ID: 1173570349

View in Genome Browser
Species Human (GRCh38)
Location 20:44071770-44071792
Sequence ATGGGGAGTGAGAGAGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173570349_1173570355 6 Left 1173570349 20:44071770-44071792 CCATGGGCTCTCTCACTCCCCAT No data
Right 1173570355 20:44071799-44071821 GCTCCCAAAGCTGCCAGCCCTGG No data
1173570349_1173570362 26 Left 1173570349 20:44071770-44071792 CCATGGGCTCTCTCACTCCCCAT No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570349_1173570356 7 Left 1173570349 20:44071770-44071792 CCATGGGCTCTCTCACTCCCCAT No data
Right 1173570356 20:44071800-44071822 CTCCCAAAGCTGCCAGCCCTGGG No data
1173570349_1173570363 27 Left 1173570349 20:44071770-44071792 CCATGGGCTCTCTCACTCCCCAT No data
Right 1173570363 20:44071820-44071842 GGGTGCCCCAGCCTTGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173570349 Original CRISPR ATGGGGAGTGAGAGAGCCCA TGG (reversed) Intergenic
No off target data available for this crispr