173569259 20:44066169-44066191 TGGCAGGGCCAGGGTTTGAAAGG - Intronic
1173671103 20:44799456-44799478 TGGCTCGGCCAGGGCTTGGATGG + Intronic
1173929428 20:46806461-46806483 TGGCCTGGCCAGGGGTTGCATGG - Intergenic
1174757088 20:53170122-53170144 TTACAGAGCCAGGTTTTGAATGG + Intronic
1175335467 20:58193195-58193217 TGGCAGGGTCAGGGCTGGACAGG - Intergenic
1175934241 20:62507758-62507780 TGGCAGGGCCAGTCTTTGGGTGG + Intergenic
1175992610 20:62796979-62797001 GGGGAGGGCCAGGGTGTGGAGGG - Intronic
1176125714 20:63473576-63473598 TGGCAGGGGCAGGGACTGGAGGG + Intergenic
1176751485 21:10694600-10694622 TGGAAAGGCCAGGAATTGAATGG - Intergenic
1176858361 21:13987619-13987641 TGGCAGGGCCAGGGTAGCACAGG - Intergenic
1178070803 21:28964126-28964148 CAGCAGTGGCAGGGTTTGAAAGG + Intronic
1178917292 21:36713331-36713353 TGGCAAGCCAAGGGTTTGATGGG + Intronic
1179428515 21:41302636-41302658 TGGCAGTGGCAGGGTTTGAGGGG - Intergenic
1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG + Intergenic
1180628122 22:17208007-17208029 TGTCAGGGCCAGGGGCTGGATGG - Intronic
1180956380 22:19743229-19743251 TGGAGGAGCCAGGATTTGAATGG + Intergenic
1181045638 22:20213054-20213076 CGCCAGGGCCAGGGATGGAAAGG - Intergenic
1181355192 22:22292815-22292837 AGGCAGGGCCAGGGCTGGCAAGG + Intergenic
1181697754 22:24602364-24602386 TGGAGGGGCCAGGATTTGATGGG + Intronic
1181956475 22:26590743-26590765 TGGCAGGGCTGGGGGTGGAAAGG - Intronic
1181967541 22:26667535-26667557 AGACAGGGCAAGGGTTTGAGGGG - Intergenic
1182128818 22:27835790-27835812 TGGCAAAGCCAGGGTTCCAAGGG - Intergenic
1182872116 22:33657100-33657122 AGGCAGGGCCAGGGTCTGGATGG + Intronic
1183270392 22:36858559-36858581 TGGGGGGGCCGGGGTTTGGAGGG + Intergenic
1183455005 22:37917817-37917839 TGGGAGGGCCAGGGGTGGAGGGG + Intronic
1184495522 22:44839029-44839051 AGGGAGGGACAGGGTTTGAAAGG + Intronic
1184827344 22:46961738-46961760 TGGCTCTGTCAGGGTTTGAAAGG + Intronic
1185277743 22:49957034-49957056 AGGCATGGCCTGGGTTGGAAGGG + Intergenic
949461828 3:4302793-4302815 TGGCAGGGCAGGGGTTTGGAGGG + Intronic
950019340 3:9776086-9776108 AGGCTGGGCAAGGGTTTGAATGG - Intronic
950849776 3:16051383-16051405 TGGCAGGCCCAGGGTGTGAGCGG + Intergenic
951164288 3:19466351-19466373 AAGCAGTGGCAGGGTTTGAAAGG + Intronic
951980716 3:28563658-28563680 TGCCAGGGGCAGGGTTTGAGGGG + Intergenic
953023406 3:39130362-39130384 AGGCTGGGCTAGGGTGTGAAGGG + Intronic
953422370 3:42764495-42764517 TGGCAGGGACAGTGGTTTAATGG - Intronic
954640749 3:52096370-52096392 TGGTCTGGCCAGGGCTTGAATGG + Intronic
