ID: 1173577222

View in Genome Browser
Species Human (GRCh38)
Location 20:44120294-44120316
Sequence GCCCCACAGTTGCACGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1338
Summary {0: 1, 1: 0, 2: 2, 3: 76, 4: 1259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173577216_1173577222 14 Left 1173577216 20:44120257-44120279 CCATAAATGATTGCATGGAGCAA 0: 1
1: 1
2: 7
3: 50
4: 304
Right 1173577222 20:44120294-44120316 GCCCCACAGTTGCACGTGACAGG 0: 1
1: 0
2: 2
3: 76
4: 1259
1173577215_1173577222 15 Left 1173577215 20:44120256-44120278 CCCATAAATGATTGCATGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 158
Right 1173577222 20:44120294-44120316 GCCCCACAGTTGCACGTGACAGG 0: 1
1: 0
2: 2
3: 76
4: 1259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173577222 Original CRISPR GCCCCACAGTTGCACGTGAC AGG Intronic
900628711 1:3622400-3622422 GACTCACAGTTACACATGACTGG - Intergenic
900758807 1:4456514-4456536 GCCACACAGTTCCACGTGGCTGG - Intergenic
900815511 1:4840714-4840736 GACTCACAGTTCCACGTGGCTGG + Intergenic
900863611 1:5251423-5251445 GACTCACAGTTCCACGTGGCTGG - Intergenic
900864462 1:5257875-5257897 GACTCACAGTTCCACGTGGCTGG - Intergenic
901252350 1:7790247-7790269 GACTCACAGTTCCACATGACTGG + Intronic
901265653 1:7908738-7908760 GACTCACAGTTCCACATGACTGG + Intergenic
901350729 1:8593533-8593555 GGCTCACAGTTGCACATGGCTGG - Intronic
901361932 1:8708732-8708754 GACTCACAGTTCCACGTGGCTGG - Intronic
901401991 1:9020993-9021015 GACTCACAGTTCCACGTGGCTGG - Intronic
902166395 1:14575301-14575323 GACTCACAGTTGCACGTGGCTGG + Intergenic
902653188 1:17850164-17850186 GACTCACAGTTCCACGTGGCAGG - Intergenic
902672861 1:17987002-17987024 GACTCACAGTTCCACGTGGCTGG + Intergenic
903106396 1:21084272-21084294 GACTCACAGTTCCACGTGGCTGG + Intronic
903262721 1:22139995-22140017 GCCCAACAGCTGCACGCGGCGGG + Intronic
904337482 1:29807491-29807513 GACTCACAGTTCCACGTGGCTGG - Intergenic
904849281 1:33445137-33445159 GACTCACAGTTCCACGTGGCTGG - Intergenic
906852580 1:49267736-49267758 GACTCACAGTTCCACGTGGCTGG + Intronic
907685030 1:56602016-56602038 GACTCACAGTTCCACGTGGCTGG - Intronic
907688245 1:56635387-56635409 GACTCACAGTTCCATGTGACTGG - Intronic
908098584 1:60766670-60766692 GACTCACAGTTCCACGTGGCTGG - Intergenic
908638203 1:66191755-66191777 GACTCACAGTTCCACGTGGCTGG + Intronic
908881884 1:68742123-68742145 GACTCACAGTTCCACGTGGCTGG - Intergenic
908954470 1:69605307-69605329 GACCCACAGTTTCATGTGGCTGG - Intronic
909239162 1:73190841-73190863 GACTCACAGTTCCACGTGGCTGG + Intergenic
909422871 1:75485765-75485787 GCCTCACAGTTCCACATGGCTGG + Intronic
909424725 1:75509929-75509951 GACTCACAGTTCCACATGACTGG + Intronic
909592051 1:77361648-77361670 GACTCACAGTTCCACGTGGCTGG + Intronic
909694715 1:78453880-78453902 GACTCACAGTTCCACGTGACTGG - Intronic
909953832 1:81753197-81753219 GACTCACAGTTCCACGTGGCTGG + Intronic
910278170 1:85470216-85470238 GACTCACAGTTCCATGTGACTGG + Intronic
910417282 1:87014227-87014249 GACCCACAGTTCCACATGGCTGG + Intronic
910479006 1:87638258-87638280 GACTCACAGTTGCACATGATTGG + Intergenic
910815215 1:91285137-91285159 GGCTCACAGTTCCACGTGGCTGG - Intronic
910977314 1:92920419-92920441 GACTCACAGTTCCACGTGGCTGG - Intronic
911007472 1:93242253-93242275 GACTCACAGTTCCACGTGGCTGG + Intronic
911007734 1:93244098-93244120 GACTCACAGTTCCACGTGGCTGG + Intronic
911515891 1:98867500-98867522 GACTCACAGTTCCATGTGACTGG + Intergenic
911829722 1:102535699-102535721 GACCCACAGTTCCACATGGCTGG + Intergenic
911831201 1:102553278-102553300 GACCTACAGTTGCACATGGCTGG + Intergenic
911951071 1:104173995-104174017 GCCTCACAGTTCCATGTGGCTGG + Intergenic
912003024 1:104858225-104858247 GACTCACAGTTCCACATGACTGG + Intergenic
912301728 1:108524762-108524784 GACTCACAGTTCCACATGACTGG + Intergenic
912708583 1:111933217-111933239 GACTCACAGTTCCACATGACTGG - Intronic
912974265 1:114313941-114313963 GCCTCACAGTTCCATGTGGCTGG + Intergenic
913307941 1:117451748-117451770 GCCTTACAGTTCCACGTGGCTGG - Intronic
915276964 1:154795783-154795805 GCCCCACAGGTCCACGTCTCTGG - Intronic
915876027 1:159612997-159613019 GACTCACAGTTCCACGTGGCTGG + Intergenic
916301893 1:163284946-163284968 GACTCACAGTTCCACGTGCCTGG + Intronic
916302632 1:163293283-163293305 GACTCACAGTTCCACATGACTGG + Intronic
916390935 1:164330241-164330263 GACTCACAGTTGCACGTGGCTGG - Intergenic
916989178 1:170224048-170224070 GACTCACAGTTCCACGTGGCTGG + Intergenic
917103909 1:171473104-171473126 GACTCACAGTTCCACATGACTGG + Intergenic
917894765 1:179477383-179477405 GTCTCACAGTTCCACGTGGCTGG + Intronic
918039339 1:180903117-180903139 GACTCACAGTTCCACGTGACTGG + Intergenic
918133942 1:181653459-181653481 GACTCACAGTTCCACGTGGCTGG - Intronic
918230735 1:182528846-182528868 GACGCACAGTTCCACATGACTGG + Intronic
918409654 1:184245359-184245381 GACTCACAGTTCCACATGACTGG + Intergenic
918734340 1:188038928-188038950 GACTCACAGTTCCATGTGACTGG - Intergenic
918735496 1:188057516-188057538 GACTCACAGTTTCATGTGACTGG + Intergenic
918897169 1:190362820-190362842 GACTCACAGTTCCACGTGGCTGG - Intronic
919021877 1:192116059-192116081 GACTCACAGTTCCACGTGGCTGG - Intergenic
919037954 1:192340711-192340733 GACTCACAGTTCCACGTGGCTGG + Intronic
919141929 1:193583398-193583420 GACTCACAGTTCCATGTGACTGG + Intergenic
919391816 1:196994787-196994809 GACTCACAGTTTCACGTGGCTGG + Intronic
920719284 1:208371974-208371996 GACTCACAGTTCCACGTAACTGG + Intergenic
920734148 1:208515890-208515912 GACTTACAGTTGCACGTGGCTGG + Intergenic
920784590 1:209028699-209028721 GACTCACAGTTACACGTGGCTGG - Intergenic
921676709 1:217984191-217984213 GACCCACAGTTCCACATGGCTGG + Intergenic
921891614 1:220359425-220359447 GACTCACAGTTCCACGTGGCTGG - Intergenic
922198415 1:223380623-223380645 GACTCACAGTTCCACATGACTGG + Intergenic
922253580 1:223872072-223872094 GACTCACAGTTCCACATGACTGG - Intergenic
922803886 1:228375982-228376004 GCCACACAGGAGCACGTGAGGGG - Intronic
923008862 1:230072672-230072694 GCCCCACTGTTACATGTGAGTGG - Intronic
923094806 1:230766751-230766773 GACTCACAGTTCCACGTGGCTGG + Intronic
923250696 1:232177251-232177273 GACTCACAGTTCCACGTGGCTGG - Intergenic
923793825 1:237134371-237134393 GACTCACAGTTCCACGTGGCTGG + Intronic
923880969 1:238103880-238103902 GACTCACAGTTCCACGTGGCTGG + Intergenic
923915614 1:238500343-238500365 GACTCACAGTTCCACGTGACTGG - Intergenic
923932650 1:238720533-238720555 GACTCACAGTTTCACGTGGCTGG + Intergenic
924104553 1:240637183-240637205 GACTCACAGTTCCACGTGGCTGG - Intergenic
924178762 1:241419907-241419929 GACTCACAGTTCCACGTGGCTGG - Intergenic
924452709 1:244192686-244192708 TCCCCACAGTCGCACATGATGGG + Intergenic
1062810227 10:457934-457956 GCCCCAGAGCAGCACGTGATGGG + Intronic
1063031334 10:2238255-2238277 GACTCACAGTTCCACATGACTGG + Intergenic
1063505943 10:6599886-6599908 GACTCACAGTTCCACGTGGCTGG + Intergenic
1063544249 10:6964416-6964438 GACTCACAGTTCCACGTGGCTGG - Intergenic
1063567602 10:7184453-7184475 GACTCACAGTTCCACGTGGCTGG - Intronic
1063782973 10:9347968-9347990 GACTCACAGTTCCACGTGGCTGG - Intergenic
1063972631 10:11392099-11392121 GACTCACAGTTCCATGTGACTGG + Intergenic
1064144529 10:12816943-12816965 GACTCACAGTTCCACGTGGCTGG + Intronic
1064178126 10:13093185-13093207 GACTCACAGTTCCACGTGGCTGG + Intronic
1064318757 10:14281975-14281997 GACTCACAGTTACACGTGGCGGG + Intronic
1064421379 10:15193713-15193735 GACTCACAGTTCCACGTGGCTGG - Intergenic
1064496415 10:15915170-15915192 GACCCACAGTTCCACATGGCTGG - Intergenic
1064498295 10:15939501-15939523 GACTCACAGTTCCACGTGGCTGG + Intergenic
1064534843 10:16348056-16348078 GCCTTACAGTTCCACGTGGCTGG - Intergenic
1064629775 10:17297852-17297874 GACTCACAGTTACACGTGGCTGG + Intergenic
1064630823 10:17309016-17309038 GACTCACAGTTTCACGTGGCTGG + Intergenic
1064638830 10:17395206-17395228 GACTCACAGTTCCACGTGGCTGG - Intronic
1064690362 10:17911607-17911629 GACTCACAGTTCCACGTGGCTGG + Intergenic
1065036884 10:21648757-21648779 GTCTCACAGTTGCACATGGCTGG + Intronic
1066288987 10:33996992-33997014 GACTCACAGTTCCACGTGGCTGG + Intergenic
1066480251 10:35788587-35788609 GACTCACAGTTCCACGTGGCTGG - Intergenic
1066578738 10:36856624-36856646 GACTCACAGTTTCACATGACTGG + Intergenic
1068056319 10:52016223-52016245 GACTCACAGTTCCACATGACTGG + Intronic
1068173482 10:53425873-53425895 GACTCACAGTTCCACGTGGCTGG + Intergenic
1068177979 10:53486683-53486705 GACTCACAGTTCCACATGACTGG + Intergenic
1068243690 10:54337466-54337488 GACCCACAGTTCCACGTGGCTGG - Intronic
1068288205 10:54966810-54966832 GACTCACAGTTCCACGTGGCTGG - Intronic
1068477142 10:57542421-57542443 GACTCACAGTTCCACGTGGCTGG + Intergenic
1068478998 10:57564641-57564663 GACTCACAGTTCCACATGACTGG - Intergenic
1069055466 10:63840012-63840034 GCCTCACAGTTCCATGTGGCTGG - Intergenic
1069923133 10:71829561-71829583 GACTCACAGTTCCACGTGGCTGG - Intronic
1070521540 10:77257868-77257890 GACTCACAGTTCCACGTGGCTGG - Intronic
1070651247 10:78238289-78238311 GACTCACAGTTCCACGTGGCTGG - Intergenic
1070714765 10:78711353-78711375 GACTCACAGTTCCACATGACTGG - Intergenic
1070922305 10:80195724-80195746 GACTCACAGTTCCACGTGGCTGG + Intronic
1071454555 10:85835566-85835588 GACTCACAGTTCCACATGACTGG - Intronic
1071637286 10:87268066-87268088 GACTCACAGTTGCACATGGCTGG - Intergenic
1071873298 10:89818038-89818060 GACCCACAGTTCCACGTGGCTGG + Intergenic
1072646017 10:97254900-97254922 TCCACACAGTAGCATGTGACAGG - Intronic
1072647248 10:97266660-97266682 GACTCACAGTTCCACATGACTGG + Intronic
1073311949 10:102549259-102549281 GACTCACAGTTCCACATGACTGG + Intronic
1073817410 10:107223281-107223303 GACTCACAGTTCCACGTGGCTGG + Intergenic
1073967186 10:109004140-109004162 GACTCACAGTTCCACGTGGCTGG + Intergenic
1074069017 10:110048233-110048255 GACTCACAGTTCCACGTGGCTGG - Intronic
1074069351 10:110050473-110050495 GACTCACAGTTCCACGTGGCTGG - Intronic
1074134270 10:110613372-110613394 GACTCACAGTTCCACATGACTGG + Intergenic
1074291192 10:112139113-112139135 GACTCACAGTTCCACGTGGCTGG - Intergenic
1074578831 10:114696724-114696746 GACTCACAGTTCCATGTGACTGG - Intergenic
1075079482 10:119373545-119373567 GACTCACAGTTCCACGTGACTGG - Intronic
1075114490 10:119614408-119614430 GACTCACAGTTCCACGTGGCTGG - Intergenic
1075530397 10:123224423-123224445 GACTCACAGTTCCACGTGGCTGG + Intergenic
1075620464 10:123923899-123923921 GACTCACAGTTCCACGTGGCTGG - Intronic
1075826266 10:125359313-125359335 GACTTACAGTTCCACGTGACTGG + Intergenic
1076086897 10:127640227-127640249 GACTCACAGTTCCACGTGGCTGG - Intergenic
1076200327 10:128552635-128552657 GACTCACAGTTCCACGTGTCTGG - Intergenic
1076276463 10:129203442-129203464 GACCCACAGTTGCACACGGCTGG - Intergenic
1076856592 10:133118433-133118455 GACTCACAGTTCCACATGACTGG + Intronic
1078452962 11:11453806-11453828 GACTCACAGTTCCACATGACTGG - Intronic
1078515121 11:12015246-12015268 GACTCACAGTTCCACATGACTGG - Intergenic
1078826227 11:14933202-14933224 GACTCACAGTTGCATGTGGCTGG + Intronic
1079405483 11:20141561-20141583 GACTCACAGTTCCACGTGGCTGG - Intergenic
1079552308 11:21715119-21715141 GACCTACAGTTCCACATGACTGG + Intergenic
1079567780 11:21904051-21904073 GACTCACAGTTTCACATGACTGG + Intergenic
1079991987 11:27255880-27255902 GACTTACAGTTCCACGTGACTGG - Intergenic
1080151670 11:29058305-29058327 GACTCACAGTTCCACATGACTGG - Intergenic
1080243526 11:30154385-30154407 GGCCCACAGTTCCACATGGCTGG + Intergenic
1080704564 11:34678193-34678215 GACTCACAGTTCCATGTGACCGG - Intergenic
1080903034 11:36513667-36513689 GACTCACAGTTCCACATGACTGG + Intronic
1081050035 11:38327340-38327362 GACTCACAGTTCCACGTGGCTGG - Intergenic
1081303315 11:41479888-41479910 GACTCACAGTTCCACGTGACTGG - Intergenic
1081315400 11:41624519-41624541 GACTCACAGTTCCACGTGGCTGG + Intergenic
1081386515 11:42479214-42479236 GACTCACAGTTCCACATGACTGG - Intergenic
1081420238 11:42867283-42867305 GACCCACAGTTCCACATGTCTGG - Intergenic
1081442265 11:43093411-43093433 GACTCACAGTTTCACGTGGCTGG - Intergenic
