ID: 1173575575

View in Genome Browser
Species Human (GRCh38)
Location 20:44111188-44111210
Sequence CAGGGACCCCAAAGGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173575575_1173575583 2 Left 1173575575 20:44111188-44111210 CCTCCATCCCTTTGGGGTCCCTG No data
Right 1173575583 20:44111213-44111235 ATCCTCTACCAAAACGCAAGAGG No data
1173575575_1173575584 3 Left 1173575575 20:44111188-44111210 CCTCCATCCCTTTGGGGTCCCTG No data
Right 1173575584 20:44111214-44111236 TCCTCTACCAAAACGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173575575 Original CRISPR CAGGGACCCCAAAGGGATGG AGG (reversed) Intergenic
No off target data available for this crispr