955263130 3:57414993-57415015 TCACAGGCCCATGGTTTGAAAGG + Intronic
955377257 3:58408471-58408493 TGGCTGGGGTAGGATTTGAATGG + Intronic
955469710 3:59273773-59273795 TGGCAGGAGCAGGCTTAGAAAGG + Intergenic
955560065 3:60179291-60179313 CGGCAGGGCAGGGATTTGAAAGG + Intronic
957981840 3:87520334-87520356 TGGAGGGGCCAGGGGTGGAATGG + Intergenic
958261798 3:91390693-91390715 TGGCAGGGGAAGGGGTTGAGTGG - Intergenic
959511311 3:107215812-107215834 AGGCAGTGGCAGGGTTTGAGAGG + Intergenic
960258748 3:115540441-115540463 AGGCAGTGACAGGGTTTGAGAGG - Intergenic
960869263 3:122232603-122232625 AGGCAGGGCCAGTGTATGCAGGG + Intronic
962601042 3:136990982-136991004 TGGCAGGGCCAGGGCTAAGAGGG + Intronic
966225066 3:177589448-177589470 TTACAGAGCCAGGGTTTGAATGG - Intergenic
966369072 3:179227512-179227534 TTGTAGGGCCAGGGCTTCAAGGG + Intronic
968442475 4:630887-630909 TGGAAGGACCAGGGAGTGAATGG + Intronic
968742411 4:2337961-2337983 GGGCAGGGCTGGGGTTTCAAGGG - Intronic
969240602 4:5894537-5894559 TGGCAGGGCCCGGGGTTGAAGGG - Intergenic
969451588 4:7276908-7276930 TGGTAGGGCCAGGATTGGAAGGG + Intronic
969627193 4:8311713-8311735 TTGCCTGGCCTGGGTTTGAAGGG - Intergenic
970364175 4:15341811-15341833 TGGGATGGCCAGCGTTTGCATGG + Intronic
972798754 4:42449857-42449879 TAGCAATGACAGGGTTTGAAAGG - Intronic
973214114 4:47649449-47649471 TGGCTGGGGCAGCCTTTGAAAGG + Intronic
973851982 4:54969906-54969928 TGGGAGGTCCAGGGTGGGAATGG + Intergenic
976074921 4:81286926-81286948 AGTCAGGGTCAAGGTTTGAAAGG + Intergenic
976154874 4:82132460-82132482 AAGCAGGGGCAGGGTTTGAGAGG + Intergenic
978034600 4:103977275-103977297 TGGAGGGGCCAGGGGTGGAAGGG + Intergenic
978713748 4:111816860-111816882 TGGCAGGGTTAGGGTTTTTATGG - Intergenic
981890638 4:149732200-149732222 TGGGTGGGCTAGAGTTTGAAGGG - Intergenic
982093058 4:151896990-151897012 TGACAGGGCCAAGCATTGAATGG + Intergenic
983058390 4:163126648-163126670 AGGCAGTGGCAGGGTTTGAGAGG + Intronic
983154894 4:164335148-164335170 AGGCAGTGGCAGGGTTTGAGAGG + Intronic
984885765 4:184447977-184447999 TGGCCGTGCCAGGGTCTCAATGG + Intronic
984910630 4:184671287-184671309 TGTGAGAGCCAGGGTTTGCAGGG + Intronic
985424313 4:189813369-189813391 TGGCAGAGCCTGGGTGGGAAAGG + Intergenic
985524003 5:392455-392477 AGGCAGGGCCAGAGTGTGCACGG + Intronic
991332964 5:65512282-65512304 TGGCAGTGGCAGGGTTTGAGAGG + Intergenic
991336065 5:65548601-65548623 AGGCAGCGTCAGGGTTTGAGAGG - Intronic
991394303 5:66187591-66187613 AAGCAGTGGCAGGGTTTGAAAGG + Intergenic
992204567 5:74418746-74418768 AGTCAGGGCCAGGGTGGGAATGG - Intergenic
