ID: 1173570374

View in Genome Browser
Species Human (GRCh38)
Location 20:44071856-44071878
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173570369_1173570374 -10 Left 1173570369 20:44071843-44071865 CCAGGTTCTCCCTGCAGCATCCT No data
Right 1173570374 20:44071856-44071878 GCAGCATCCTCCACCTGCCGGGG No data
1173570359_1173570374 21 Left 1173570359 20:44071812-44071834 CCAGCCCTGGGTGCCCCAGCCTT No data
Right 1173570374 20:44071856-44071878 GCAGCATCCTCCACCTGCCGGGG No data
1173570368_1173570374 2 Left 1173570368 20:44071831-44071853 CCTTGTCGTGGGCCAGGTTCTCC No data
Right 1173570374 20:44071856-44071878 GCAGCATCCTCCACCTGCCGGGG No data
1173570360_1173570374 17 Left 1173570360 20:44071816-44071838 CCCTGGGTGCCCCAGCCTTGTCG No data
Right 1173570374 20:44071856-44071878 GCAGCATCCTCCACCTGCCGGGG No data
1173570358_1173570374 30 Left 1173570358 20:44071803-44071825 CCAAAGCTGCCAGCCCTGGGTGC No data
Right 1173570374 20:44071856-44071878 GCAGCATCCTCCACCTGCCGGGG No data
1173570366_1173570374 7 Left 1173570366 20:44071826-44071848 CCCAGCCTTGTCGTGGGCCAGGT No data
Right 1173570374 20:44071856-44071878 GCAGCATCCTCCACCTGCCGGGG No data
1173570361_1173570374 16 Left 1173570361 20:44071817-44071839 CCTGGGTGCCCCAGCCTTGTCGT No data
Right 1173570374 20:44071856-44071878 GCAGCATCCTCCACCTGCCGGGG No data
1173570367_1173570374 6 Left 1173570367 20:44071827-44071849 CCAGCCTTGTCGTGGGCCAGGTT No data
Right 1173570374 20:44071856-44071878 GCAGCATCCTCCACCTGCCGGGG No data
1173570364_1173570374 8 Left 1173570364 20:44071825-44071847 CCCCAGCCTTGTCGTGGGCCAGG No data
Right 1173570374 20:44071856-44071878 GCAGCATCCTCCACCTGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173570374 Original CRISPR GCAGCATCCTCCACCTGCCG GGG Intergenic
No off target data available for this crispr