1081691545 11:45081593-45081615 GACTCACAGTTCCACATGACTGG + Intergenic
1082203225 11:49398974-49398996 GACTCACAGCTGCACGTGGCTGG - Intergenic
1082865755 11:57898727-57898749 GACTCACAGTTCCACGTGGCTGG - Intergenic
1082894005 11:58170795-58170817 GACACACAGTTCCACGTGGCTGG - Intronic
1082906486 11:58312808-58312830 GACTCACAGTTGCACATGGCTGG + Intergenic
1083107114 11:60368802-60368824 GACCCATAGTTCCACGTGGCTGG - Intronic
1084440797 11:69171913-69171935 GACTTACAGTTGCACGTGGCTGG + Intergenic
1085681647 11:78580932-78580954 GACTCACAGTTCCACGTGGCTGG + Intergenic
1086419052 11:86619688-86619710 GACTCACAGTTCCACGTGGCTGG - Intronic
1086503542 11:87478617-87478639 GGCTCACAGTTTCACATGACTGG - Intergenic
1086552046 11:88063828-88063850 GACTCACAGTTCCACGTGGCTGG - Intergenic
1086609619 11:88739771-88739793 GACCCACAGTTCCACATGGCTGG - Intronic
1086651813 11:89301105-89301127 GACTCACAGCTGCACGTGGCTGG + Intergenic
1087024591 11:93637038-93637060 GACTCACAGTTCCACGTGGCTGG - Intergenic
1087603598 11:100346848-100346870 GACTCACAGTTCCACGTGGCTGG + Intronic
1087838447 11:102897915-102897937 GACCCACAGTTCCACATGGCTGG - Intergenic
1088033716 11:105285450-105285472 GACTCACAGTTCCACGTGGCTGG + Intergenic
1088088326 11:106007435-106007457 GACTCACAGTTCCACGTGGCTGG + Intronic
1088141357 11:106620758-106620780 GACTCACAGTTCCACGTGGCTGG - Intergenic
1088219954 11:107559184-107559206 AACCCACAGTTCCACGTGGCCGG - Intronic
1088377497 11:109158775-109158797 GCCTTACAGTTCCACGTGGCTGG + Intergenic
1089044272 11:115485698-115485720 GACTCACAGTTCCATGTGACTGG - Intronic
1089154439 11:116390153-116390175 GACTCACAGTTCCACATGACAGG + Intergenic
1089161343 11:116439901-116439923 GACTCACAGTTCCACGTGGCTGG + Intergenic
1089578368 11:119462847-119462869 GACTCACAGTTCCACGTGGCTGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1089878338 11:121747426-121747448 GACTCACAGTTTCACGTGGCTGG - Intergenic
1090392157 11:126395774-126395796 GACTCACAGTTCCACGTGGCTGG - Intronic
1090504428 11:127296550-127296572 GACTCACAGTTCCACATGACTGG - Intergenic
1090521860 11:127488507-127488529 GACCCACAGTTCCACATGGCTGG + Intergenic
1090583526 11:128185337-128185359 GACTCACAGTTCCACGTGGCTGG - Intergenic
1090618620 11:128541054-128541076 CACCCTCAGTTTCACGTGACTGG + Intronic
1091001726 11:131915676-131915698 GACTCACAGTTCCACGTGGCTGG + Intronic
1091350597 11:134891050-134891072 GACTCACAGTTCCACGTGGCTGG - Intergenic
1092437283 12:8460265-8460287 GACTCACAGTTCCACGTGGCTGG + Intronic
1092625932 12:10328807-10328829 GACTCACAGTTCCACGTGGCTGG + Intergenic
1093277823 12:17151724-17151746 GACTCACAGTTGCACATGGCTGG + Intergenic
1093337036 12:17918865-17918887 GACTCACAGTTCCACGTGGCTGG + Intergenic
1093689180 12:22090227-22090249 GACTCACAGTTCCACATGACTGG - Intronic
1093692818 12:22126371-22126393 GACTCACAGTTTCACGTGGCTGG - Intronic
1093916178 12:24804832-24804854 GACTCACAGTTCCACATGACTGG + Intergenic
1094575767 12:31683705-31683727 GACTCACAGTTCCACGTGGCTGG - Intronic
1095188616 12:39230570-39230592 GACTCACAGTTCCACGTGGCTGG + Intergenic
1095315284 12:40753450-40753472 GACTCACAGTTCCACGTGGCTGG + Intronic
1095367238 12:41422496-41422518 GACTCACAGTTCCACATGACTGG + Intronic
1095633226 12:44402050-44402072 GACTCACAGTTCCACGTGGCTGG + Intergenic
1095795152 12:46210802-46210824 GACTCACAGTTCCACGTGGCTGG - Intronic
1096905079 12:54927647-54927669 GACCCACAGTTGCACGTGGCTGG - Intergenic
1096960087 12:55569042-55569064 GACTCACAGTTCCACGTGGCTGG + Intergenic
1096969069 12:55651013-55651035 GACTCACAGTTCCACGTGGCTGG - Intergenic
1098140203 12:67443212-67443234 GACCCACAGTTCCACATGGCTGG - Intergenic
1098317390 12:69207105-69207127 GGCCCACAGTTCCACATGGCTGG + Intergenic
1098607116 12:72404516-72404538 GACTCACAGTTTCACATGACTGG + Intronic
1098672526 12:73248996-73249018 GACTCACAGTTCCACGTGACTGG + Intergenic
1098792239 12:74837955-74837977 GACTCACAGTTCCACGTGGCTGG - Intergenic
1098976150 12:76904057-76904079 GGCTCACAGTTCCACGTGGCTGG - Intergenic
1099057778 12:77867335-77867357 GACTCACAGTTCCACGTGGCTGG - Intronic
1099379807 12:81939804-81939826 CCCTTACAGTTACACGTGACAGG + Intergenic
1099390268 12:82070808-82070830 GATTCACAGTTTCACGTGACTGG + Intergenic
1099594014 12:84634614-84634636 GACTCACAGTTCCACGTGGCTGG + Intergenic
1099646605 12:85365928-85365950 GACTCACAGTTCCACATGACTGG - Intergenic
1099671961 12:85705876-85705898 GACTCACAGTTCCACGTGGCTGG - Intergenic
1099791425 12:87339822-87339844 GACCCACAGTTCCACGTGGCTGG + Intergenic
1100047126 12:90396108-90396130 GACTCACAGTTCCACGTGTCTGG - Intergenic
1100597731 12:96086269-96086291 GACTCACAGTTGCACATGGCTGG - Intergenic
1100602957 12:96128116-96128138 GACTCACAGTTCCACGTGGCTGG + Intergenic
1100733725 12:97502739-97502761 GCCCCACAGTGGCTCATGCCTGG - Intergenic
1101005692 12:100398971-100398993 GACTCACAGTTCCACGTGGCGGG - Intronic
1101084540 12:101222357-101222379 GGCTCACAGTTCCACGTGGCTGG - Intergenic
1101117583 12:101547527-101547549 GACTCACAGTTCCACATGACTGG + Intergenic
1101230100 12:102732004-102732026 GACTCACAGTTCCACGTGGCTGG - Intergenic
1101264706 12:103071735-103071757 GACTCACAGTTCCACTTGACTGG - Intergenic
1101396535 12:104353734-104353756 GACTCACAGTTCCACGTGGCGGG + Intergenic
1101535571 12:105613227-105613249 GACTCACAGTTCCACGTGGCTGG - Intergenic
1101676694 12:106923700-106923722 GACTCACAGTTCCACATGACTGG + Intergenic
1101684867 12:107008937-107008959 GACTCACAGTTTCACGTGACTGG - Intronic
1101763333 12:107677077-107677099 GACTCACAGTTCCACGTGGCTGG + Intergenic
1101861424 12:108485458-108485480 GACTCACAGTTCCACGTGGCTGG - Intergenic
1102395358 12:112581202-112581224 GACTCACAGTTCCACATGACTGG + Intronic
1102553944 12:113713565-113713587 GACCCACAGTTCCACATGGCTGG + Intergenic
1102596964 12:114000335-114000357 GACTCACAGTTCCACGTGTCTGG + Intergenic
1102748468 12:115271270-115271292 GACTCACAGTTCCACGTGGCTGG + Intergenic
1102825576 12:115945414-115945436 GACTCACAGTTCCACGTGGCTGG - Intergenic
1103008931 12:117442949-117442971 GACTCACAGTTCCACGTGGCTGG + Intronic
1103466935 12:121149398-121149420 GGCCCACAGTTCCACATGGCTGG + Intronic
1103686527 12:122736363-122736385 GGCTCACAGTTCCACGTGGCTGG - Intergenic
1103881471 12:124169320-124169342 GACTCACAGTTCCACATGACTGG - Intronic
1103914280 12:124368496-124368518 GCCCCACGGGTGGAAGTGACGGG - Intronic
1104114506 12:125736388-125736410 GACTCACAGTTCCATGTGACTGG + Intergenic
1104140054 12:125979309-125979331 GACTCACAGTTCCACGTGGCTGG + Intergenic
1104171952 12:126290981-126291003 GCCTCACAGTTCCACCTGGCTGG + Intergenic
1104476121 12:129072015-129072037 GCACCACAGTTGCAGGGGAGAGG + Exonic
1104487290 12:129162648-129162670 GCCACACAGTTTCAAATGACTGG - Intronic
1104525422 12:129516413-129516435 GACTCACAGTTCCACGTGGCTGG + Intronic
1104532916 12:129589346-129589368 GACCCACAGTTCCACGTGACTGG - Intronic
1104808176 12:131602903-131602925 GACTCACAGTTCCACGTGGCTGG + Intergenic
1105405657 13:20130378-20130400 GACTCACAGTTCCACGTGGCTGG + Intergenic
1106120865 13:26859344-26859366 GGCTCACAGTTCCACGTGGCCGG + Intergenic
1106311860 13:28561622-28561644 GACTCACAGTTCCACGTGGCCGG - Intergenic
1106369931 13:29122334-29122356 GACTCACAGTTCCACGTGGCTGG + Intronic
1106631684 13:31480650-31480672 GACTCACAGTTCCACGTGGCTGG + Intergenic
1106929986 13:34653207-34653229 GACTCACAGTTCCACGTGACTGG - Intergenic
1107964058 13:45583812-45583834 GACTCACAGTTCCACGTGGCTGG - Intronic
1108099896 13:46943925-46943947 GACTCACAGTTCCACATGACTGG + Intergenic
1108142393 13:47437390-47437412 GACTCACAGTTCCACGTGGCTGG - Intergenic
1108701008 13:52944307-52944329 GACTCACAGTTCCACGTGGCTGG + Intergenic
1108705738 13:52984304-52984326 GACTCACAGTTCCACATGACTGG + Intergenic
1108788949 13:53943085-53943107 GACCCACAGTTCCACGTGGCTGG + Intergenic
1108851009 13:54728842-54728864 GACCCACAGTTCCACGTGGCTGG - Intergenic
1108902954 13:55435588-55435610 GACTCACAGTTTCACGTGGCTGG - Intergenic
1108944494 13:56003885-56003907 GACACACAGTTCCACGTGGCTGG + Intergenic
1109369056 13:61397519-61397541 GACTCACAGTTCCACGTGGCTGG - Intergenic
1109416998 13:62052693-62052715 GACTCACAGTTCCACGTGGCTGG - Intergenic
1109614313 13:64809913-64809935 GACTCACAGTTCCACGTGGCTGG - Intergenic
1109679491 13:65731203-65731225 GTCTCACAGTTCCACGTGGCTGG - Intergenic
1109737428 13:66505275-66505297 GACTCACAGTTCCACATGACTGG + Intronic
1109811343 13:67516948-67516970 GACTCACAGTTCCACGTGGCTGG + Intergenic
1109955335 13:69558093-69558115 GACTCACAGTTCCACATGACTGG - Intergenic
1110044914 13:70814960-70814982 GACTCACAGTTCCACATGACTGG - Intergenic
1110056794 13:70984538-70984560 GACTCACAGTTCCACGTGGCTGG + Intergenic
1110161658 13:72385772-72385794 GACTCACAGTTCCACGTGGCTGG + Intergenic
1110370110 13:74730184-74730206 GACTCACAGTTCCACGTGGCTGG + Intergenic
1110396071 13:75030348-75030370 GACTTACAGTTCCACGTGACTGG - Intergenic
1110420787 13:75305212-75305234 GACTCACAGTTCCACGTGTCTGG - Intronic
1110695645 13:78484929-78484951 GACTCACAGTTCCACATGACTGG - Intergenic
1110732526 13:78895724-78895746 GCCTCACAGTTCCACATGGCTGG + Intergenic
1110832947 13:80052926-80052948 GACCCACAGTTCCACATGGCTGG + Intergenic
1110914750 13:81008112-81008134 GACTCACAGTTCCACCTGACTGG - Intergenic
1111072442 13:83186876-83186898 GACTTACAGTTCCACGTGACTGG - Intergenic
1111271369 13:85891684-85891706 GACTCACAGTTCCACATGACTGG - Intergenic
1111411248 13:87880145-87880167 GACCCACAGTTCCACATGGCTGG + Intergenic
1111435128 13:88196591-88196613 GACTCACAGTTTCACATGACTGG - Intergenic
1111440574 13:88279045-88279067 GACTCACAGTTCCACGTGGCTGG + Intergenic
1111475695 13:88743844-88743866 GACTCACAGTTCCATGTGACTGG - Intergenic
1111477584 13:88773117-88773139 GACTCACAGTTCCACGTGGCTGG + Intergenic
1111635531 13:90898522-90898544 GACTCACAGTTGCACATGACTGG - Intergenic
1111649496 13:91071727-91071749 GACTCACAGTTCCACATGACTGG - Intergenic
1111751941 13:92344134-92344156 GACTCACAGTTCCACATGACTGG + Intronic
1111816749 13:93163450-93163472 GACTCACAGTTCCACGTGGCTGG + Intergenic
1111911902 13:94322284-94322306 GACTCACAGTTCCACGTGACTGG - Intronic
1111929619 13:94500270-94500292 GACTCACAGTTCCACGTGGCTGG + Intergenic
1112031977 13:95465074-95465096 GACTCACAGTTCTACGTGACTGG + Intronic
1112190423 13:97171979-97172001 GACTCACAGTTCCACGTGGCTGG - Intergenic
1112238432 13:97657396-97657418 GACTCACAGTTCCACATGACTGG + Intergenic
1112281817 13:98069383-98069405 GACTCACAGTTCCACGTGGCTGG - Intergenic
1112637296 13:101228627-101228649 GACTCACAGTTCCACGTGGCTGG - Intronic
1112722178 13:102257998-102258020 GACTCACAGTTCCACGTGGCTGG + Intronic
1112739072 13:102453703-102453725 GAATCACAGTTCCACGTGACTGG - Intergenic
1112797869 13:103077034-103077056 GAACCACAGTTGCACATGGCTGG + Intergenic
1112857362 13:103787681-103787703 GACTCACAGTTCCACGTGGCTGG + Intergenic
1112982209 13:105399405-105399427 GACTCACAGTTCCACGTGGCTGG + Intergenic
1113003122 13:105666698-105666720 GACTCACAGTTCCACGTGGCTGG + Intergenic
1113005304 13:105695019-105695041 GACGCACAGTTCCACGTGGCTGG - Intergenic
1113035049 13:106039056-106039078 GACTCACAGTTCCACATGACTGG + Intergenic
1113096953 13:106676218-106676240 GACTCACAGTTCCACGTGGCTGG + Intergenic
1113156795 13:107332524-107332546 GCCCCACAGCTGCTCCTGAGGGG - Intronic
1113173024 13:107527834-107527856 GACTCACAGTTCCACGTGGCTGG - Intronic
1113649236 13:112023741-112023763 GACTCACAGTTCCACGTGACTGG + Intergenic
1113915426 13:113868177-113868199 GACTCACAGTTCCACGTGGCTGG - Intergenic
1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG + Intronic
1115132575 14:30071895-30071917 GACTCACAGTTCCACGTGGCAGG - Intronic
1115525672 14:34278374-34278396 GACTCACAGTTCCACGTGGCTGG - Intronic
1115577748 14:34727519-34727541 GACTCACAGTTCCACATGACTGG + Intergenic
1115817522 14:37178871-37178893 GACTCACAGTTCCACGTGGCTGG + Intergenic
1115989798 14:39140384-39140406 GACTTACAGTTCCACGTGACTGG + Intergenic
1116095181 14:40358767-40358789 GACTCACAGTTCCACGTGGCTGG - Intergenic
1116272310 14:42787149-42787171 GACTCACAGTTCCACATGACTGG - Intergenic