993124937 5:83822378-83822400 TGGCAGGGGCAGGGGATGATTGG - Intergenic
993956247 5:94236550-94236572 AGGCAGTGGCAGGGTTTGAGAGG + Intronic
994353689 5:98773207-98773229 TGGCAGGGCCAGGGCAGGGAGGG + Intronic
996084227 5:119287603-119287625 TGCCAGGGGCTGGGTTTGGAGGG - Intronic
996841853 5:127855227-127855249 TAGCAGTGGCAGGGTTTGAGAGG - Intergenic
997281789 5:132653547-132653569 TGACAGCACCAGCGTTTGAAAGG + Intergenic
998367534 5:141640701-141640723 TGGCAGGGCCAGGGGGTGGGTGG + Exonic
998456798 5:142280006-142280028 AGGCAGGGCCAGGGCCTGCAGGG + Intergenic
998765466 5:145482076-145482098 TGACAGGGCCACGGAATGAAAGG - Intronic
1001190430 5:169625716-169625738 AGGCAGAGGCAGGGTTTGAGAGG + Intergenic
1001445582 5:171780215-171780237 TGGCGGGGGCAGGGAATGAATGG - Intergenic
1001847382 5:174934346-174934368 TGACAGGGAGATGGTTTGAAGGG - Intergenic
1002172280 5:177382046-177382068 TAGCAGGGGCAGGTTTCGAAAGG + Intronic
1002940417 6:1710771-1710793 TTGCAGGGCGGGGGTGTGAATGG + Intronic
1003094538 6:3131954-3131976 TGACAGTGCCCGGGGTTGAAGGG - Intronic
1003512615 6:6793946-6793968 TGGGAGGGGCAGGGTCAGAAGGG - Intergenic
1006373375 6:33658833-33658855 GGGCAGGGCCAGGGTTGGAGGGG + Intronic
1008993362 6:57629451-57629473 TGGCAGGGGAAGGGGTTGAGTGG + Intronic
1009181967 6:60528540-60528562 TGGCAGGGGAAGGGGTTGAGTGG + Intergenic
1009732283 6:67623108-67623130 TGGGAGGGGCTGGGTTGGAATGG + Intergenic
1010766157 6:79778752-79778774 TGGAAGGGCCAGACTTTGAAAGG + Intergenic
1011992235 6:93536237-93536259 TTGCAGGGACATGGTTGGAATGG - Intergenic
1015684996 6:135849766-135849788 TGGGAGGGCCAGATTTTGGAAGG - Intergenic
1015708922 6:136118193-136118215 TGATGGGGCCAGGGCTTGAAGGG - Intronic
1016741438 6:147533167-147533189 GGGCAGGTCCAGGGCTTGCAGGG + Intronic
1017388760 6:153914928-153914950 GGGCAGGGCCAGGACTTGGATGG + Intergenic
1017656234 6:156632355-156632377 TGGGAGGGCCTAGGTGTGAAAGG + Intergenic
1018429612 6:163713071-163713093 TGGCATGGCTGGGGTTGGAAAGG + Intergenic
1018594823 6:165467777-165467799 AGGCAGAGACAGGGTTTGAAAGG + Intronic
1019119994 6:169794654-169794676 TGGCAGGTGCAGGGGGTGAAGGG + Intergenic
1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG + Exonic
1019702918 7:2482739-2482761 AGGCAGGGCCAGGGTTAGGGAGG + Intergenic
1020257645 7:6510875-6510897 TGTCAGGGGGAGGGTATGAATGG - Intronic
1022637226 7:32147792-32147814 GGGCAGGATCTGGGTTTGAAAGG + Intronic
1023862394 7:44224458-44224480 GGGCAGGGCCTGGGCTTGGAGGG + Intronic
1025639816 7:63355446-63355468 TGGCAGGGCAGGGTTTTCAAGGG - Intergenic
