ID: 1173581268

View in Genome Browser
Species Human (GRCh38)
Location 20:44148539-44148561
Sequence TCCAGGACGTTGTCAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173581268_1173581274 0 Left 1173581268 20:44148539-44148561 CCACCTGCTGACAACGTCCTGGA 0: 1
1: 0
2: 1
3: 3
4: 109
Right 1173581274 20:44148562-44148584 TGCAGAAAGGGGAAATGTGTTGG No data
1173581268_1173581275 1 Left 1173581268 20:44148539-44148561 CCACCTGCTGACAACGTCCTGGA 0: 1
1: 0
2: 1
3: 3
4: 109
Right 1173581275 20:44148563-44148585 GCAGAAAGGGGAAATGTGTTGGG 0: 1
1: 0
2: 3
3: 33
4: 338
1173581268_1173581277 27 Left 1173581268 20:44148539-44148561 CCACCTGCTGACAACGTCCTGGA 0: 1
1: 0
2: 1
3: 3
4: 109
Right 1173581277 20:44148589-44148611 AGGCGACCCGAGCTGCCGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 50
1173581268_1173581276 7 Left 1173581268 20:44148539-44148561 CCACCTGCTGACAACGTCCTGGA 0: 1
1: 0
2: 1
3: 3
4: 109
Right 1173581276 20:44148569-44148591 AGGGGAAATGTGTTGGGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173581268 Original CRISPR TCCAGGACGTTGTCAGCAGG TGG (reversed) Intronic
902632644 1:17714549-17714571 TCCAGGACTTCTTGAGCAGGCGG + Intergenic
903857467 1:26345441-26345463 GGCAGGACGGTGGCAGCAGGGGG + Exonic
905029529 1:34872344-34872366 TGCAGCAGGTTGTCAGGAGGTGG + Intronic
906802062 1:48746605-48746627 TCCAGGACATTGTCTACAGAAGG + Intronic
909221984 1:72976409-72976431 TCCAGGACATTGGAAGCAAGCGG + Intergenic
909823697 1:80098552-80098574 TGCATGACGTTGACAGGAGGTGG + Intergenic
914828724 1:151155148-151155170 TACAGGACGTTCTCAGGAAGTGG - Intergenic
922810226 1:228411194-228411216 CCCAGCATGTTGCCAGCAGGTGG + Intronic
923790368 1:237106318-237106340 TGCAGCACGGTGGCAGCAGGGGG + Intronic
1063771218 10:9204032-9204054 TCAAGGAAGTTTTCAGTAGGGGG + Intergenic
1065700388 10:28419726-28419748 TCTTGGAGGATGTCAGCAGGTGG - Intergenic
1067543696 10:47176444-47176466 TCCAGGACCGTATCAGTAGGAGG - Intergenic
1069826553 10:71258346-71258368 TCCTGGACTTGGCCAGCAGGTGG - Intronic
1069977749 10:72228616-72228638 TCCAGAACGGAGTCAGCTGGGGG - Intronic
1071759475 10:88583958-88583980 TCCAGTACAATGTCAGGAGGGGG - Intronic
1074455344 10:113590963-113590985 CCCAGGGCATTCTCAGCAGGAGG + Intronic
1075709922 10:124525514-124525536 TTCTGGACATTGTCAGCATGTGG + Intronic
1075712099 10:124536287-124536309 TCCTGGCAGTAGTCAGCAGGAGG + Intronic
1076866350 10:133168174-133168196 TCCAGGCCCTTCTCAGCTGGCGG + Intronic
1077060127 11:614249-614271 CCCATGACGCTGTCAGCAGATGG + Exonic
1077148013 11:1054467-1054489 TCCTGGAAGATGCCAGCAGGAGG + Intergenic
1077394341 11:2313745-2313767 TCCAGGACGTGGTGAGCGTGGGG + Exonic
1082113086 11:48298660-48298682 GCCAGGATGTTGCCAGCAGTGGG + Intergenic
1089564058 11:119361592-119361614 CCCATGAGGTTGTCAGCTGGGGG + Intronic
1090962916 11:131573062-131573084 TCCAGGGCCTTGTCAAGAGGAGG - Intronic
1092058204 12:5524302-5524324 TCCAGGACCTTCTCAGCCGGCGG - Intergenic
1092961308 12:13598932-13598954 TCCAGGAGGAAGTCAGGAGGAGG - Intronic