1116356555 14:43937868-43937890 GACTCACAGTTCCACATGACAGG + Intergenic
1116865838 14:50030944-50030966 GACTCACAGTTCCACGTGGCTGG + Intergenic
1116969577 14:51050454-51050476 GACTCACAGTTCCACGTGGCTGG - Intronic
1117106989 14:52407806-52407828 GACTCACAGTTCCACGTGGCTGG - Intergenic
1117173787 14:53128161-53128183 GACTCACAGTTCCACGTGGCTGG - Intronic
1117229091 14:53696986-53697008 GCCTCACAGTTTCACATGGCTGG + Intergenic
1118119822 14:62828445-62828467 GATTCACAGTTGCACATGACTGG + Intronic
1118481072 14:66166318-66166340 GACTCACAGTTCCACGTGGCCGG - Intergenic
1118538177 14:66791896-66791918 GACTCACAGTTCCACGTGGCTGG + Intronic
1119402799 14:74375637-74375659 GACTCACAGTTCCACGTGGCTGG + Intergenic
1119862524 14:77946838-77946860 GACTCACAGTTCCACGTGGCTGG - Intergenic
1120133233 14:80832175-80832197 GACTCACAGTTCCACGTGGCTGG - Intronic
1120159202 14:81127836-81127858 GACTCACAGTTCCACGTGGCTGG - Intronic
1120244836 14:81994625-81994647 GACTCACAGTTCCACGTGGCTGG + Intergenic
1120476740 14:84998176-84998198 GACTCACAGTTCCACGTGGCTGG - Intergenic
1120654029 14:87168444-87168466 GACTCACAGTTACACGTGGCTGG + Intergenic
1120724432 14:87922058-87922080 GACTCACAGTTCCACGTGGCTGG - Intronic
1120739468 14:88091637-88091659 GACTCACAGTTCCACGTGGCTGG - Intergenic
1120843516 14:89107108-89107130 GACTCACAGTTCCACGTGGCTGG - Intergenic
1120863795 14:89278148-89278170 GACTCACAGTTCCACGTGGCTGG + Intronic
1120914403 14:89697880-89697902 GGCTCACAGTTCCACATGACTGG - Intergenic
1120947721 14:90013536-90013558 GGCTCACAGTTGCACATGGCGGG - Intronic
1121063303 14:90937620-90937642 GGCTCACAGTTCCACGTGGCTGG + Intronic
1121166397 14:91806166-91806188 GACTCACAGTTCCACGTGGCTGG - Intronic
1121467128 14:94123127-94123149 GACTCACAGTTGCACATGGCTGG - Intergenic
1121513023 14:94527070-94527092 GACTCACAGTTCCACGTGCCTGG - Intergenic
1121678176 14:95771327-95771349 GACTCACAGTTCCACGTGGCTGG - Intergenic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1121963429 14:98282498-98282520 GACTCACAGTTGCACATGGCTGG + Intergenic
1121969859 14:98346044-98346066 GACTTACAGTTCCACGTGACCGG + Intergenic
1122203576 14:100137192-100137214 GCCCCTCAGTAGCAGGTGCCGGG + Intronic
1122352821 14:101106266-101106288 GACTCACAGTTCCACGTGGCTGG - Intergenic
1123844041 15:24279371-24279393 GGCTCACAGTTGCACATGGCTGG + Intergenic
1123859121 15:24445656-24445678 GGCTCACAGTTGCACATGGCTGG + Intergenic
1124393698 15:29282357-29282379 GACTCACAGTTTCACGTGGCTGG - Intronic
1124550006 15:30671734-30671756 GACTCACAGTTCCACGTGGCTGG + Intronic
1124966961 15:34439987-34440009 GACTCACAGTTCCACGTGGCTGG + Intergenic
1125223421 15:37367194-37367216 GACTCACAGTTCCACATGACTGG + Intergenic
1126933224 15:53677694-53677716 GACTCACAGTTCCACGTGTCTGG - Intronic
1127318722 15:57821431-57821453 GACTCACAGTTCCACATGACTGG + Intergenic
1127733962 15:61824805-61824827 GACTCACAGTTCCACGTGGCTGG + Intergenic
1128355977 15:66926879-66926901 GACTCACAGTTCCACGTGGCTGG - Intergenic
1128409459 15:67379799-67379821 GACTCACAGTTCCACATGACTGG - Intronic
1128482329 15:68050104-68050126 GACTCACAGTTCCACATGACTGG + Intergenic
1128749023 15:70135252-70135274 GACTCACAGTTCCACGTGGCTGG + Intergenic
1130098884 15:80876960-80876982 GACTCACAGTTCCACATGACTGG + Intronic
1130524269 15:84690344-84690366 GACTTACAGTTCCACGTGACTGG - Intronic
1130658193 15:85807980-85808002 GACTCACAGTTCCACATGACTGG - Intergenic
1130711450 15:86285589-86285611 GACTCACAGTTCCACGTGGCTGG - Intronic
1130900128 15:88200687-88200709 GACCCACAGTTCCACATGGCTGG - Intronic
1130917215 15:88314603-88314625 GACTCACAGTTCCACGTGGCTGG + Intergenic
1131272301 15:90954831-90954853 GCTCGACAGAGGCACGTGACGGG + Intergenic
1131410569 15:92204095-92204117 GACTCACAGTTCCACGTGGCTGG - Intergenic
1131525370 15:93148285-93148307 GACTCATAGTTCCACGTGACTGG + Intergenic
1131575185 15:93582312-93582334 GACTCACAGTTCCACGTGGCTGG - Intergenic
1131619758 15:94055092-94055114 GACTCACAGTTCCACATGACTGG - Intergenic
1131649509 15:94383518-94383540 GACTCACAGTTCCACGTGGCTGG + Intronic
1131897476 15:97049252-97049274 GACTCACAGTTCCACGTGGCTGG - Intergenic
1132081707 15:98871589-98871611 GACTCACAGTTTCATGTGACTGG + Intronic
1132209594 15:100010167-100010189 GACTCGCAGTTGCACGTGGCAGG - Intronic
1132230762 15:100182156-100182178 GACTCACAGTTGCACATGGCTGG + Intronic
1133438283 16:5799073-5799095 GACTCACAGTTGCACATGGCTGG + Intergenic
1133486204 16:6221658-6221680 GACTCACAGTTCCACGTGGCTGG + Intronic
1133533313 16:6675623-6675645 GACTCACAGTTCCATGTGACTGG + Intronic
1133547341 16:6820211-6820233 GACTCACAGTTGCACATGGCTGG - Intronic
1133580231 16:7137537-7137559 GACTCACAGTTCCACGTGGCTGG - Intronic
1133728851 16:8560899-8560921 GACTCACAGTTCCACGTGGCTGG + Intergenic
1133838298 16:9385976-9385998 GACTCACAGTTCCACGTCACTGG + Intergenic
1133926323 16:10195814-10195836 GACTCACAGTTCCACGTGGCTGG + Intergenic
1133928801 16:10215553-10215575 CCCCCTCAGTCGCACGGGACTGG + Intergenic
1134276042 16:12776967-12776989 GCCTCACAGTTCCACGTGGCTGG - Intronic
1134326752 16:13214653-13214675 GACTCACAGTTCCACGTGGCTGG + Intronic
1134330539 16:13247037-13247059 GACTCACAGTTCCACGTGGCTGG + Intergenic
1134340162 16:13337424-13337446 GACTCACAGTTCCACGTGGCTGG - Intergenic
1134380692 16:13722087-13722109 GACTCACAGTTCCACGTGACTGG - Intergenic
1134606171 16:15572993-15573015 GACTCACAGTTCCACGTGGCTGG - Intronic
1134853093 16:17498020-17498042 GCTCCTGAGTAGCACGTGACAGG - Intergenic
1134869394 16:17638218-17638240 GACTCACAGTTCCACGTGGCTGG + Intergenic
1135386288 16:22043914-22043936 GACTCACAGTTCCACGTGACTGG + Intronic
1135919159 16:26632798-26632820 GACTCACAGTTCCACGTGGCTGG + Intergenic
1135951553 16:26918982-26919004 GACTCACAGTTCCACGTGGCTGG - Intergenic
1135964876 16:27027560-27027582 GACTCACAGTTCCACGTGGCTGG - Intergenic
1135966367 16:27039099-27039121 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1136294089 16:29291912-29291934 GGCCCAAAGTCGCACATGACGGG + Intergenic
1136769909 16:32827612-32827634 GACGCACAGTTCCACATGACTGG - Intergenic
1137340360 16:47596234-47596256 GCCTCACAGTTCCACATGGCTGG - Intronic
1137392816 16:48095338-48095360 GACTCACAGTTCCACGTGGCTGG - Intronic
1137399767 16:48143788-48143810 GACTCACAGTTCCATGTGACTGG - Intronic
1137409828 16:48218799-48218821 GACTCACAGTTCCACGTGGCTGG - Intronic
1137686831 16:50392228-50392250 GACTCACAGTTCCACGTGGCTGG + Intergenic
1137775990 16:51054750-51054772 GACTCACAGTTCCACGTGGCTGG + Intergenic
1137961214 16:52884082-52884104 GACTCACAGTTCCACGTGGCTGG + Intergenic
1138220681 16:55247867-55247889 GACTCACAGTTCCACATGACTGG + Intergenic
1138908991 16:61373834-61373856 GACCTACAGTTCCACGTGGCTGG - Intergenic
1139021562 16:62756189-62756211 GACTCACAGTTCCACGTGGCTGG - Intergenic
1139139190 16:64240328-64240350 GACTCACAGTTCCACGTGGCTGG - Intergenic
1139171713 16:64638224-64638246 GACTCACAGTTCCACGTGGCTGG - Intergenic
1139299532 16:65933598-65933620 GACTCACAGTTCCACGTGGCTGG - Intergenic
1140154001 16:72403300-72403322 GACTCACAGTTCCACGTGGCTGG + Intergenic
1140278216 16:73530089-73530111 GTCTCACAGTTCCACGTGGCTGG + Intergenic
1140323942 16:73981840-73981862 GACTTACAGTTCCACGTGACTGG + Intergenic
1140763142 16:78130130-78130152 GACTCACAGTTCCACGTGGCTGG - Intronic
1141133587 16:81451370-81451392 GACTCACAGTTCCACGTGGCTGG - Intronic
1141214089 16:82008187-82008209 GACTCACAGTTCCACGTGGCTGG - Intronic
1141314682 16:82950612-82950634 GACTCACAGTTACACGTGGCTGG - Intronic
1141466455 16:84208924-84208946 GACTCACAGTTTCACGTGGCTGG - Intergenic
1141909553 16:87049357-87049379 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1141909560 16:87049393-87049415 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1141909567 16:87049429-87049451 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1141909574 16:87049465-87049487 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1142044394 16:87915946-87915968 GACTCACAGTTCCACGTGGCTGG + Intronic
1142099992 16:88265958-88265980 GGCCCAAATTTGCACATGACGGG + Intergenic
1143715120 17:8762130-8762152 GACCCACAGTTCCACATGCCTGG + Intergenic
1143832737 17:9665351-9665373 GACTCACAGTTCCACATGACTGG + Intronic
1143931851 17:10437557-10437579 GACTCACAGTTCCACGTGGCTGG - Intergenic
1143980766 17:10867599-10867621 GACTCACAGTTGCACATGGCTGG - Intergenic
1144187384 17:12809379-12809401 GACTCACAGTTCCACATGACTGG + Intronic
1145831064 17:27916799-27916821 GACTCACAGTTTCACATGACTGG + Intergenic
1146098518 17:29955507-29955529 GACTCACAGTTCCACGTGGCTGG - Intronic
1146516097 17:33490677-33490699 GACTCACAGTTCCACGTGGCTGG - Intronic
1146663900 17:34683855-34683877 GACCCACAGTTCCACGTGGCTGG + Intergenic
1147834170 17:43318162-43318184 GACTCACAGTTCCACGTGGCTGG + Intergenic
1148244313 17:46020587-46020609 GACTCACAGTTCCACGTGACTGG + Intronic
1149210487 17:54294740-54294762 GACTCACAGTTCCACGTGGCTGG - Intergenic
1149222503 17:54431833-54431855 GCCTCACAGTTCCACATGGCTGG + Intergenic
1149284976 17:55152511-55152533 GACTCACAGTTCCACGTGGCTGG + Intronic
1149304828 17:55337717-55337739 GACTCACAGTTTCACGTGGCTGG + Intergenic
1149308973 17:55375945-55375967 GACTCACAGTTCCACGTGGCTGG + Intergenic
1149325131 17:55522427-55522449 GACTCACAGTTCCACGTGGCTGG + Intergenic
1149342131 17:55698157-55698179 GACTCACAGTTCCACGTGGCTGG + Intergenic
1149370065 17:55985164-55985186 GACTCACAGTTGCGCGTGGCTGG + Intergenic
1149370804 17:55992083-55992105 GACTCACAGTTTCACATGACTGG + Intergenic
1149518573 17:57300680-57300702 GACTCACAGTTCCACGTGGCTGG + Intronic
1149992950 17:61392912-61392934 GCCCCCAAGTTGCACATGAAAGG - Intergenic
1150159911 17:62887940-62887962 GACTCACAGTTCCACGTGGCTGG - Intergenic
1150329868 17:64286093-64286115 GACTCACAGTTCCACGTGGCTGG - Intergenic
1150622096 17:66815274-66815296 GACTCACAGTTCCACGTGGCTGG + Intergenic
1150649765 17:67002123-67002145 GACTCACAGTTCCACGTGGCTGG + Intronic
1150928905 17:69563455-69563477 GACTCACAGTTCCACGTGGCTGG - Intergenic
1150978164 17:70111867-70111889 GGCTCACAGTTCCACGTGGCTGG - Intronic
1151092931 17:71463136-71463158 GACTCACAGTTCCACGTGGCTGG - Intergenic
1151119290 17:71774079-71774101 GACTCACAGTTCCACATGACTGG - Intergenic
1151152240 17:72098137-72098159 GACTCACAGTTCCATGTGACTGG + Intergenic
1151211500 17:72547875-72547897 GACTCACAGTTCCACGTGGCTGG + Intergenic
1151515291 17:74590275-74590297 GACTCACAGTTCCACATGACTGG - Intronic
1151981671 17:77514813-77514835 GACTCACAGTTCCACGTGGCTGG + Intergenic
1152160718 17:78666988-78667010 GACTCACAGTTCCACGTGGCTGG + Intergenic
1203168489 17_GL000205v2_random:122405-122427 GCCTCACAGTTTCACATGGCTGG - Intergenic
1153076142 18:1164332-1164354 GACTCACAGTTCCACGTGGCTGG + Intergenic
1153124577 18:1775684-1775706 GACTCACAGTTCCACGTGGCTGG + Intergenic
1153272166 18:3333587-3333609 GACTCACAGTTCCACGTGGCTGG + Intergenic
1153376144 18:4381866-4381888 GACTCACAGTTCCACGTGGCTGG + Intronic
1153774484 18:8440670-8440692 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1154059918 18:11049799-11049821 GACTCACAGTTCCACGTGGCTGG - Intronic
1154509058 18:15075542-15075564 GACTTACAGTTCCACGTGACTGG - Intergenic
1155617345 18:27737598-27737620 GACCCACAGTTCCACATGGCTGG + Intergenic
1155663465 18:28278985-28279007 GCCTCATAGTTTCACTTGACTGG - Intergenic
1155722781 18:29039564-29039586 GACTCACAGTTCCACATGACTGG + Intergenic
1155968168 18:32055443-32055465 GACTCACAGTTGCACATGGCTGG + Intronic
1156051798 18:32944936-32944958 AACTCACAGTTGCACGTGGCTGG - Intronic
1156266033 18:35489325-35489347 GACTCACAGTTCCACGTGGCTGG + Exonic
1156507324 18:37606178-37606200 GACTCACAGTTCCACGTGGCTGG - Intergenic
1156593272 18:38516600-38516622 GACTTACAGTTCCACGTGACTGG + Intergenic
1156741774 18:40339486-40339508 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1156749670 18:40436288-40436310 GCCTCACAGTTCCACGTGGCTGG - Intergenic
1156883990 18:42112994-42113016 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1157142709 18:45126626-45126648 GACTCACAGTTCCACGTGGCTGG - Intergenic