1025642883 7:63392646-63392668 TGGCAGGGCAGGGTTTTCAAGGG + Intergenic
1025712326 7:63924853-63924875 TGGCAGGGCAGGGTTTTCAAGGG + Intergenic
1025818919 7:64945496-64945518 GGGCAGGGCCTGGGTATGATTGG - Intergenic
1026775862 7:73230605-73230627 TGGCAGTGCCAGGGCTGGATGGG + Intergenic
1027016720 7:74783977-74783999 TGGCAGTGCCAGGGCTGGATGGG + Intronic
1027071308 7:75161959-75161981 TGGCAGTGCCAGGGCTGGATGGG - Intergenic
1027758535 7:82248030-82248052 TGGCATGCCCAGTGTTTTAAAGG - Intronic
1027912169 7:84264695-84264717 GGGTAGGGCGAGGGTTTGGAAGG + Intronic
1028045175 7:86108474-86108496 GGGAGGGGCCAGGGATTGAATGG + Intergenic
1029252278 7:99245305-99245327 TGGCAGGGACAGGGGTGGATAGG + Intergenic
1030322437 7:108183167-108183189 CGGTAGAGCCAGAGTTTGAAAGG - Intronic
1033446818 7:141430553-141430575 CGGAAGAGCCAGGATTTGAATGG + Intronic
1034883553 7:154780366-154780388 TGTCATGGCCTGTGTTTGAAAGG + Intronic
1035257253 7:157638693-157638715 TGGCATTCCCAGGGTTTGGAGGG + Intronic
1035387276 7:158482236-158482258 AGGCAGTGGCAGGGGTTGAAAGG + Intronic
1037654570 8:20872107-20872129 TGGCAGGGGCAGGGTGTGCAGGG + Intergenic
1038763187 8:30403792-30403814 TGGCAGGGGCAGGGGATGCAAGG - Intronic
1040690987 8:49938075-49938097 TGGCATGGCATGGATTTGAAAGG - Intronic
1041779895 8:61566507-61566529 AGGCAGTGGCAGGGTTTGAGAGG + Intronic
1042548196 8:69969980-69970002 AGGCAGGGGCAGGGCTTGAGAGG + Intergenic
1042575113 8:70209404-70209426 AGGCAGGAACAGGGTTTGAGAGG + Intronic
1044821912 8:96160824-96160846 TGGCGGGGCCGGGGTTTGTGTGG - Intergenic
1045384505 8:101658340-101658362 TGGCAGAGACAGAATTTGAAAGG - Intronic
1047662167 8:127049212-127049234 TGGAAAGACCATGGTTTGAATGG - Intergenic
1047807038 8:128371533-128371555 AGGCAGGGGCAGGGCTTGAGGGG + Intergenic
1048954846 8:139527142-139527164 TGGCAGGGGCTGGGTCTGCATGG + Intergenic
1049585021 8:143429022-143429044 TGGCAGGGCGAAGGTGGGAACGG + Exonic
1050040832 9:1491534-1491556 TGGAAGGGTGAGGGTTTAAAAGG + Intergenic
1051123966 9:13782948-13782970 GAGCAGGGGCAGGGTTTGAGAGG + Intergenic
1052426985 9:28317881-28317903 AGGCAGGGACTGGGTTTGACTGG - Intronic
1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG + Intronic
1054811984 9:69442311-69442333 TAGCAGGGCCAGGGGCTGCAGGG - Intronic
1054922584 9:70556736-70556758 TGGCAGAGTCAGGGTTTTGAGGG - Intronic
1055238097 9:74148723-74148745 TGGAAGGGCTATGGTTTGAATGG + Intergenic
1056443562 9:86643482-86643504 TGGCGGGGCCAGGATCTGAAGGG + Intergenic
1057857194 9:98610720-98610742 TGGCAGGGCCAGGGTCTCTCTGG - Intronic
