ID: 1173571347

View in Genome Browser
Species Human (GRCh38)
Location 20:44078600-44078622
Sequence TTCCAGGCCCTTTCTAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173571340_1173571347 23 Left 1173571340 20:44078554-44078576 CCATTCCTCCTTCCTATCTTGCT No data
Right 1173571347 20:44078600-44078622 TTCCAGGCCCTTTCTAAGAAAGG No data
1173571343_1173571347 11 Left 1173571343 20:44078566-44078588 CCTATCTTGCTTCTTCATTGTGG No data
Right 1173571347 20:44078600-44078622 TTCCAGGCCCTTTCTAAGAAAGG No data
1173571341_1173571347 18 Left 1173571341 20:44078559-44078581 CCTCCTTCCTATCTTGCTTCTTC No data
Right 1173571347 20:44078600-44078622 TTCCAGGCCCTTTCTAAGAAAGG No data
1173571342_1173571347 15 Left 1173571342 20:44078562-44078584 CCTTCCTATCTTGCTTCTTCATT No data
Right 1173571347 20:44078600-44078622 TTCCAGGCCCTTTCTAAGAAAGG No data
1173571339_1173571347 27 Left 1173571339 20:44078550-44078572 CCATCCATTCCTCCTTCCTATCT No data
Right 1173571347 20:44078600-44078622 TTCCAGGCCCTTTCTAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173571347 Original CRISPR TTCCAGGCCCTTTCTAAGAA AGG Intergenic
No off target data available for this crispr