1158108869 18:53917496-53917518 GACTCACAGTTCCACGTGGCTGG - Intergenic
1158264161 18:55641328-55641350 GACTCACAGTTCCACGTGGCTGG + Intronic
1158272805 18:55734632-55734654 GACTCACAGTTCCACGTGGCTGG - Intergenic
1158298632 18:56027790-56027812 GACTCACAGTTCCACGTGGCTGG + Intergenic
1158337815 18:56432955-56432977 GACTCACAGTTGCACTTGGCTGG + Intergenic
1158488721 18:57891201-57891223 GACTCACAGTTCCACGTGGCTGG - Intergenic
1158554900 18:58466885-58466907 GATTCACAGTTGCACGTGACTGG - Intergenic
1158732359 18:60038068-60038090 GACTCACAGTTCCACGTGGCTGG + Intergenic
1158855577 18:61540424-61540446 GACTCACAGTTCCACGTGGCTGG + Intronic
1159172254 18:64785943-64785965 GACTCACAGTTCCACATGACTGG - Intergenic
1159248468 18:65840715-65840737 GACTCACAGTTCCACGTGGCTGG - Intronic
1159333756 18:67036098-67036120 GACTCACAGTTTCACATGACTGG - Intergenic
1159424664 18:68269670-68269692 GACTCACAGTTCCACGTGGCTGG - Intergenic
1159439197 18:68455810-68455832 GACCCACAGTTACACTTGGCTGG - Intergenic
1159618012 18:70604072-70604094 GACTCACAGTTCCACGTGGCTGG + Intergenic
1159636023 18:70805952-70805974 GACTCACAGTTCCACTTGACTGG - Intergenic
1159643659 18:70892089-70892111 GACTCACAGTTCCACGTGGCTGG - Intergenic
1159705311 18:71678947-71678969 GACTCACAGTTCCACGTGGCTGG - Intergenic
1159718491 18:71855642-71855664 GCCTCACAGTTCCACATGGCAGG + Intergenic
1159746449 18:72242420-72242442 GACTCACAGTTCCACATGACTGG + Intergenic
1159751160 18:72303973-72303995 GACTCACAGTTCCACGTGGCTGG + Intergenic
1159751203 18:72304275-72304297 GACTCACAGTTCCACGTGTCTGG + Intergenic
1159888356 18:73931919-73931941 GACTCACAGTTCCACATGACTGG - Intergenic
1160010497 18:75104093-75104115 GCCTCACAGTTCCACGTGGCAGG + Intergenic
1160348726 18:78155685-78155707 GACTCATAGTTCCACGTGACTGG + Intergenic
1162246234 19:9403940-9403962 GACTCACAGTTCCACGTGGCTGG + Intergenic
1163076969 19:14902232-14902254 GACTCACAGTTCCACGTGGCTGG + Intergenic
1163375419 19:16927391-16927413 GACTCACAGTTTCACGTGGCTGG - Intronic
1163388388 19:17014540-17014562 GACTCACAGTTTCACGTGGCTGG + Intronic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1164506655 19:28866810-28866832 GCTCCATAGCTGCACCTGACTGG - Intergenic
1164530491 19:29044609-29044631 GACTCACAGTTCCACGTGGCTGG + Intergenic
1165410447 19:35657431-35657453 GCCCCACAGCTGGAAGTGAGTGG - Intronic
1166263733 19:41663204-41663226 GACTCACAGTTTCACGTGGCTGG + Intronic
1166967532 19:46538800-46538822 GACTCACAGTTCCACGTGGCTGG + Intronic
1166983277 19:46644435-46644457 GACTCACAGTTCCACGTGGCTGG - Intergenic
1167195826 19:48027516-48027538 GCCTCACAGTTCCACGTGGCTGG - Intergenic
1167563677 19:50242355-50242377 GACTCACAGTTCCACGTGGCTGG + Intronic
1168372635 19:55849000-55849022 GACCCACAGTTCCATGTGGCTGG - Intronic
1168641902 19:58036220-58036242 GCCCAACAGTTGAACGTGGTGGG - Intronic
924991467 2:316217-316239 GACTCACAGTTCCACGTGGCTGG - Intergenic
925036104 2:687021-687043 GACCCACAGTTCCACATGGCTGG - Intergenic
925151967 2:1621035-1621057 GACTCACAGTTCCACGTGGCTGG - Intergenic
925295400 2:2773161-2773183 GACTCACAGTTCCACGTGGCTGG + Intergenic
925450154 2:3962253-3962275 GACTCACAGTTCCACGTGGCTGG - Intergenic
925527374 2:4818062-4818084 GACTCACAGTTCCACATGACTGG + Intergenic
925536356 2:4922167-4922189 GACTCACAGTTCCACGTGGCTGG + Intergenic
925571876 2:5321164-5321186 GACTCACAGTTGCACGTGGCTGG - Intergenic
925807014 2:7660526-7660548 GACTCACAGTTTCACGTGGCTGG - Intergenic
926020668 2:9492254-9492276 TCCCCACAGATGCAAGTGAATGG + Intronic
926217390 2:10913893-10913915 GCTCCAGAGTTGCAAGTGACAGG + Exonic
926295333 2:11564829-11564851 GACCCACAGTTCCACGTGGCTGG + Intronic
926304148 2:11625869-11625891 GACTCACAGTTCCACGTGGCTGG + Intronic
926340970 2:11904059-11904081 GCCTCACAGTTCCACATGGCTGG - Intergenic
926626524 2:15095299-15095321 GACTCACAGTTCCACGTGCCTGG + Intergenic
926653433 2:15371256-15371278 GACTCACAGTTCCACATGACTGG - Intronic
926979231 2:18549464-18549486 GACTCACAGTTCCACGTGGCTGG - Intergenic
927255841 2:21040211-21040233 GACTCACAGTTCCACGTGGCTGG - Intronic
927376168 2:22417259-22417281 GTCTCACAGTTCCACGTGGCTGG + Intergenic
928324198 2:30306950-30306972 GACTCACAGTTCCACGTGGCTGG - Intronic
928332960 2:30371578-30371600 GACTCACAGTTTCACGTGGCTGG - Intergenic
928474746 2:31615066-31615088 GACTCACAGTTCCACGTGGCTGG - Intergenic
928609807 2:32981864-32981886 GACTCACAGTTCCACATGACTGG - Intronic
928771724 2:34709927-34709949 GACTCACAGTTCCACGTGGCTGG - Intergenic
928780908 2:34819403-34819425 GCCTTACAGTTCCACGTGACTGG + Intergenic
928866865 2:35927553-35927575 GACTCACAGTTTCACGTGGCTGG - Intergenic
929019717 2:37539409-37539431 GACTCACAGTTCCACATGACTGG - Intergenic
929070935 2:38029848-38029870 GACTCACAGTTCCACGTGGCTGG + Intronic
930440802 2:51403224-51403246 GACTCACAGTTCCACGTGGCTGG + Intergenic
930481208 2:51950960-51950982 GACTCACAGTTCCACATGACTGG + Intergenic
931130877 2:59334063-59334085 GACTCACAGTTCCACATGACTGG - Intergenic
931153996 2:59607247-59607269 GACTCACAGTTCCACGTGGCTGG - Intergenic
932711694 2:74070239-74070261 GACTCACAGTTCCACGTGGCTGG + Intronic
933051775 2:77610513-77610535 GACTCACAGTTCCACGTGGCTGG + Intergenic
933267984 2:80202905-80202927 GACTTACAGTTCCACGTGACCGG + Intronic
933271241 2:80235429-80235451 GCCCCACACTTGGCCTTGACTGG - Intronic
933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG + Intronic
934054866 2:88243081-88243103 GACCTACAGTTCCACGTGGCTGG - Intergenic
934081920 2:88475903-88475925 GACTCACAGTTCCACGTGGCTGG - Intergenic
935385339 2:102493378-102493400 GACTCACAGTTCCACATGACTGG + Intronic
935390263 2:102544051-102544073 GCCCCACAGTTCCTAGTGAGAGG + Intergenic
935425899 2:102918050-102918072 GACTCACAGTTCCACTTGACTGG + Intergenic
935497706 2:103802257-103802279 GACTCACAGTTCCACGTGGCTGG - Intergenic
936543750 2:113372971-113372993 GACTTACAGTTCCACGTGACCGG + Intergenic
936588532 2:113780599-113780621 GACTCACAGTTCCACGTGACTGG + Intergenic
937448914 2:121984183-121984205 GCCTTACAGTTCCACGTGACTGG - Intergenic
937702790 2:124882775-124882797 GACTCACAGTTCCACGTGGCTGG + Intronic
938515191 2:131997535-131997557 GCCTCACAGTTTCACATGGCTGG + Intergenic
939098377 2:137863673-137863695 GACTCACAGTTCCACGTGGCTGG - Intergenic
939187329 2:138876762-138876784 GACTCACAGTTCCACGTGGCTGG + Intergenic
940148349 2:150572156-150572178 GACTCACAGTTCCACGTGGCTGG + Intergenic
940361865 2:152804792-152804814 GGCACACAGTGGCACGGGACTGG - Intergenic
940485097 2:154288074-154288096 GACTCACAGTTCCACATGACTGG + Intronic
940499554 2:154477140-154477162 GACTCACAGTTCCACATGACTGG - Intergenic
940699394 2:157022776-157022798 GCCTCACAGTTCCACATGGCTGG - Intergenic
940727710 2:157353848-157353870 GGCTCACAGTTCCATGTGACTGG + Intergenic
940728305 2:157361030-157361052 GACTCACAGTTCCACGTGACTGG - Intergenic
940965625 2:159833937-159833959 GCCTCACAGTTCCACATGGCTGG - Intronic
941452112 2:165672342-165672364 GACTCACAGTTCCACGTGGCTGG + Intronic
941491090 2:166142969-166142991 GACTCACAGTTCCACATGACTGG - Intergenic
941509614 2:166389502-166389524 GACACACAGTTCCACGTGGCTGG + Intergenic
942395448 2:175542824-175542846 GACTCACAGTTCCACGTGGCTGG + Intergenic
942420117 2:175798377-175798399 GACTCACAGTTCCACATGACTGG - Intergenic
942684975 2:178521874-178521896 GACTCACAGTTCCACGTGGCTGG + Intergenic
942724614 2:178993310-178993332 TACTCACAGTTACACGTGACTGG + Intronic
942885376 2:180916892-180916914 GGCTCACAGTTCCACGTGGCTGG - Intergenic
943237918 2:185346786-185346808 GCATCACAGTTCCACGTGGCTGG - Intergenic
943462974 2:188192597-188192619 GACTCACAGTTTCACGTGGCTGG - Intergenic
943559872 2:189448112-189448134 GACTCACAGTTCCACGTGGCTGG - Intronic
943576817 2:189639825-189639847 GACTCACAGTTCCACGTGGCTGG + Intergenic
943622602 2:190167143-190167165 GACTTACAGTTGCATGTGACTGG + Intronic
944375676 2:199038975-199038997 GGCTCACAGTTCCACATGACTGG + Intergenic
944721743 2:202429685-202429707 GACTCACAGTTCCACATGACTGG + Intronic
944880318 2:204006776-204006798 GACTCACAGTTCCACGTGGCTGG + Intergenic
944957895 2:204833726-204833748 GACTCACAGTTCCACGTGGCTGG - Intronic
945059842 2:205899438-205899460 GACTCACAGTTCCACGTGCCTGG - Intergenic
945114221 2:206394845-206394867 GACTCACAGTTCCACGTGGCTGG - Intergenic
945149883 2:206779434-206779456 GACCAACAGTTCCACATGACTGG + Intronic
945337962 2:208615383-208615405 GACTCACAGTTCCACATGACTGG - Intronic
945480193 2:210336403-210336425 GACCTACAGTTCCACGTGGCTGG - Intergenic
945623573 2:212171781-212171803 GACCCACAGTTCCTCATGACTGG - Intronic
945739351 2:213641810-213641832 GCCTCACAGTTCCACATGGCTGG + Intronic
946169903 2:217888762-217888784 GACTCACAGTTCCACGTGGCTGG - Intronic
946600461 2:221354969-221354991 GACTCACAGTTCCACGTGGCTGG + Intergenic
946732092 2:222719869-222719891 GACTCACAGTTGCACATGGCTGG + Intergenic
946910670 2:224457514-224457536 GACTCACAGTTCCACGTGGCCGG + Intergenic
947248256 2:228074373-228074395 GACTCACAGTTCCACATGACTGG + Intronic
947296540 2:228636650-228636672 GACTCACAGTTACACGTGGCTGG + Intergenic
947825007 2:233099869-233099891 GACTCACAGTTCCACGTGGCTGG + Intronic
947903249 2:233740155-233740177 GACTCACAGTTCCACATGACTGG - Intronic
947934023 2:233987939-233987961 GACTCACAGTTCCACGTGGCTGG - Intronic
948062118 2:235049838-235049860 GTCCCACAGCTGGAAGTGACAGG - Intronic
948066107 2:235081574-235081596 GACTCACAGTTCCACGTGGCTGG - Intergenic
948111167 2:235456992-235457014 GACTCACAGTTCCACGTGGCTGG - Intergenic
948219946 2:236261751-236261773 GACTCACAGTTCCACGTGGCTGG + Intronic
948288800 2:236808750-236808772 GCCCCACAGATGTAGGTGTCAGG - Intergenic
948310697 2:236983732-236983754 GACTCACAGTTCCACGTGGCTGG - Intergenic
948647600 2:239416984-239417006 GACTCACAGTTGCATGTGGCTGG - Intergenic
1169043758 20:2519043-2519065 GACTCACAGTTGCACATGGCTGG - Intronic
1169162764 20:3396116-3396138 GACTCACAGTTCCACGTGGCTGG - Intronic
1169446114 20:5672364-5672386 GACCCACGGTTCCACATGACTGG + Intergenic
1169590877 20:7140893-7140915 GACTCACAGTTGCACATGGCTGG - Intergenic
1169985061 20:11435111-11435133 GACTCACAGTTCCACGTGGCTGG + Intergenic
1170018124 20:11806059-11806081 GACCCACAGTGCCACGTGGCTGG + Intergenic
1170049087 20:12121545-12121567 GACTCACAGTTGCACATGGCTGG - Intergenic
1170079156 20:12451756-12451778 GACCTACAGTTCCACGTGGCTGG - Intergenic
1170100236 20:12691155-12691177 GACTCACAGTTCCACGTGGCTGG + Intergenic
1170146003 20:13175053-13175075 GACTCACAGTTCCACATGACTGG - Intergenic
1170313352 20:15016702-15016724 GACTTACAGTTGCACATGACTGG + Intronic
1170338288 20:15295227-15295249 GTCTCACAGTTCCACATGACTGG - Intronic
1170449393 20:16466632-16466654 GACTCACAGTTCCACGTGGCTGG - Intronic
1170787952 20:19483730-19483752 GCCCCACAGTTGCAAGAAGCTGG - Intronic
1170810469 20:19670151-19670173 GTCCCACAGTTACATGTGAAGGG - Intronic
1173254412 20:41383731-41383753 GACTCACAGTTCCACGTGGCTGG - Intergenic
1173392710 20:42649137-42649159 GACTCACAGTTCCACGTGGCTGG + Intronic
1173577222 20:44120294-44120316 GCCCCACAGTTGCACGTGACAGG + Intronic
1173674909 20:44825237-44825259 GACTCACAGTTCCACGTGGCTGG + Intergenic
1173942945 20:46927482-46927504 GACTCACAGTTCCATGTGACTGG + Intronic
1174092855 20:48063140-48063162 GACTCACAGTTCCACATGACTGG - Intergenic
1174108437 20:48179986-48180008 GACCCACAGTTCCACATGGCTGG - Intergenic
1174116985 20:48232973-48232995 GACTCACAGTTCCACGTGGCTGG - Intergenic
1174197284 20:48782422-48782444 GACTCACAGTTTCACGTGGCTGG - Intronic
1174709135 20:52686634-52686656 GACCCACAGTTCCACGTGGCTGG + Intergenic
1174873549 20:54205420-54205442 GACTCACAGTTCCACGTGGCTGG + Intergenic
1175050757 20:56153114-56153136 GACTCACAGTTCCACGTGGCTGG + Intergenic
1175052269 20:56166511-56166533 GCCACACAGCAGCACGTGAGTGG + Intergenic
1175691989 20:61072140-61072162 GACCCACAGTTCAACGTGGCTGG - Intergenic
1175746871 20:61463180-61463202 GACTCACAGTTCCACGTGACTGG - Intronic
1175840762 20:62025669-62025691 GACTCACAGTTCCACATGACTGG - Intronic
