ID: 1173576560

View in Genome Browser
Species Human (GRCh38)
Location 20:44116006-44116028
Sequence GGCACCGCCTGCGCCGTCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173576560_1173576566 8 Left 1173576560 20:44116006-44116028 CCCGCGACGGCGCAGGCGGTGCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1173576566 20:44116037-44116059 CTCGATGGCCATGCGCTCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 112
1173576560_1173576564 5 Left 1173576560 20:44116006-44116028 CCCGCGACGGCGCAGGCGGTGCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1173576564 20:44116034-44116056 AGCCTCGATGGCCATGCGCTCGG 0: 1
1: 0
2: 1
3: 2
4: 81
1173576560_1173576570 21 Left 1173576560 20:44116006-44116028 CCCGCGACGGCGCAGGCGGTGCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1173576570 20:44116050-44116072 CGCTCGGTGGCTGGACGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1173576560_1173576562 -7 Left 1173576560 20:44116006-44116028 CCCGCGACGGCGCAGGCGGTGCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1173576562 20:44116022-44116044 CGGTGCCTGCAGAGCCTCGATGG 0: 1
1: 0
2: 0
3: 12
4: 112
1173576560_1173576571 22 Left 1173576560 20:44116006-44116028 CCCGCGACGGCGCAGGCGGTGCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1173576571 20:44116051-44116073 GCTCGGTGGCTGGACGCGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1173576560_1173576569 20 Left 1173576560 20:44116006-44116028 CCCGCGACGGCGCAGGCGGTGCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1173576569 20:44116049-44116071 GCGCTCGGTGGCTGGACGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 80
1173576560_1173576572 28 Left 1173576560 20:44116006-44116028 CCCGCGACGGCGCAGGCGGTGCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1173576572 20:44116057-44116079 TGGCTGGACGCGCGGGGCTGCGG 0: 1
1: 0
2: 5
3: 16
4: 271
1173576560_1173576567 12 Left 1173576560 20:44116006-44116028 CCCGCGACGGCGCAGGCGGTGCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1173576567 20:44116041-44116063 ATGGCCATGCGCTCGGTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173576560 Original CRISPR GGCACCGCCTGCGCCGTCGC GGG (reversed) Exonic