ID: 1173574827

View in Genome Browser
Species Human (GRCh38)
Location 20:44105842-44105864
Sequence CTGTTAAAATGTATGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173574827_1173574829 -8 Left 1173574827 20:44105842-44105864 CCCTGGATCATACATTTTAACAG No data
Right 1173574829 20:44105857-44105879 TTTAACAGTTAGAATGTGTTTGG No data
1173574827_1173574834 23 Left 1173574827 20:44105842-44105864 CCCTGGATCATACATTTTAACAG No data
Right 1173574834 20:44105888-44105910 AACAAAAAACCTGATGAAGAGGG No data
1173574827_1173574833 22 Left 1173574827 20:44105842-44105864 CCCTGGATCATACATTTTAACAG No data
Right 1173574833 20:44105887-44105909 TAACAAAAAACCTGATGAAGAGG No data
1173574827_1173574835 24 Left 1173574827 20:44105842-44105864 CCCTGGATCATACATTTTAACAG No data
Right 1173574835 20:44105889-44105911 ACAAAAAACCTGATGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173574827 Original CRISPR CTGTTAAAATGTATGATCCA GGG (reversed) Intergenic
No off target data available for this crispr