1175892176 20:62320805-62320827 GCCACGCAGTTGCTCGTGAATGG + Exonic
1176201402 20:63862389-63862411 GCCCCACAGTTGGAAGGGGCTGG + Exonic
1176403272 21:6336730-6336752 GCCTCACAGTTTCACATGGCTGG + Intergenic
1176433885 21:6652374-6652396 GCCTCACAGTTTCACATGGCTGG - Intergenic
1177059579 21:16353979-16354001 GACTCACAGTTCCACGTGGCTGG - Intergenic
1177114589 21:17070865-17070887 GACTCACAGTTCCACGTGGCTGG + Intergenic
1177217289 21:18146603-18146625 GACCCACAGTTCCACATGGCTGG - Intronic
1177450786 21:21262788-21262810 GACTCACAGTTCCACGTGGCTGG + Intronic
1177452748 21:21292872-21292894 GACTCACAGTTCCAAGTGACTGG + Intronic
1177587381 21:23116058-23116080 GACTCACAGTTCCACGTGGCTGG + Intergenic
1177639345 21:23826293-23826315 GACTCACAGTTCCACATGACTGG - Intergenic
1177918569 21:27123106-27123128 GACTCACAGTTCCACGTGGCTGG + Intergenic
1177931362 21:27288269-27288291 GACTCACAGTTCCACATGACTGG + Intergenic
1177988177 21:28004411-28004433 GACTTACAGTTCCACGTGACTGG + Intergenic
1178041397 21:28644134-28644156 GACCCACAGTTCCACATGGCTGG + Intergenic
1178052189 21:28759835-28759857 GACTCACAGTTCCACGTGGCTGG - Intergenic
1178056020 21:28799199-28799221 GACTCACAGTTCCACGTGGCTGG + Intergenic
1178098525 21:29240930-29240952 GACTCACAGTTCCACGTGGCTGG - Intronic
1178106180 21:29321959-29321981 GGCTCACAGTTGCACATGGCTGG + Intronic
1178260348 21:31093954-31093976 GACTCACAGTTCCACGTGGCTGG - Intergenic
1178280723 21:31280435-31280457 GACTCACAGTTCCACGTGGCTGG - Intronic
1178346012 21:31828600-31828622 GACTCACAGTTCCATGTGACTGG - Intergenic
1178379706 21:32097528-32097550 GACTCACAGTTCCACGTGGCTGG + Intergenic
1178419278 21:32430556-32430578 GACTCACAGATCCACGTGACTGG + Intronic
1178694639 21:34782175-34782197 GACTCACAGTTGCACATGGCTGG - Intergenic
1178793532 21:35722322-35722344 GACTCACAGTTCCACGTGACTGG + Intronic
1178809441 21:35867868-35867890 GACTCACAGTTCCACGTGACCGG + Intronic
1179016442 21:37597799-37597821 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1179131427 21:38640666-38640688 GACTCACAGTTCCACGTGGCTGG - Intronic
1179161129 21:38900301-38900323 GACTCACAGTTCCACGTGGCTGG - Intergenic
1179176774 21:39013641-39013663 GACCCACGGTTCCACGTGGCTGG + Intergenic
1179213329 21:39345681-39345703 TCCCTACAGTTCCACATGACAGG + Intronic
1179237197 21:39558326-39558348 GACTCACAGTTCCACGTGGCTGG - Intronic
1179350664 21:40607769-40607791 GACTCACAGTTCCACGTGGCTGG - Intronic
1179398213 21:41060468-41060490 GACTCACAGTTCCACATGACTGG + Intergenic
1179582230 21:42351239-42351261 GCCCCAGACCTGCACGTGGCCGG - Intergenic
1180218199 21:46340059-46340081 GACTCACAGTTCCACGTGGCTGG + Intronic
1180942435 22:19668089-19668111 GCCTCACAGTTCCACGAGGCAGG + Intergenic
1181129485 22:20722119-20722141 GACTCACAGTTCCACGTGGCTGG - Intronic
1181485269 22:23226868-23226890 TCCCCTCAGTTGCACCTGAAAGG + Intronic
1181875872 22:25940397-25940419 GACTCACAGTTCCACATGACTGG - Intronic
1182055948 22:27354781-27354803 GACTCACAGTTCCACGTGTCTGG + Intergenic
1183043465 22:35200945-35200967 GACTTACAGTTCCACGTGACTGG - Intergenic
1183047381 22:35230955-35230977 GACTCACAGTTCCACGTGGCTGG + Intergenic
1184450997 22:44582768-44582790 GTCACACGGTTGCACGTGTCTGG + Intergenic
1184862226 22:47179041-47179063 GACTCACAGTTCCACGTGGCTGG - Intergenic
1184936949 22:47731585-47731607 GACTCACAGTTCCACGTGGCTGG - Intergenic
1185124420 22:48999390-48999412 GACTCACAGTTCCACGTGGCTGG + Intergenic
1185152424 22:49171938-49171960 GACTCACAGTTCCACGTGGCTGG + Intergenic
1185310228 22:50150260-50150282 GCCCCACAGTGCCTGGTGACTGG - Intronic
949230552 3:1745053-1745075 GACTCACAGTTCTACGTGACTGG + Intergenic
949274249 3:2259525-2259547 GACTCACAGTTCCACGTGTCTGG + Intronic
949385861 3:3501690-3501712 GACTCACAGTTCCACGTGGCTGG - Intergenic
949413616 3:3793602-3793624 GACTCACAGTTCCACGTGGCTGG - Intronic
949476018 3:4446418-4446440 GACTCACAGTTCCACATGACTGG - Intronic
949770472 3:7571834-7571856 GACTCACAGTTCCACATGACTGG + Intronic
949828162 3:8184916-8184938 GACTCACAGTTCCACGTGGCTGG - Intergenic
949881169 3:8662030-8662052 GATCCACAGTTCCACGTGGCTGG - Intronic
949956798 3:9275738-9275760 GACTCACAGTTCCACGTGATGGG - Intronic
951495292 3:23318531-23318553 GACTCACAGTTCCACGTGGCTGG + Intronic
952171510 3:30812375-30812397 GACTCACAGTTCCACGTGGCTGG + Intronic
952298675 3:32084989-32085011 GACTCACAGTTCCACGTGACTGG + Intergenic
953436783 3:42883552-42883574 GACTCACAGTTCCACGTGGCTGG - Intronic
953606924 3:44418375-44418397 GACTCACAGTTCCACGTGACTGG - Intergenic
954601697 3:51875398-51875420 TCCCCACAGTTACTCATGACAGG - Intronic
954721029 3:52563269-52563291 CCCCCACAGGTGAAGGTGACAGG - Intronic
955154333 3:56401906-56401928 GACCCACAGTTCCACATGGCTGG + Intronic
955570173 3:60296113-60296135 GACTCACAGTTCCACGTGGCTGG - Intronic
955745569 3:62136806-62136828 GACTCACAGTTCCACGTGACTGG - Intronic
955869179 3:63418589-63418611 GACTCACAGTTCCACGTGACTGG + Intronic
955900346 3:63747189-63747211 GACTCACAGTTCCACATGACTGG + Intergenic
956030197 3:65028883-65028905 GACTCACAGTTACACGTGGCTGG - Intergenic
956169381 3:66420894-66420916 GACTCACAGTTCCACGTGGCTGG + Intronic
956379382 3:68649553-68649575 GACTCACAGTTTCACGTGCCTGG - Intergenic
956388593 3:68747542-68747564 GACTCACAGTTCCACGTGGCTGG - Intronic
956399814 3:68865575-68865597 GACTCACAGTTCCACATGACTGG - Intronic
956714544 3:72067115-72067137 GACCCACAGTTCCACGTGGCTGG + Intergenic
956994458 3:74808367-74808389 GACTCACAGTTTCACGTGGCTGG + Intergenic
957212416 3:77276776-77276798 GACCCACAGTTCCACATGGCTGG + Intronic
957258010 3:77863554-77863576 GACTCACAGTTCCACATGACTGG - Intergenic
957261331 3:77905618-77905640 GACTCACAGTTCCACGTGGCTGG - Intergenic
957292149 3:78291967-78291989 GACTCACAGTTCCACGTGGCTGG + Intergenic
957294489 3:78319587-78319609 GACTCACAGTTCCACATGACTGG - Intergenic
957337745 3:78853762-78853784 GACTCACAGTTCCACGTGACTGG + Intronic
957442723 3:80271187-80271209 GACTCACAGTTCCACGTGGCTGG - Intergenic
957454753 3:80427005-80427027 GACTCACAGTTCCACGTGGCTGG - Intergenic
957464578 3:80570708-80570730 GACTCACAGTTCCACATGACTGG - Intergenic
957476898 3:80737399-80737421 GACTCACAGTTCCACGTGGCTGG + Intergenic
957646404 3:82935857-82935879 GACCCACAGTTCCATGTGGCCGG + Intergenic
957656291 3:83081534-83081556 GACTCACAGTTCCACATGACTGG + Intergenic
957821112 3:85374640-85374662 GACTCACAGTTTCACATGACTGG + Intronic
958018556 3:87970025-87970047 GACTCACAGTTCCACGTGGCCGG - Intergenic
958049301 3:88323952-88323974 GACTCACAGTTCCACATGACTGG - Intergenic
958152254 3:89705383-89705405 GACTCACAGTTTCACGTGGCTGG + Intergenic
958174235 3:89974775-89974797 GGCTCACAGTTCCACGTGGCTGG - Intergenic
958175180 3:89988603-89988625 GACTCACAGTTCCACGTGCCTGG - Intergenic
958487088 3:94726468-94726490 GCCTCACAGTTCCACATGGCTGG - Intergenic
958557875 3:95703658-95703680 GACCCACAGTTCCACATGGCTGG + Intergenic
958597167 3:96241834-96241856 GACTCACAGTTTCATGTGACTGG + Intergenic
958604258 3:96338032-96338054 GACTCACAGTTCCACGTGGCTGG - Intergenic
958620905 3:96558468-96558490 GACTCACAGTTCCACGTGGCTGG + Intergenic
959095305 3:101949228-101949250 GACTCACAGTTCCACGTGGCTGG - Intergenic
959718011 3:109454850-109454872 GACTCACAGTTCCACGTGATTGG + Intergenic
959730131 3:109591556-109591578 GACTCACAGTTCCAAGTGACTGG + Intergenic
959832094 3:110876054-110876076 GACTCACAGTTCCACGTGGCTGG - Intergenic
960197101 3:114781916-114781938 GACTCACAGTTTCACGTGGCTGG - Intronic
960398467 3:117166364-117166386 GACTCACAGTTCCACGTGGCTGG - Intergenic
960608625 3:119533712-119533734 GACTCACAGTTCCACGTGGCTGG - Intronic
960660610 3:120053885-120053907 GACTCACAGTTCCACGTGACTGG - Intronic
962853525 3:139325351-139325373 GACTCACAGTTCCACGTGGCTGG + Intronic
963351743 3:144160186-144160208 GACCCACAGTTCCACATGGCTGG + Intergenic
963581695 3:147134318-147134340 GACTCACAGTTCCACGTGGCTGG + Intergenic
963754515 3:149219940-149219962 GACTCACAGTTCCACATGACTGG - Intronic
964025949 3:152074608-152074630 GACCCACAGTTCCACATGGCTGG + Intergenic
964079985 3:152742989-152743011 GACTCACAGTTCCACATGACTGG + Intergenic
964898447 3:161627567-161627589 GACTCATAGTTGCAGGTGACTGG + Intergenic
965012229 3:163108339-163108361 GACTCACAGTTTCACGTGGCTGG + Intergenic
965316049 3:167191653-167191675 GACTCACAGTTCCACGTGGCTGG - Intergenic
966341915 3:178934714-178934736 GACTCACAGTTCCACGTGGCTGG + Intergenic
967564921 3:190961786-190961808 GGCTCACAGTTCCACGTGGCTGG - Intergenic
968557746 4:1256443-1256465 GACTCACAGTTTCACGTGGCTGG - Intergenic
969037426 4:4265951-4265973 GACTCACAGTTCCACGTGGCTGG - Intergenic
969073027 4:4555020-4555042 GACTCACAGTTCCACGTGGCTGG + Intergenic
969195501 4:5560355-5560377 GACTCACAGTTCCACATGACTGG + Intronic
969222303 4:5769139-5769161 GACTCACAGTTCCACGTGGCTGG + Intronic
969268322 4:6080695-6080717 GACTCACAGTTTCACGTGGCTGG - Intronic
969921065 4:10540293-10540315 GACCCACAGTTTCACATGGCTGG - Intronic
970026284 4:11627440-11627462 GACTCACAGTTCCACGTGGCTGG + Intergenic
970157107 4:13152691-13152713 GACTCACAGTTCCACGTGGCTGG + Intergenic
970157351 4:13154414-13154436 GACTCACAGTTCCACGTGGCTGG + Intergenic
970167977 4:13260004-13260026 GACTCACAGTTCCACATGACTGG - Intergenic
970569733 4:17368003-17368025 GACTCACAGTTCCACATGACTGG - Intergenic
970991682 4:22220326-22220348 GACTCACAGTTCCACGTGGCTGG - Intergenic
971008080 4:22397826-22397848 GACCCACAGTTCCACATGGCTGG - Intronic
971053013 4:22882270-22882292 GACTCACAGTTCCACATGACTGG - Intergenic
971248141 4:24948980-24949002 GACTCACAGTTTCACGTGGCTGG - Intronic
971262936 4:25073540-25073562 GACTCACAGTTCCACGTGGCTGG - Intergenic
971390518 4:26181080-26181102 GACTCACAGTTCCACGTGGCTGG - Intronic
971661905 4:29429503-29429525 GACTCACAGTTCCACGTGGCTGG + Intergenic
971833633 4:31732766-31732788 GACTCACAGTTCCACGTGGCTGG - Intergenic
972011057 4:34182778-34182800 GACCCACAGTTCCATGTGGCTGG + Intergenic
972175695 4:36402711-36402733 GACTCACAGTTCCACGTGTCTGG - Intergenic
972275547 4:37554225-37554247 GACTCACAGTTCCACGTGGCTGG - Intronic
972434185 4:39015942-39015964 GACTCACAGTTCCACGTGGCTGG - Intronic
972937491 4:44156382-44156404 GACTCACAGTTTCACGTGGCTGG + Intergenic
973710426 4:53624477-53624499 GACTCACAGTTGCATGTGGCTGG - Intronic
974158606 4:58106617-58106639 GACTCACAGTTCCACGTGTCTGG - Intergenic
974202113 4:58655810-58655832 GACTCACAGTTCCACGTGGCTGG - Intergenic
974205319 4:58695223-58695245 GACTCACAGTTCCACATGACTGG - Intergenic
974219335 4:58946888-58946910 GACTCACAGTTCCACGTGGCTGG + Intergenic
974724326 4:65778661-65778683 GACTTACAGTTCCACGTGACTGG - Intergenic
974748300 4:66103838-66103860 GACTCACAGTTCCACGTGGCTGG - Intergenic
974845870 4:67350854-67350876 GACTCACAGTTCCACGTGGCTGG + Intergenic
974872381 4:67659549-67659571 GACTCACAGTTTCACATGACTGG - Intronic
974902215 4:68014540-68014562 GACTCACAGTTCCACGTGGCTGG - Intergenic
974960279 4:68691319-68691341 GACTCACAGTTCCACGTGGCTGG + Intergenic
975046372 4:69808733-69808755 GACTCACAGTTCCACGTGGCTGG - Intergenic
975252073 4:72192094-72192116 GACTCACAGTTCCACATGACTGG - Intergenic
975543472 4:75537553-75537575 GACTCACAGTTCCACGTGGCGGG - Intronic
975917836 4:79346326-79346348 GACTCACAGTTCCACGTGTCTGG - Intergenic
976335364 4:83879144-83879166 GACTCACAGTTCCACGTGGCTGG - Intergenic
976395606 4:84551767-84551789 GACTCACAGTTCCACGTGGCTGG + Intergenic
976443059 4:85098843-85098865 GACTCACAGTTCCACGTGGCTGG + Intergenic
976461050 4:85313580-85313602 GACTCACAGTTGCACGTGGTTGG + Intergenic
976668565 4:87626985-87627007 GACTCACAGTTCCACGTGGCTGG + Intergenic
976750484 4:88447357-88447379 GACTCACAGTTCCACATGACTGG + Intergenic
976853368 4:89575185-89575207 GACTCACAGTTCCACGTGGCTGG - Intergenic
976983679 4:91265894-91265916 GTCTCACAGTTTCACGTGGCTGG + Intronic
977026198 4:91821870-91821892 GACTTACAGTTGCACGTGACTGG + Intergenic
977116215 4:93031713-93031735 GACCCACAGTTCCACATGACTGG - Intronic
977311323 4:95391157-95391179 GACTCACAGTTCCACATGACTGG - Intronic
977503788 4:97877461-97877483 GACTCACAGTTCCACGTGGCTGG + Intronic
