ID: 1173570362

View in Genome Browser
Species Human (GRCh38)
Location 20:44071819-44071841
Sequence TGGGTGCCCCAGCCTTGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173570357_1173570362 -6 Left 1173570357 20:44071802-44071824 CCCAAAGCTGCCAGCCCTGGGTG No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570350_1173570362 9 Left 1173570350 20:44071787-44071809 CCCCATCCCTGTGCTCCCAAAGC No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570354_1173570362 2 Left 1173570354 20:44071794-44071816 CCTGTGCTCCCAAAGCTGCCAGC No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570358_1173570362 -7 Left 1173570358 20:44071803-44071825 CCAAAGCTGCCAGCCCTGGGTGC No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570353_1173570362 3 Left 1173570353 20:44071793-44071815 CCCTGTGCTCCCAAAGCTGCCAG No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570349_1173570362 26 Left 1173570349 20:44071770-44071792 CCATGGGCTCTCTCACTCCCCAT No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570352_1173570362 7 Left 1173570352 20:44071789-44071811 CCATCCCTGTGCTCCCAAAGCTG No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data
1173570351_1173570362 8 Left 1173570351 20:44071788-44071810 CCCATCCCTGTGCTCCCAAAGCT No data
Right 1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173570362 Original CRISPR TGGGTGCCCCAGCCTTGTCG TGG Intergenic
No off target data available for this crispr