1058895370 9:109396294-109396316 TGGAAGGGTCAGGGATGGAACGG + Intronic
1059459296 9:114419828-114419850 TGGCAGAGCTGGGATTTGAATGG + Intronic
1059764949 9:117375212-117375234 TGTCTGGGCCAGAGTTTGCATGG + Intronic
1060342941 9:122792873-122792895 AGGCAAGGCCAGGGTGGGAAAGG + Intergenic
1060414666 9:123421864-123421886 GGGCAGGGCCAGGTCTTGAATGG - Intronic
1060992339 9:127856322-127856344 TGGCAGAGCTAGGCTTTGAGAGG + Intergenic
1061881748 9:133572341-133572363 GGGCAGAGCCAGGGCCTGAAGGG + Intronic
1061952197 9:133942869-133942891 TGGCAGGGACAGGGACTGCACGG + Intronic
1062389440 9:136328064-136328086 TGGCAGGGCCAGGCTTGGGAGGG - Intronic
1062430053 9:136522909-136522931 TGGCAGGGCGAGGGGCTGCAGGG + Exonic
1062502539 9:136857598-136857620 TGGCAGGGGCAGGGATTGAGGGG + Intronic
1185510518 X:660702-660724 GGGCAGGGCTGGGGTTGGAAGGG + Intergenic
1186466693 X:9789047-9789069 TGGCATTGCCAGTGTTTGCATGG + Intronic
1187074947 X:15925428-15925450 AGGCAGTGGCAGGGTTTGAGAGG + Intergenic
1187797196 X:23017160-23017182 TGGTAGGGCTAGGAGTTGAAAGG + Intergenic
1188148954 X:26649051-26649073 TGGGAGGGCCAGGTTTTTCATGG - Intergenic
1189015769 X:37095031-37095053 TGGCAGGGGCAGGGGATGCAAGG - Intergenic
1189186430 X:39059412-39059434 TGCTAGGGCCAGAGTTTTAAAGG + Intergenic
1189740177 X:44109609-44109631 TTGCAGGGCCAGGGTGGGGAGGG + Intergenic
1190336736 X:49267215-49267237 GGGCAGGCCCAGGGTGTGAGAGG + Intergenic
1190538787 X:51456462-51456484 TGGGAGGGCCAGGTTTTTCACGG + Intergenic
1190570864 X:51779916-51779938 AGGCAGGGCCAGGCTATGCAGGG - Intergenic
1192238870 X:69314063-69314085 AGGCAGGGCCAAGGGTTGAGGGG + Intergenic
1194763490 X:97821899-97821921 TGCCAGGGCCAGGGGAGGAAAGG - Intergenic
1194846332 X:98814001-98814023 AAGCAGTGGCAGGGTTTGAAAGG - Intergenic
1195628276 X:107026819-107026841 AAGCAGTGGCAGGGTTTGAAAGG - Intergenic
1196520412 X:116664623-116664645 TGGCGGGGGCGGGGTTTGCAGGG + Intergenic
1196693931 X:118590883-118590905 GGGCAGAGACAGGGTTTCAAAGG - Intronic
1196749871 X:119106400-119106422 TGGCAGAGCAAGCATTTGAAAGG + Intronic
1196979481 X:121195757-121195779 TGGAAGAGCCAGGGCTAGAAAGG + Intergenic
1197052271 X:122074221-122074243 TGGAGGGGCCAGGGGTGGAATGG + Intergenic
1197062172 X:122194720-122194742 TGGCTGGGCTAGGCTTTAAAAGG + Intergenic
1198847761 X:140931164-140931186 TGGGAGGGCCAGGTTTTTCATGG + Intergenic
1198985774 X:142451464-142451486 TGGAAGGGCCATGGTTAGATGGG - Intergenic
1199123598 X:144088015-144088037 TTACAAGGCTAGGGTTTGAATGG + Intergenic
1201210358 Y:11674896-11674918 TGGAATGGGCAGGATTTGAATGG + Intergenic