977545242 4:98368986-98369008 GACTCACAGTTTCACATGACTGG + Intronic
977675709 4:99744619-99744641 GACTCACAGTTCCACGTGGCTGG + Intergenic
978049494 4:104179994-104180016 GACTCACAGTTGCACATGGCTGG + Intergenic
978083520 4:104622314-104622336 GACTTACAGTTCCACGTGACTGG + Intergenic
978106846 4:104913005-104913027 GACTCACAGTTCCACATGACTGG + Intergenic
978571296 4:110140933-110140955 GACTCACAGTTCCACGTGGCTGG + Intronic
978696189 4:111583497-111583519 GACTCACAGTTCCACATGACTGG + Intergenic
979183556 4:117758969-117758991 GACTTACAGTTCCACGTGACTGG - Intergenic
979304710 4:119129276-119129298 GACTCACAGTTCCACGTGGCTGG - Intergenic
979368124 4:119849202-119849224 GACTCACAGTTCCACGTGGCTGG + Intergenic
979387640 4:120088185-120088207 GACTCACAGTTCCACGTGGCTGG + Intergenic
979484935 4:121260001-121260023 TCACAACAGTTGCACATGACTGG + Intergenic
979548490 4:121964014-121964036 GACTCACAGTTCCACGTGGCTGG + Intergenic
979876645 4:125899633-125899655 GACTCACAGTTGCACATGGCTGG - Intergenic
980084579 4:128378139-128378161 GACACACAGTTCCATGTGACTGG + Intergenic
980203801 4:129691625-129691647 GGCTCACAGTTCCACGTGGCTGG + Intergenic
980214517 4:129834612-129834634 GACTCATAGTTCCACGTGACTGG + Intergenic
980513567 4:133824444-133824466 GACTCACAGTTTCATGTGACTGG - Intergenic
980720518 4:136688473-136688495 GCCTTACAGTTCCACGTGACTGG + Intergenic
980824523 4:138057493-138057515 GACTCACAGTTCCACGTGGCTGG - Intergenic
980932776 4:139197457-139197479 GACTTACAGTTCCACGTGACTGG - Intergenic
980955747 4:139427647-139427669 GACTCACAGTTCCACGTGGCTGG + Intergenic
981359513 4:143830646-143830668 GACCCACAATTGCATGTGGCTGG - Intergenic
981645688 4:146996086-146996108 GACTCACAGTTCCACGTGACTGG - Intergenic
981679469 4:147379553-147379575 GACTCACAGTTCCACGTGGCTGG + Intergenic
982320630 4:154073294-154073316 GACTCACAGTTCCACGTGGCTGG + Intergenic
982731883 4:158964743-158964765 GACTCACAGTTCCACATGACTGG + Intronic
983419943 4:167504188-167504210 GACTCACAGTTCCACGTGCCTGG - Intergenic
983723968 4:170894498-170894520 GACTCACAGTTTCACGTGGCGGG + Intergenic
984720539 4:182969091-182969113 GACTCACAGTTCCACGTGGCTGG + Intergenic
985308706 4:188573798-188573820 GACTCACAGTTCCACGTGGCTGG - Intergenic
985844208 5:2332161-2332183 GACTCACAGTTCCACGTGGCTGG + Intergenic
985957365 5:3275506-3275528 GCCCCACGAGTGCAGGTGACAGG - Intergenic
986223260 5:5789381-5789403 GACTCACAGTTCCACGTGGCTGG - Intergenic
986310659 5:6548416-6548438 GACTCACAGTTCCACGTGGCTGG - Intergenic
986316866 5:6595152-6595174 GACCCACAGTTCCACATGACTGG - Intergenic
986797526 5:11226496-11226518 GACTCACAGTTCCACATGACTGG + Intronic
986805402 5:11304063-11304085 GACTCACAGTTCCACGTGGCTGG - Intronic
986885933 5:12235823-12235845 GACCCACAGTTCCACATGGCTGG - Intergenic
986895093 5:12356093-12356115 GACTCACAGTTCCATGTGACTGG + Intergenic
986994963 5:13596512-13596534 GACTTACAGTTCCACGTGACTGG + Intergenic
987025805 5:13925491-13925513 GCCTTACAGTTCCACGTGGCTGG + Intronic
987029680 5:13964304-13964326 CCTCCACGGTTGCAAGTGACTGG + Intergenic
987172218 5:15270629-15270651 GACTCACAGTTCCACATGACTGG - Intergenic
987207159 5:15639541-15639563 GACTCACAGTTCCACGTGGCTGG - Intronic
987261041 5:16203754-16203776 GACTCACAGTTCCACATGACGGG - Intergenic
987470818 5:18325261-18325283 GACTCACAGTTGCATGTGGCTGG + Intergenic
987481147 5:18459417-18459439 GGCTCACAGTTGCACATGGCTGG - Intergenic
987490161 5:18569886-18569908 GACCCACAGTTCCTCATGACTGG - Intergenic
987500023 5:18697824-18697846 GACTCACAGTTCCACGTGGCTGG + Intergenic
987737532 5:21866127-21866149 GACTCACAGTTCCACATGACTGG - Intronic
987794507 5:22608861-22608883 GACTCACAGTTCCACGTGGCTGG - Intronic
987847883 5:23311278-23311300 GACTCACAGTTCCACATGACTGG + Intergenic
987849773 5:23336444-23336466 GACTCACAGTTCCACATGACTGG + Intergenic
987896994 5:23959755-23959777 GACTCACAGTTCCACGTGGCTGG + Intronic
987987938 5:25173673-25173695 GACTCACAGTTCCACATGACTGG - Intergenic
988025911 5:25689680-25689702 GACTCACAGTTTCACGTGGCTGG + Intergenic
988034067 5:25803253-25803275 GGCTCACAGTTCCACGTGGCTGG + Intergenic
988133331 5:27136132-27136154 GACTCACAGTTCCACGTGGCTGG + Intergenic
988146337 5:27313572-27313594 GACTCACAGTTCCACGTGTCTGG + Intergenic
988204240 5:28114408-28114430 GACACACAGTTCCACGTGGCTGG + Intergenic
988307244 5:29507982-29508004 GCCTCACAGTTCCACATGGCTGG - Intergenic
988386002 5:30566096-30566118 GACTCACAGTTCCACGTGGCTGG + Intergenic
988394328 5:30678381-30678403 GACTTACAGTTGCACGTGGCTGG - Intergenic
988507900 5:31839955-31839977 GGCTCACAGTTCCACGTGGCTGG - Intronic
988673461 5:33406888-33406910 GACTCACAGTTCCACGTGGCTGG - Intergenic
989289900 5:39750989-39751011 GACTCACAGTTCCACGTGACTGG - Intergenic
989751323 5:44897147-44897169 GACTTACAGTTCCACGTGACTGG - Intergenic
990132866 5:52609238-52609260 GACTCACAGTTCCACGTGGCTGG - Intergenic
990393068 5:55347799-55347821 GACTCACAGTTCCACGTGGCTGG + Intronic
990448048 5:55911121-55911143 GACTCACAGTTCCACGTGGCTGG + Intronic
990594504 5:57299576-57299598 GACTCACAGTTCCACGTGGCTGG + Intergenic
990815947 5:59784985-59785007 GACTTACAGTTCCACGTGACTGG - Intronic
991006911 5:61836901-61836923 GACTCACAGTTCCACGTGGCTGG - Intergenic
991021008 5:61980218-61980240 GGACTACAGGTGCACGTGACTGG - Intergenic
991039344 5:62159747-62159769 GACTCACAGTTCCACGTGGCTGG - Intergenic
992018362 5:72598274-72598296 GACTCACAGTTCCACATGACTGG + Intergenic
992335675 5:75766259-75766281 GACCCACAGTTTCATGTGGCTGG - Intergenic
992778387 5:80107292-80107314 GACTCACAGTTCCACGTGGCTGG - Intergenic
992871846 5:81014315-81014337 GACTCACAGTTCCACATGACTGG + Intronic
992885683 5:81157645-81157667 GACTCACAGTTCCACATGACTGG + Intronic
993090256 5:83416822-83416844 GACTCACAGTTCCACGTGGCTGG - Intergenic
993208688 5:84920566-84920588 GACTCACAGTTCCACATGACTGG - Intergenic
993262800 5:85681919-85681941 GACCCACAGTTCCACATGGCTGG + Intergenic
994244419 5:97463309-97463331 GACTCACAGTTCCATGTGACTGG - Intergenic
994338655 5:98600054-98600076 GACACACAGTTACACATGACTGG - Intergenic
994417004 5:99484769-99484791 GACTCACAGTTCCACGTGGCGGG - Intergenic
994462970 5:100090405-100090427 GACTCACAGTTCCACGTGGCTGG + Intergenic
994464646 5:100111510-100111532 GACTCACAGTTCCACGTGGCTGG + Intergenic
994549293 5:101209663-101209685 GACTCACAGTTACACATGACTGG - Intergenic
994808092 5:104478159-104478181 GACCCACAGTTTCACATGGCTGG - Intergenic
994831008 5:104784220-104784242 GACTCACAGTTCCACGTGGCTGG + Intergenic
994870620 5:105345591-105345613 GACTCACAGTTCCACGTGTCTGG + Intergenic
994890691 5:105631166-105631188 GACTCACAGTTCCACATGACTGG + Intergenic
994905605 5:105838419-105838441 GACTCACAGTTCCACATGACTGG + Intergenic
995078317 5:108014805-108014827 GACTCACAGTTCCATGTGACTGG + Intronic
995200182 5:109416096-109416118 GACTCACAGTTTCACGTGGCTGG - Intergenic
995353918 5:111215181-111215203 GACTCACAGTTGCGCGTGGCTGG - Intergenic
995600583 5:113791111-113791133 TCTCCACAGTGGCATGTGACTGG + Intergenic
995760976 5:115561625-115561647 GACTCACAGTTCCATGTGACTGG + Intergenic
995860558 5:116636201-116636223 GACTCACAGTTCCACGTGACTGG + Intergenic
996024751 5:118632316-118632338 GACTCACAGTTCCACGTGGCTGG - Intergenic
996098015 5:119419710-119419732 GACTCACAGTTCCACGTGGCTGG - Intergenic
996330904 5:122327669-122327691 GACTCACAGTTCCACATGACTGG - Intronic
996774598 5:127120190-127120212 GACTCACAGTTCCACGTGGCTGG + Intergenic
996820255 5:127618981-127619003 GACTCACAGTTCCACGTGGCTGG + Intergenic
996861517 5:128072248-128072270 GACTCACAGTTCCACGTGGCTGG - Intergenic
996871552 5:128198660-128198682 GACCCACAGTTCCACATGGCTGG - Intergenic
997014731 5:129919472-129919494 GACTCACAGTTCCACGTGGCTGG + Intronic
997712933 5:136021405-136021427 GACTCACAGTTCCACGTGGCTGG + Intergenic
999026395 5:148236817-148236839 GCCTCACAGTTTCATGTGACTGG + Intergenic
999028600 5:148263880-148263902 GACTCACAGTTCCACGTGGCTGG + Intergenic
999540906 5:152571692-152571714 GACTCACAGTTCCACGTGGCTGG - Intergenic
999841324 5:155430726-155430748 GACTTACAGTTCCACGTGACTGG - Intergenic
1000057979 5:157626028-157626050 GCCTCACAGTTGTATGTGAGGGG - Exonic
1000238952 5:159391161-159391183 GACTCACAGTTCCACGTGGCTGG + Intergenic
1000573893 5:162951928-162951950 GACTCACAGTTCCACGTGACTGG + Intergenic
1001724529 5:173885931-173885953 GACTCACAGTTCCACGTGACTGG - Intergenic
1001795381 5:174498051-174498073 GACTCACAGTTCCACGTGGCTGG - Intergenic
1002961886 6:1923107-1923129 GACTCACAGTTCCACGTGGCTGG - Intronic
1003001047 6:2334101-2334123 GACTCACAGTTCCACGTGGCTGG + Intergenic
1003635830 6:7830646-7830668 GACTCACAGTTCCACATGACTGG + Intronic
1003649214 6:7943150-7943172 GACTCACAGTTCCACGTGGCTGG - Intronic
1003897832 6:10624286-10624308 GACTCACAGTTCCACGTGACTGG + Intronic
1004249490 6:14011899-14011921 GACTCACAGTTCCACGTGGCTGG + Intergenic
1004522345 6:16373774-16373796 GACTCACAGTTCCACGTGGCTGG - Intronic
1004676198 6:17845040-17845062 GACTCACAGTTCCACGTGGCTGG + Intronic
1004895864 6:20147148-20147170 GACTCACAGTTCCACGTGGCTGG - Intronic
1005217885 6:23553638-23553660 GACTCACAGTTCCACATGACTGG + Intergenic
1005632219 6:27719091-27719113 GACTCACAGTTCCACGTGACTGG + Intergenic
1006405800 6:33844070-33844092 GACTCACAGTTCCACGTGGCCGG - Intergenic
1006696972 6:35939545-35939567 GACTCACAGTTCCACATGACTGG - Intergenic
1007223632 6:40297687-40297709 GACTCACAGTTCCACATGACTGG - Intergenic
1007658505 6:43467603-43467625 GACTCACAGTTCCACGTGGCTGG - Intergenic
1007856742 6:44865483-44865505 GACTCACAGTTCCACGTGGCTGG + Intronic
1007915755 6:45560312-45560334 GACTCACAGTTCCACGTGGCTGG + Intronic
1007976988 6:46111972-46111994 GACCCACAATTCCACGTGGCTGG - Intergenic
1008060956 6:46996497-46996519 GGCCCACAGTTCCACATGGCTGG - Intergenic
1008134306 6:47756267-47756289 GACTCACAGTTCCACGTGTCTGG - Intergenic
1008233494 6:49014293-49014315 GACTCACAGTTACACATGACTGG + Intergenic
1008377293 6:50806590-50806612 GACTCACAGTTCCACGTGTCTGG - Intergenic
1009473516 6:64058235-64058257 GACTCACAGTTCCACATGACTGG - Intronic
1009554605 6:65147788-65147810 GACCCACAGTTCCGCATGACTGG + Intronic
1009577381 6:65483768-65483790 GACCTACAGTTCCACGTGGCTGG + Intronic
1009768997 6:68121051-68121073 GACTCACAGTTCCACATGACTGG + Intergenic
1009780856 6:68267485-68267507 GACTCACAGTTCCACATGACTGG - Intergenic
1009929483 6:70160169-70160191 GACCCACAGCTCCACGTGGCTGG + Intronic
1010032018 6:71281284-71281306 GACTCACAGTTCCACGTGGCTGG - Intergenic
1010291178 6:74139873-74139895 GACTCACAGTTCCACATGACTGG - Intergenic
1010347629 6:74830727-74830749 GGCCCACAGTTCCACGTGGCTGG + Intergenic
1010872453 6:81059418-81059440 GACTCACAGTTCCACGTGTCTGG - Intergenic
1010884250 6:81217205-81217227 GACTCACAGTTCCACGTGCCTGG - Intergenic
1011292303 6:85789527-85789549 GACTCACAGTTCCACATGACTGG - Intergenic
1011692352 6:89881989-89882011 GACTCACAGTTCCACATGACTGG + Intergenic
1011876419 6:91967039-91967061 GACTCACAGTTGCACATGGCTGG - Intergenic
1012486048 6:99723408-99723430 GCCTCACAGTTGCACATGGCAGG - Intergenic
1012715372 6:102661549-102661571 GACTCACAGTTCCACATGACTGG - Intergenic
1012811782 6:103967934-103967956 GACTCACAGTTACACATGACTGG + Intergenic
1012835068 6:104254484-104254506 GACTCACAGTTCCATGTGACTGG + Intergenic
1013014993 6:106152778-106152800 GACTCACAGTTCCACGTGGCTGG - Intergenic
1013197851 6:107861454-107861476 GACTCACAGTTCCACGTGGCTGG + Intergenic
1013396771 6:109748685-109748707 GACTCACAGTTCCACGTGGCTGG + Intronic
1013419654 6:109955423-109955445 GACTCACAGTTTCACGTGGCTGG + Intergenic
1013453587 6:110309542-110309564 GTATCACAGTTGCACGTGTCTGG + Intronic
1013767635 6:113593375-113593397 GACTCACAGTTTCACATGACTGG + Intergenic
1013927582 6:115492390-115492412 GACTCACGGTTGCATGTGACTGG + Intergenic
1013962503 6:115917438-115917460 GACTTACAGTTCCACGTGACTGG + Intergenic
1014022074 6:116602914-116602936 GACTCACAGTTCCACGTGGCTGG + Intergenic
1014249161 6:119098275-119098297 GACTCACAGTTCCACGTGGCTGG - Intronic
