ID: 1173570357

View in Genome Browser
Species Human (GRCh38)
Location 20:44071802-44071824
Sequence CACCCAGGGCTGGCAGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173570357_1173570363 -5 Left 1173570357 20:44071802-44071824 CCCAAAGCTGCCAGCCCTGGGTG No data
Right 1173570363 20:44071820-44071842 GGGTGCCCCAGCCTTGTCGTGGG No data
1173570357_1173570362 -6 Left 1173570357 20:44071802-44071824 CCCAAAGCTGCCAGCCCTGGGTG No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570357_1173570365 0 Left 1173570357 20:44071802-44071824 CCCAAAGCTGCCAGCCCTGGGTG No data
Right 1173570365 20:44071825-44071847 CCCCAGCCTTGTCGTGGGCCAGG No data
1173570357_1173570372 29 Left 1173570357 20:44071802-44071824 CCCAAAGCTGCCAGCCCTGGGTG No data
Right 1173570372 20:44071854-44071876 CTGCAGCATCCTCCACCTGCCGG No data
1173570357_1173570373 30 Left 1173570357 20:44071802-44071824 CCCAAAGCTGCCAGCCCTGGGTG No data
Right 1173570373 20:44071855-44071877 TGCAGCATCCTCCACCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173570357 Original CRISPR CACCCAGGGCTGGCAGCTTT GGG (reversed) Intergenic
No off target data available for this crispr