1097291721 12:57922264-57922286 TCCAGGACGTTGAGACCAGCTGG + Intergenic
1101245493 12:102880376-102880398 TCCAGGACATTGCCACCAAGGGG + Intronic
1103545349 12:121697270-121697292 TTCAAGATGTTGCCAGCAGGTGG + Intergenic
1104113724 12:125728473-125728495 TCTAGGACATTCACAGCAGGAGG + Intergenic
1107080478 13:36369484-36369506 TCCAGGCAGTCGTCAGCAGCTGG - Intronic
1112386890 13:98948093-98948115 TCCAGGCCTTTGTAAGCAGCAGG + Intronic
1121010789 14:90518961-90518983 TCCAGGAAGCTGTCTGCAGCAGG + Intergenic
1122231496 14:100308257-100308279 TCCAGTACCTTGACAGCATGTGG + Intergenic
1122364032 14:101183695-101183717 CCCAGGAGGCTGTCAGCAGCTGG + Intergenic
1122416982 14:101554758-101554780 TGCAGGACCTTCTGAGCAGGTGG - Intergenic
1124608709 15:31193051-31193073 ACCAGCACGTGGTCAGGAGGAGG + Intergenic
1125517797 15:40332463-40332485 TCCAGAAGGATGTCAGGAGGAGG - Intronic
1126496934 15:49301776-49301798 ACCAGCACTTTGTCAGCATGTGG - Intronic
1129251489 15:74311469-74311491 TCCTGGTCGTTTTCAGCTGGAGG - Intronic
1132238439 15:100239283-100239305 ACCATGACGTTCTCAGCAGATGG + Intronic
1132330565 15:101009450-101009472 TGCAGGACTCTGGCAGCAGGTGG + Intronic
1132992553 16:2804397-2804419 TCCCGGAGGTTGTAAGGAGGTGG - Intergenic
1134053269 16:11152507-11152529 TCCAGGACATTGACATCTGGTGG + Intronic
1134121611 16:11587915-11587937 TCCAGGTCTTTGCCAGCATGGGG - Intronic
1136382487 16:29901932-29901954 GCAAGGAGGTTGTCAGTAGGCGG - Intronic
1137539116 16:49349914-49349936 TCCCTGACCTTGTCTGCAGGTGG + Intergenic
1141463455 16:84191705-84191727 CCCAGGACGTGGGGAGCAGGGGG + Intronic
1143475814 17:7203450-7203472 TCCATGACCTTCTCAGCCGGGGG + Exonic
1145296539 17:21597576-21597598 CCCAGGATCTTGTCAGCAAGAGG - Intergenic
1145367242 17:22274496-22274518 CCCAGGATCTTGTCAGCAAGAGG + Intergenic
1153979390 18:10296427-10296449 CTCAGGACGGTGTCAGCAGCAGG - Intergenic
1155389262 18:25316411-25316433 TCCAGCACTTTGTCAGCCAGGGG + Intronic
1156377255 18:36525811-36525833 TCCTGGACATTGTCAACAGTTGG - Intronic
1158803560 18:60943005-60943027 TCCAAGAGGTTCTCAGGAGGAGG + Intergenic
1163459677 19:17429527-17429549 TCCACGAAGTTGTCACCAAGGGG + Intronic
1163690999 19:18738453-18738475 TCCAGGACGGTCTCATCTGGAGG - Intronic
1164674704 19:30093390-30093412 TCCAGGCCCTTGCGAGCAGGTGG + Intergenic
1166539115 19:43594012-43594034 TCCAGGAGGTAGCCAGCAAGTGG + Intronic
926180081 2:10634733-10634755 TCTAGGACGTTATCAGCAGGAGG + Intronic
928422737 2:31151698-31151720 TCAAGGACATTGCCATCAGGTGG + Intronic
929362274 2:41107205-41107227 TTCAGTACTTTGTCAGCAGGTGG - Intergenic
929791185 2:45024297-45024319 TCCAGGACCATGCCAGGAGGAGG - Intergenic
931434700 2:62236323-62236345 TCCAGGAATGTGACAGCAGGGGG - Intergenic
932338936 2:70947630-70947652 CCCTGGCCATTGTCAGCAGGAGG + Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
948587246 2:239027163-239027185 TCCTGGAAGTTGTCAGCAACAGG + Intergenic
949025305 2:241765041-241765063 GCCAGGACTTTGTCTGCAGTGGG + Intronic