1014346074 6:120270929-120270951 GACTCACAGTTCCACGTGGCTGG - Intergenic
1015516408 6:134086748-134086770 GACTCACAGTTCCACGTGGCTGG - Intergenic
1015549635 6:134398714-134398736 GACTCACAGTTCCACGTGGCTGG - Intergenic
1015694530 6:135965515-135965537 GGCCCACAGTTCCACATGGCTGG + Intronic
1015777640 6:136831155-136831177 GACTCACAGTTCCACATGACTGG + Intronic
1016001814 6:139049302-139049324 GACTCACAGTTCCACGTGGCAGG - Intergenic
1016150664 6:140738026-140738048 GACTCACAGTTCCACGTGGCTGG + Intergenic
1016161422 6:140885311-140885333 GACTCACAGTTGCACTTGGCTGG + Intergenic
1016236313 6:141871637-141871659 GGCTCACAGTTCCACATGACTGG + Intergenic
1016247631 6:142002888-142002910 GACTCACAGTTTCACGTGGCTGG + Intergenic
1016281627 6:142425777-142425799 GACTTACAGTTCCACGTGACTGG + Intronic
1016337281 6:143020929-143020951 GACTCACAGTTCCACGTGGCTGG + Intergenic
1016474593 6:144413380-144413402 GACCCACAGTTCCACATGGCTGG + Intronic
1016683085 6:146852918-146852940 GACCCACAGTTCCACATGGCTGG - Intergenic
1016799018 6:148149803-148149825 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1016876191 6:148867719-148867741 GACTCACAGTTCCACGTGGCTGG - Intronic
1017278564 6:152598356-152598378 GGCTCACAGTTCCACGTGGCTGG - Intronic
1017342193 6:153336655-153336677 GACTCACAGTTCCACATGACTGG - Intergenic
1017346639 6:153390894-153390916 GACTCACAGTTCCACGTGGCTGG - Intergenic
1017359790 6:153554347-153554369 GACTCACAGTTCCACATGACTGG + Intergenic
1017408961 6:154149161-154149183 GACTCACAGTTCCACGTGGCTGG + Intronic
1017524361 6:155229776-155229798 GACTCACAGTTCCACATGACTGG + Intronic
1017762266 6:157578829-157578851 GACTCACAGTTCCACATGACTGG - Intronic
1017790552 6:157794313-157794335 GACTCACAGTTCCACGTGGCTGG - Intronic
1018101741 6:160446409-160446431 GACTCACAGTTTCACATGACTGG + Intronic
1018219686 6:161565653-161565675 GACTCACAGTTCCACATGACTGG - Intronic
1018229633 6:161663150-161663172 GACTCACAGTTCCACGTGACTGG - Intronic
1018358458 6:163041575-163041597 GACTCACAGTTCCACATGACTGG - Intronic
1018396751 6:163383683-163383705 GACTCACAGTTCCACGTGGCTGG - Intergenic
1018449771 6:163896789-163896811 GACTCACAGTTCCACGTGGCTGG - Intergenic
1018452468 6:163922030-163922052 GACTCACAGTTCCACGTGGCTGG + Intergenic
1018485533 6:164237842-164237864 GACTCACAGTTTCACGTGGCTGG - Intergenic
1018527897 6:164734495-164734517 GACTCACAGTTCCACGTGGCTGG - Intergenic
1018720286 6:166566784-166566806 GCCCCACTCCTGCACCTGACAGG + Intronic
1019081354 6:169432643-169432665 GACTCACAGTTTCACGTGACTGG - Intergenic
1019262794 7:91560-91582 GCACCACATCTGCACGAGACAGG - Intergenic
1019806541 7:3130549-3130571 GACTCACAGTTCCACGTGGCTGG + Intergenic
1019810685 7:3163048-3163070 GACTCACAGTTCCACGTGGCTGG - Intronic
1019952615 7:4385751-4385773 GACTCACAGTTCCACGTGGCTGG + Intergenic
1019970089 7:4533807-4533829 GACTCACAGTTCCACGTGGCTGG - Intergenic
1020015645 7:4829834-4829856 GGCTCACAGTTCCACGTGACTGG - Intronic
1020389863 7:7646570-7646592 GACTCACAGTTCCACGTGGCTGG - Intronic
1020412414 7:7907804-7907826 GACTCACAGTTCCACATGACTGG - Intronic
1020438953 7:8196984-8197006 GACTCACAGTTGCACATGGCTGG - Intronic
1021001934 7:15341743-15341765 GACTCACAGTTGCACATGACTGG + Intronic
1021612139 7:22467733-22467755 GACTCACAGTTCCACGTGGCTGG - Intronic
1021626119 7:22594902-22594924 GACTCACAGTTCCACATGACTGG + Intronic
1021700802 7:23317781-23317803 GCCTAACATTTGCATGTGACTGG + Intronic
1022605627 7:31811279-31811301 GACTCACAGTTCCACGTGGCTGG - Intronic
1022862431 7:34382275-34382297 GACTTACAGTTCCACGTGACTGG - Intergenic
1022862671 7:34383898-34383920 GACTCACAGTTCCACGTGGCCGG - Intergenic
1022978105 7:35576901-35576923 GACTCACAGTTCCACGTGGCTGG + Intergenic
1023293899 7:38695069-38695091 GACTCACAGTTCCACGTGTCTGG + Intergenic
1023370846 7:39510850-39510872 GACTCACAGTTCCACATGACTGG + Intergenic
1024184564 7:46936942-46936964 GACACACAGTTCCACGTGGCTGG - Intergenic
1024415880 7:49106864-49106886 GACTCACAGTTCCACGTGGCTGG - Intergenic
1024702226 7:51916650-51916672 GACTCACAGTTCCACATGACTGG + Intergenic
1025170178 7:56749336-56749358 GACTTACAGTTGCACGTGGCTGG - Intergenic
1025701707 7:63826382-63826404 GACTCACAGTTGCACGTGGCTGG + Intergenic
1025923441 7:65936829-65936851 GTCACACAGTTCCATGTGACTGG + Intronic
1026120696 7:67534404-67534426 GACTCACAGTTCCACGTGGCTGG - Intergenic
1026151939 7:67795290-67795312 GACTCACAGTTTCACGTGGCCGG + Intergenic
1026165133 7:67902925-67902947 GACTCACAGTTCCACGTGGCTGG + Intergenic
1026171111 7:67954747-67954769 GACCCACAGTTCCACGTGGCTGG + Intergenic
1026190766 7:68124208-68124230 GACTCACAGTTCCACGTGGCTGG - Intergenic
1026225647 7:68437700-68437722 GACTCACAGTTCCACGTGGCTGG - Intergenic
1026226952 7:68450618-68450640 GACTCACAGTTCCACATGACTGG - Intergenic
1026227927 7:68459059-68459081 GACTCACAGTTTCACGTGGCTGG + Intergenic
1026288992 7:68988826-68988848 GACTCACAGTTCCACGTGGCTGG - Intergenic
1026307410 7:69154097-69154119 GACTCACAGTTCCACGTGGCTGG + Intergenic
1026561396 7:71453366-71453388 GGCTCACAGTTGCATGTGGCTGG + Intronic
1026570513 7:71525650-71525672 GACTCACAGTTCCACATGACTGG - Intronic
1026590808 7:71694035-71694057 GACTCACAGTTCCACGTGGCTGG + Intronic
1026671160 7:72391794-72391816 GACCCACAGTTCCATGTGGCTGG - Intronic
1026677002 7:72436420-72436442 GACTCACAGTTCCACGTGGCTGG - Intronic
1026800091 7:73394772-73394794 GACTCACAGTTCCACGTGGCTGG - Intergenic
1027581412 7:80001050-80001072 GACTCACAGTTCCACGTGGCTGG + Intergenic
1027764015 7:82316701-82316723 GACTCACAGTTCCACCTGACTGG + Intronic
1027922834 7:84418227-84418249 GACACACAGTTCCACCTGACTGG + Intronic
1028189052 7:87824433-87824455 GACTCACAGTTCCATGTGACTGG - Intronic
1028219663 7:88182266-88182288 ACCCCACAATGGCAGGTGACTGG - Intronic
1028544173 7:91979234-91979256 GACTCACAGTTCCACGTGGCTGG + Intronic
1028661936 7:93287989-93288011 GACTCACAGTTCCACATGACTGG + Intronic
1029036934 7:97532420-97532442 GCCTTACAGTTCCACGTGGCTGG + Intergenic
1029048962 7:97663390-97663412 GACTCACAGTTCCACGTGACTGG + Intergenic
1029984808 7:104913592-104913614 GACTCACAGTTCCACGTGGCTGG + Intergenic
1031106113 7:117545075-117545097 GACTCACAGTTCCATGTGACTGG + Intronic
1031240893 7:119238070-119238092 GACTCACAGTTCCACGTGGCTGG + Intergenic
1031379125 7:121062935-121062957 GACTCACAGTTCCACGTGGCTGG - Intronic
1031567821 7:123321682-123321704 GACTCACAGTTCCACGTGGCTGG + Intergenic
1031573255 7:123384485-123384507 GACTCACAGTTCCACGTGGCTGG - Intergenic
1031645770 7:124222952-124222974 GACTCACAGTTCCACGTGGCTGG - Intergenic
1031708998 7:125021618-125021640 GACGCACAGTTCCACGTGGCTGG - Intergenic
1031709255 7:125023662-125023684 GACTCACAGTTTCACGTGGCTGG - Intergenic
1031908162 7:127484363-127484385 GACTCACAGTTGCATGTGGCTGG - Intergenic
1032161650 7:129515507-129515529 GACTCACAGTTCCACGTGGCTGG - Intergenic
1032430424 7:131856574-131856596 GACTCACAGTTCCACATGACTGG - Intergenic
1032440241 7:131937188-131937210 GACCCACAGTTCCACATGGCTGG - Intergenic
1032459670 7:132101394-132101416 GACTCACAGTTCCACGTGGCTGG + Intergenic
1032594583 7:133226736-133226758 GACTCACAGTTCCACGTGGCTGG + Intergenic
1032764193 7:134975269-134975291 GACTCACAGTTCCACATGACTGG - Intergenic
1032958674 7:137003989-137004011 GACCCACAGTTTCACAGGACTGG - Intronic
1033048398 7:137982660-137982682 GACTCACAGTTCCACGTGGCTGG - Intronic
1033224855 7:139553401-139553423 GACTCACAGTTCCACGTGGCTGG - Intergenic
1033270824 7:139931514-139931536 GACTCACAGTTCCACGTGGCTGG + Intronic
1033429996 7:141280554-141280576 GACTCACAGTTCCACGTGGCTGG - Intronic
1033800827 7:144899746-144899768 GACTCACAGTTCCACATGACTGG - Intergenic
1033803362 7:144926956-144926978 GACTCACAGTTCCACGTGGCTGG + Intergenic
1033810345 7:145004314-145004336 GACTCACAGTTCCACATGACTGG - Intergenic
1033815905 7:145072816-145072838 GACTCACAGTTCCACATGACTGG + Intergenic
1033948819 7:146758524-146758546 GACTCACAGTTCCACGTGGCTGG + Intronic
1033949218 7:146762708-146762730 GGCTCACAGTTCCACGTGGCTGG + Intronic
1033958284 7:146879866-146879888 GGCTCACAGTTCCACGTGGCTGG + Intronic
1034134865 7:148757744-148757766 GCTCAACAGTTCCACGTGGCTGG + Intronic
1034435866 7:151062562-151062584 GGCCCAGAGGGGCACGTGACTGG + Intronic
1034516977 7:151588773-151588795 GACTCACAGTTCCACGTGACTGG - Intronic
1034679904 7:152920722-152920744 GACTCACAGTTCCACGTGGCTGG + Intergenic
1034925211 7:155115788-155115810 GACTCACAGTTCCACGTGGCTGG + Intergenic
1035043615 7:155949066-155949088 GCCCCACAGTGACAGGTGGCTGG + Intergenic
1035077935 7:156193342-156193364 GACTCACAGTTCCACATGACTGG + Intergenic
1035132433 7:156668490-156668512 GACCCACAGGTGCAAGTCACTGG - Intronic
1035177130 7:157059432-157059454 GACTCACAGTTACACGTGGCTGG - Intergenic
1035206629 7:157297933-157297955 GCCCCTCAGCTGCAGGTGCCAGG + Intergenic
1035348141 7:158221543-158221565 GACCCACAGTTCCATGTGGCTGG + Intronic
1035796766 8:2364648-2364670 GACTCACAGTTCCACATGACCGG - Intergenic
1035841646 8:2818130-2818152 GACTCACAGTTCCACGTGGCTGG - Intergenic
1035844155 8:2845084-2845106 GACTCACAGTTCCACGTGGCTGG - Intergenic
1036117584 8:5975067-5975089 GACTCACAGTTCCACATGACTGG + Intergenic
1036753009 8:11455089-11455111 GCCCCAGTGCTGCACGTGGCAGG + Intronic
1036771475 8:11581376-11581398 GACTCACAGTTCCACGTGGCTGG + Intergenic
1037011349 8:13846478-13846500 GACTCACAGTTCCATGTGACTGG - Intergenic
1037036047 8:14168613-14168635 GACTCACAGTTCCACGTGGCTGG - Intronic
1037107845 8:15131407-15131429 GACTCACAGTTCCACGTGGCTGG - Intronic
1037141625 8:15526664-15526686 GACTCACAGTTCCACGTAACTGG - Intronic
1037167801 8:15852042-15852064 GACTCACAGTTCCACGTGGCTGG - Intergenic
1037246128 8:16836983-16837005 GACTCACAGTTCCACGTGGCTGG - Intergenic
1037272159 8:17142113-17142135 GACTCACAGTTCCACGTGGCTGG + Intergenic
1037452134 8:19025948-19025970 GACTCACAGTTCCACGTGGCTGG + Intronic
1037494795 8:19428297-19428319 GCCTCACAGTTCCATGTGGCTGG + Intronic
1037595009 8:20347750-20347772 GCCTCACAGTTCCACGTGGCTGG + Intergenic
1037721988 8:21452278-21452300 GCCTCACAGTTTCACATGGCTGG + Intergenic
1037993621 8:23338007-23338029 GCTCAACAGTTTCACGTGACTGG + Intronic
1038018755 8:23535697-23535719 GACCCACAGTTCCACGTGGCTGG + Intronic
1038094517 8:24293044-24293066 GCCTCACAGTTTCACATGGCTGG + Intergenic
1038274423 8:26108515-26108537 GACTCACAGTTCCACGTGGCTGG - Intergenic
1038320345 8:26520205-26520227 GACTCACAGTTGCACATGGCTGG - Intronic
1038678792 8:29647701-29647723 GACTTACAGTTCCACGTGACTGG + Intergenic
1038735056 8:30161257-30161279 GACTCACAGTTCCACATGACTGG - Intronic
1038740370 8:30211780-30211802 GACTCACAGTTCCACATGACTGG + Intergenic
1039000388 8:32973270-32973292 GACTCACAGTTCCACATGACTGG - Intergenic
1039044615 8:33438673-33438695 GACCCACAGTTACACATGGCTGG + Intronic
1039392520 8:37192903-37192925 GACTCACAGTTCCACGTGGCTGG - Intergenic
1039426218 8:37488374-37488396 GACTCACAGTTCCACATGACTGG - Intergenic
1039547248 8:38419088-38419110 GACTCACAGTTCCACGTGGCTGG - Intronic
1039681020 8:39736495-39736517 GACTCACAGTTCCACGTGGCTGG - Intergenic
1039790818 8:40874270-40874292 TCTCCACAGCTGGACGTGACGGG - Intronic
1039858685 8:41437919-41437941 GACCCACAGTTCCACGTGGCTGG - Intergenic
1040577122 8:48662485-48662507 GACCCACAGTTCCACGTAACTGG + Intergenic
1041894356 8:62906770-62906792 GACTCACAGTTGCACATGGCTGG - Intronic
1042606485 8:70551758-70551780 GACTCACAGTTCCACGTGGCTGG + Intergenic
1043088089 8:75862063-75862085 GACTCACAGTTCCACGTGGCTGG - Intergenic
1043088587 8:75869451-75869473 GACTTACAGTTCCACGTGACTGG + Intergenic
1043355979 8:79413194-79413216 GACTCACAGTTCCACGTGGCTGG - Intergenic
1043379599 8:79688557-79688579 GACTCACAGTTCCACGTGGCTGG + Intergenic
1043801030 8:84609829-84609851 GACTCACAGTTCCACGTGGCTGG + Intronic
1043806026 8:84672596-84672618 GACTCACAGTTCCACATGACTGG + Intronic
1044045874 8:87431196-87431218 GACTCACAGTTCCACGTGGCTGG - Intronic
1044155143 8:88837195-88837217 GACTCACAGTTCCACGTGGCTGG + Intergenic
1044565830 8:93660473-93660495 GACTCACAGTTCCACGTGGCAGG - Intergenic
