ID: 1173570352

View in Genome Browser
Species Human (GRCh38)
Location 20:44071789-44071811
Sequence CAGCTTTGGGAGCACAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173570352_1173570362 7 Left 1173570352 20:44071789-44071811 CCATCCCTGTGCTCCCAAAGCTG No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570352_1173570365 13 Left 1173570352 20:44071789-44071811 CCATCCCTGTGCTCCCAAAGCTG No data
Right 1173570365 20:44071825-44071847 CCCCAGCCTTGTCGTGGGCCAGG No data
1173570352_1173570363 8 Left 1173570352 20:44071789-44071811 CCATCCCTGTGCTCCCAAAGCTG No data
Right 1173570363 20:44071820-44071842 GGGTGCCCCAGCCTTGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173570352 Original CRISPR CAGCTTTGGGAGCACAGGGA TGG (reversed) Intergenic
No off target data available for this crispr