ID: 1173570358

View in Genome Browser
Species Human (GRCh38)
Location 20:44071803-44071825
Sequence GCACCCAGGGCTGGCAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173570358_1173570374 30 Left 1173570358 20:44071803-44071825 CCAAAGCTGCCAGCCCTGGGTGC No data
Right 1173570374 20:44071856-44071878 GCAGCATCCTCCACCTGCCGGGG No data
1173570358_1173570363 -6 Left 1173570358 20:44071803-44071825 CCAAAGCTGCCAGCCCTGGGTGC No data
Right 1173570363 20:44071820-44071842 GGGTGCCCCAGCCTTGTCGTGGG No data
1173570358_1173570365 -1 Left 1173570358 20:44071803-44071825 CCAAAGCTGCCAGCCCTGGGTGC No data
Right 1173570365 20:44071825-44071847 CCCCAGCCTTGTCGTGGGCCAGG No data
1173570358_1173570362 -7 Left 1173570358 20:44071803-44071825 CCAAAGCTGCCAGCCCTGGGTGC No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570358_1173570373 29 Left 1173570358 20:44071803-44071825 CCAAAGCTGCCAGCCCTGGGTGC No data
Right 1173570373 20:44071855-44071877 TGCAGCATCCTCCACCTGCCGGG No data
1173570358_1173570372 28 Left 1173570358 20:44071803-44071825 CCAAAGCTGCCAGCCCTGGGTGC No data
Right 1173570372 20:44071854-44071876 CTGCAGCATCCTCCACCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173570358 Original CRISPR GCACCCAGGGCTGGCAGCTT TGG (reversed) Intergenic
No off target data available for this crispr