1045194104 8:99912363-99912385 GACTCACAGTTCCACGTGGCTGG - Intergenic
1045864017 8:106844514-106844536 GACTCACAGTTCCACGTGGCTGG - Intergenic
1046038557 8:108874537-108874559 GACTCACAGTTTCACGTGGCTGG + Intergenic
1046159447 8:110341477-110341499 GACTCACAGTTTCACATGACAGG + Intergenic
1046365668 8:113227751-113227773 GACTCACAGTTCCACATGACTGG - Intronic
1046717892 8:117587056-117587078 GGCTCACAGTTCCACGTGGCTGG - Intergenic
1046779490 8:118200154-118200176 GACTCACAGTTCCACGTGGCTGG - Intronic
1046839666 8:118842404-118842426 GACTCACAGTTTCACGTGGCTGG - Intergenic
1046917292 8:119691239-119691261 GACTCACAGTTGCACATGGCTGG - Intergenic
1047310583 8:123688360-123688382 GACTCACAGTTCCACGTGCCTGG - Intronic
1047389207 8:124436532-124436554 GACTCACAGTTCCACGTGGCTGG - Intergenic
1047487851 8:125348763-125348785 GACTCACAGTTCCACGTGGCTGG - Intronic
1047535224 8:125713262-125713284 GACTCACAGTTCCACGTGGCTGG - Intergenic
1047613157 8:126540391-126540413 GACTCACAGTTCCACATGACTGG - Intergenic
1047650278 8:126913005-126913027 GACTCACAGTTCCACGTGGCTGG - Intergenic
1047823976 8:128553068-128553090 GACTCACAGTTCCACGTGACTGG + Intergenic
1047895886 8:129365780-129365802 GACTCACAGTTTCACGTGGCTGG - Intergenic
1048030606 8:130628090-130628112 GACACACAGTTCCACGTGGCTGG - Intergenic
1048077877 8:131093459-131093481 GACTCACAGTTGCACATGGCTGG + Intergenic
1048210607 8:132451276-132451298 GACTCACAGTTCCACGTGGCTGG - Intronic
1048373273 8:133799019-133799041 GATTCACAGTTCCACGTGACTGG - Intergenic
1048542610 8:135355985-135356007 GACTCACAGTTCCACGTGGCTGG - Intergenic
1048551940 8:135441655-135441677 GACTCACAGTTCCACGTGACTGG + Intergenic
1048622880 8:136153811-136153833 GACTCACAGTTCCACATGACTGG - Intergenic
1048642282 8:136377202-136377224 GACCCACAGTTCCACCTGGCTGG + Intergenic
1048652507 8:136494768-136494790 GACTCACAGTTCCACATGACTGG + Intergenic
1048905291 8:139081970-139081992 GACTCACAGTTCCACGTGGCTGG + Intergenic
1049005571 8:139853434-139853456 GCCCCACAGGTGGAAGGGACTGG + Intronic
1049296261 8:141841291-141841313 GCCTCACAGTTCCACATGGCTGG - Intergenic
1050644499 9:7704229-7704251 GACTCACAGTTCCACGTGGCTGG + Intergenic
1050691884 9:8236581-8236603 GACTCACAGTTCCACGTGGCTGG - Intergenic
1051658095 9:19401684-19401706 GACCCACAGTTCCACATGGCTGG - Intergenic
1051979623 9:22998234-22998256 GACCCACAGTTCCACATGGCTGG + Intergenic
1052181511 9:25534123-25534145 GACTCACAGTTCCACATGACTGG - Intergenic
1052187622 9:25619047-25619069 GACTCACAGTTCCACATGACTGG + Intergenic
1052187907 9:25621045-25621067 GACTCACAGTTTCACATGACTGG + Intergenic
1052271673 9:26634176-26634198 GACTCACAGTTCCACGTGGCTGG + Intergenic
1052608724 9:30740477-30740499 GACTCACAGTTCCACGTGGCTGG - Intergenic
1052686380 9:31763527-31763549 GACTCACAGTTGCACATGGCTGG + Intergenic
1052716683 9:32126562-32126584 GACTCACAGTTCCACGTGGCTGG + Intergenic
1053811612 9:41858482-41858504 GACACACAGTTCCACGTGGCTGG - Intergenic
1054618982 9:67328957-67328979 GACACACAGTTCCACGTGGCTGG + Intergenic
1055006028 9:71507789-71507811 GACTCACAGTTCCACGTGGCTGG - Intergenic
1055083286 9:72289406-72289428 GACTTACAGTTGCACGTGCCTGG + Intergenic
1055252166 9:74320726-74320748 GACTCACAGTTCCACGTGGCTGG - Intergenic
1055910161 9:81341519-81341541 GACTCACAGTTCCACGTGGCTGG + Intergenic
1055931200 9:81561295-81561317 GACTCACAGTTCCACGTGGCTGG - Intergenic
1056040896 9:82665874-82665896 GACTCACAGTTTCACGTGGCTGG - Intergenic
1056074674 9:83026390-83026412 GACTCACAGTTCCACATGACTGG + Intronic
1056092400 9:83217665-83217687 GACTCACAGTTCCACGTGGCTGG - Intergenic
1056238663 9:84621377-84621399 GACCTACAGTTCCACGTGGCTGG - Intergenic
1056588734 9:87947430-87947452 GACTCACAGTTCCACATGACTGG - Intergenic
1057975836 9:99605183-99605205 GCCCCAGAGGTCCACGTGCCTGG - Intergenic
1058047972 9:100377274-100377296 GACTCACAGTTCCACGTGGCTGG - Intergenic
1058194794 9:101959273-101959295 GCTTCACAGTTCCACGTGGCTGG + Intergenic
1058329465 9:103741017-103741039 GACTCACAGTTTCACGTGGCCGG + Intergenic
1058583832 9:106485851-106485873 GACTCACAGTTCCACGTGGCTGG - Intergenic
1058783358 9:108361914-108361936 GGCTCACAGTTTCACCTGACTGG + Intergenic
1058929053 9:109700415-109700437 GACTCACAGTTCCACATGACTGG - Intronic
1059363513 9:113767019-113767041 GACTCACAGTTCCACGTGGCTGG - Intergenic
1059462637 9:114443856-114443878 GACTCACAGTTCCACGTGGCTGG + Intronic
1059497290 9:114720278-114720300 GCAACACAGCTGCACTTGACTGG + Intergenic
1059549736 9:115216910-115216932 GACTCACAGTTCCACGTGGCTGG - Intronic
1059826066 9:118030314-118030336 GACCCACAGTTCCACATGGCTGG + Intergenic
1060711500 9:125869972-125869994 GACTCACAGTTCCACGTGTCTGG + Intronic
1060967221 9:127718005-127718027 GCTCAACAGTTCCACGTGGCTGG - Intronic
1061363875 9:130160375-130160397 GACTCACAGTTTCATGTGACTGG + Intergenic
1061801522 9:133115622-133115644 CCCCCACTGTTGCCTGTGACAGG - Intronic
1062127676 9:134872542-134872564 GACTCACAGTTCCACGTGGCTGG + Intergenic
1062223293 9:135432515-135432537 GACTCACAGTTCCACGTGGCTGG + Intergenic
1062251507 9:135598020-135598042 GACTCACAGTTCCACGTGGCTGG - Intergenic
1062632730 9:137472981-137473003 GACTCACAGTTCCACGTGGCTGG + Intronic
1203437648 Un_GL000195v1:156295-156317 GCCTCACAGTTTCACATGGCTGG + Intergenic
1185674337 X:1836776-1836798 GACTCACAGTTCCACGTGGCTGG + Intergenic
1185740312 X:2526678-2526700 GACTCGCAGTTCCACGTGACGGG - Intergenic
1185973653 X:4693910-4693932 GACTCACAGTTCCACGTGGCTGG + Intergenic
1185974277 X:4701598-4701620 GACTCACAGTTCCACGTGGCTGG - Intergenic
1185997969 X:4974018-4974040 GACTCACAGTTGCACATGGCTGG - Intergenic
1186006381 X:5076877-5076899 GACTCACAGTTCCACGTGGCTGG - Intergenic
1186117585 X:6321234-6321256 GACTCACAGTTCCACATGACTGG + Intergenic
1186167299 X:6840259-6840281 GACTCACAGTTCCACGTGGCTGG - Intergenic
1186172520 X:6892384-6892406 GACTCACAGTTCCACGTGGCTGG + Intergenic
1186191061 X:7068014-7068036 GACTCACAGTTCCACATGACTGG - Intronic
1186196062 X:7111191-7111213 GACCCACAGTTCCACATGGCTGG - Intronic
1186197628 X:7125682-7125704 GACTCACAGTTCCACGTGGCTGG + Intronic
1186233691 X:7484192-7484214 GACTCACAGTTCCACGTGGCTGG + Intergenic
1186241896 X:7577168-7577190 GACGCACAGTTCCACGTGGCTGG - Intergenic
1186262201 X:7791576-7791598 GACTCACAGTTCCACATGACTGG + Intergenic
1186289384 X:8080105-8080127 GACTCACAGTTCCACATGACTGG - Intergenic
1186364103 X:8873673-8873695 GACTCACAGTTCCACGTGGCTGG - Intergenic
1186751778 X:12628888-12628910 GCCTCACAGTTCCACATGGCTGG + Intronic
1186894949 X:13996393-13996415 GACCTACAGTTCCACGTGGCTGG + Intergenic
1187052477 X:15708293-15708315 GACTCACAGTTCCACGTGGCTGG - Intronic
1187110130 X:16289688-16289710 GACTCACAGTTCCACGTGGCTGG + Intergenic
1187277246 X:17826887-17826909 GACTCACAGTTCCACATGACTGG - Intronic
1187298898 X:18029161-18029183 GACTTACAGTTCCACGTGACTGG - Intergenic
1187388634 X:18871461-18871483 GACTCACAGTTCCACGTGGCTGG - Intergenic
1188062613 X:25619133-25619155 GACTCACAGTTCCACATGACTGG + Intergenic
1188103904 X:26125171-26125193 GACTCACAGTTCCACGTGGCTGG + Intergenic
1188162233 X:26818495-26818517 GACTCACAGTTCCACATGACTGG - Intergenic
1188261094 X:28024981-28025003 GACTCACAGTTCCACGTGGCTGG - Intergenic
1188403064 X:29771841-29771863 GACTCACAGTTCCACGTGCCTGG + Intronic
1188520494 X:31033017-31033039 GACTCACAGTTCCACGTGGCTGG + Intergenic
1189050470 X:37640232-37640254 GACTCACAGTTGCACATGGCTGG + Intronic
1189228529 X:39433779-39433801 GACTCACAGTTCCACGTGGCTGG + Intergenic
1189257741 X:39653484-39653506 GCCCCAAAGTTGCCCTAGACAGG - Intergenic
1189403368 X:40693511-40693533 GACTCACAGTTCCATGTGACTGG - Intronic
1189423600 X:40879257-40879279 GACCCACAGTTCCACATGGCTGG + Intergenic
1189537803 X:41954721-41954743 GACTCACAGTTCCACATGACTGG + Intergenic
1190528491 X:51351610-51351632 GACTCACAGTTCCACATGACTGG + Intergenic
1190974401 X:55385599-55385621 GACTCACAGTTGCACATGGCTGG - Intergenic
1191688076 X:63913098-63913120 GACTCACAGTTCCACGTGGCTGG - Intergenic
1191985929 X:66981516-66981538 GACTCACAGTTTCACATGACTGG + Intergenic
1192394761 X:70768493-70768515 GACTCACAGTTCCACATGACTGG + Intronic
1192417193 X:70992368-70992390 GACTCACAGTTCCACGTGGCTGG + Intergenic
1193183392 X:78484390-78484412 GACTCACAGTTCCACGTGGCTGG + Intergenic
1193289416 X:79754088-79754110 GACTCACAGTTTCACGTGGCTGG + Intergenic
1193460148 X:81781390-81781412 GCCTCACAGTTCCACATGGCTGG + Intergenic
1193690033 X:84630503-84630525 GACTCATAGTTGCACGTGGCTGG + Intergenic
1193865175 X:86721769-86721791 GACTCACAGTTCCACATGACTGG + Intronic
1193938347 X:87650799-87650821 GACTCACAGTTCCACGTGGCTGG + Intronic
1194034399 X:88853334-88853356 GACTCACAGTTGCACATGGCTGG - Intergenic
1194036284 X:88876267-88876289 GACTCACAGTTCCACGTGGCTGG - Intergenic
1194127211 X:90034393-90034415 GACCCACAGTTCCACATGGCTGG - Intergenic
1194194253 X:90871626-90871648 GCCTTACAGTTCCACATGACTGG - Intergenic
1194389750 X:93301078-93301100 GGCTCACAGTTGCATGTGGCTGG - Intergenic
1194503597 X:94707000-94707022 GGCTCACAGTTCCACGTGGCTGG + Intergenic
1194518981 X:94894972-94894994 GACTTACAGTTCCACGTGACTGG - Intergenic
1194744515 X:97613753-97613775 GCTCCATAGCTGCACGTGGCTGG + Intergenic
1194755202 X:97731333-97731355 GACTCACAGTTCCACGTGGCTGG + Intergenic
1194778045 X:97990398-97990420 GACTCACAGTTCCACATGACTGG + Intergenic
1194838828 X:98714346-98714368 GACCCACAGTTCCATGTGGCTGG - Intergenic
1195629745 X:107042690-107042712 GACTCACAGTTCCACGTGGCTGG + Intergenic
1195838978 X:109151088-109151110 GACTCACAGTTTCACATGACTGG - Intergenic
1196025385 X:111036394-111036416 GACTCACAGTTCCACGTGGCTGG + Intronic
1196207486 X:112957279-112957301 GACTCACAGTTCCACGTGGCTGG - Intergenic
1196483507 X:116178922-116178944 GACTTACAGTTGCATGTGACTGG - Intergenic
1197072164 X:122312826-122312848 GACTCACAGTTCCACGTGCCTGG - Intergenic
1197074862 X:122341975-122341997 GGCTCACAGTTGCACATGGCTGG + Intergenic
1197088768 X:122511203-122511225 GACTCACAGTTCCACATGACTGG + Intergenic
1197249288 X:124198206-124198228 GACTCACAGTTCCACGTGCCTGG + Intronic
1197314033 X:124941839-124941861 GACTCACAGTTCCACGTGGCTGG + Intronic
1197341202 X:125267703-125267725 GACTCACAGTTACACGTGGCTGG + Intergenic
1197371810 X:125636062-125636084 GACTCACAGTTACACATGACTGG - Intergenic
1197392279 X:125882669-125882691 GACTCACAGTTCCACATGACTGG - Intergenic
1197411002 X:126116255-126116277 GACTCACAGTTCCACATGACTGG - Intergenic
1197442699 X:126511012-126511034 GACTCACAGTTCCACGTGGCTGG + Intergenic
1198083646 X:133263100-133263122 GACTCACAGTTCCACGTGGCTGG + Intergenic
1198496997 X:137203208-137203230 GACTCACAGTTTCACGTGGCTGG + Intergenic
1198660971 X:138967024-138967046 GACTCACAGTTCCACGTGCCTGG - Intronic
1198662915 X:138990501-138990523 GACTCACAGTTCCACGTGGCTGG + Intronic
1198852663 X:140982117-140982139 GCCTCACAGTTCCACATGGCTGG + Intergenic
1199058754 X:143328637-143328659 GACTCACAGTTGCACATGGCTGG - Intergenic
1199071060 X:143476149-143476171 GACTCACAGTTCCACGTGGCTGG - Intergenic
1199176209 X:144790790-144790812 GACTCACAGTTCCACGTGGCTGG + Intergenic
1199218162 X:145284889-145284911 GACTTACAGTTGCACGTGGCTGG - Intergenic
1199235593 X:145488721-145488743 GGCTCACAGTTCCACATGACTGG + Intergenic
1199277984 X:145969025-145969047 GACCTACAGTTCCACGTGGCTGG - Intergenic
1199301570 X:146220157-146220179 GCCTCACAGTTCCACATGGCTGG + Intergenic
1199307556 X:146284714-146284736 GACTCACAGTTCCACGTGGCTGG - Intergenic
1199476618 X:148253669-148253691 GACTCACAGTTCCACGTGTCTGG - Intergenic
1200035773 X:153328856-153328878 GACTCACAGTTCCACGTGACCGG + Intergenic
1200258277 X:154597457-154597479 GACTCACAGTTCCACGTGGCTGG - Intergenic
1200319795 X:155175730-155175752 GACTCACAGTTCCACGTGGCTGG - Intergenic
1200332137 X:155309565-155309587 GACTCACAGTTCCACGTGGCTGG + Intronic
1200540864 Y:4454018-4454040 GCCTTACAGTTCCACATGACTGG - Intergenic
1201276345 Y:12302459-12302481 GACTTACAGTTCCACGTGACTGG - Intergenic
1201471167 Y:14336332-14336354 GACCCACAGTCCCACGTGGCTGG - Intergenic