1173226819 20:41167011-41167033 ACCAGGAGGGTGTCTGCAGGAGG + Intronic
1173581268 20:44148539-44148561 TCCAGGACGTTGTCAGCAGGTGG - Intronic
1175846871 20:62064370-62064392 TCCAGGAAGTTCTCCGCTGGTGG - Intronic
1176058491 20:63161341-63161363 TACAGGACGTGGTCAGCGGCTGG - Intergenic
1180696459 22:17754252-17754274 TCCAGGACTTTGCCAGACGGGGG + Intronic
1182715929 22:32356282-32356304 TCCAGGAAGTAGTCAGCAATTGG + Intronic
950649601 3:14398982-14399004 TCCAGGACATTGTAGACAGGGGG + Intergenic
951132906 3:19069205-19069227 TCCAGGAAGATGTCTGCAGCAGG + Intergenic
952615805 3:35272580-35272602 TCCAAGACTTTTTGAGCAGGTGG - Intergenic
963038095 3:141049785-141049807 TCCAGGAGCTTGTCAATAGGAGG + Intergenic
974378679 4:61109473-61109495 TCCAGGAGGGTGGGAGCAGGAGG - Intergenic
976986622 4:91308454-91308476 TTAAGGACATTGTCAGCAAGCGG + Intronic
977147192 4:93458585-93458607 TCCAGGATGTTCTCTGCAAGAGG - Intronic
983408827 4:167370232-167370254 TCCAGGACCTTGTTAGGGGGCGG - Intergenic
985120533 4:186636604-186636626 TCCAAGAGGTTTTCAGCAGCTGG - Exonic
992078691 5:73214912-73214934 TCCAGGATGTTTTCAACATGAGG + Intergenic
994525478 5:100901071-100901093 TCCTGGACGTTGCCGGCTGGTGG - Intronic
1001713469 5:173795807-173795829 TCCAGGGTGTTGACAGGAGGAGG + Intergenic
1004876328 6:19958495-19958517 TTCAGGAGTTTGTCAGCAGAAGG - Intergenic
1004917321 6:20344075-20344097 TCCAGGACGTGGCCATTAGGTGG - Intergenic
1008384481 6:50872796-50872818 TCTAGGACTTTATGAGCAGGAGG + Intergenic
1015813133 6:137180852-137180874 TCCAGGACATTGTGTACAGGGGG - Intergenic
1019074419 6:169376577-169376599 ACCAGGAGGTTGACAGAAGGCGG - Intergenic
1021694801 7:23266519-23266541 TCCAGGGGGTTGTCACCAGCAGG - Exonic
1023878844 7:44307329-44307351 GGGAGGAAGTTGTCAGCAGGGGG + Intronic
1023878849 7:44307349-44307371 GGGAGGAAGTTGTCAGCAGGGGG + Intronic
1026052849 7:66961361-66961383 CCCAGGGGGTGGTCAGCAGGAGG + Intergenic
1029049282 7:97667381-97667403 TCCAGGACTTTGTATGCAGAGGG - Intergenic
1029736178 7:102467232-102467254 TCCAGGAGGCTTCCAGCAGGTGG + Intronic
1030743501 7:113137767-113137789 TACAGGAAATTGTAAGCAGGAGG + Intergenic
1037473963 8:19237954-19237976 CCTAGGACGCTGACAGCAGGCGG - Intergenic
1037974305 8:23199223-23199245 TCCAAGACCTTGTAGGCAGGGGG - Intronic
1038015368 8:23510120-23510142 TCCAGGAGGCTGTCAGCAGATGG + Intergenic
1043036806 8:75209060-75209082 TCCAAGAAGTTATCAACAGGGGG - Intergenic
1049200140 8:141336091-141336113 TCCAGATCCTTGTCAACAGGAGG - Intergenic
1052510027 9:29404822-29404844 TCAAGGACTCTGTCAGCTGGAGG - Intergenic
1053606518 9:39665896-39665918 TACAGGAAGTTGTAACCAGGAGG - Intergenic
1053864440 9:42422514-42422536 TACAGGAAGTTGTAACCAGGAGG - Intergenic
1054247023 9:62676527-62676549 TACAGGAAGTTGTAACCAGGAGG + Intergenic
1054842536 9:69759437-69759459 TCCCGGACGTTGGCAAGAGGGGG - Intronic
1056006010 9:82272000-82272022 TCCAGGACTTTGCCAGAAGTGGG - Intergenic
1061972629 9:134053186-134053208 TCCAGGATGGGGGCAGCAGGAGG + Intronic
1062191330 9:135249366-135249388 ACAAGGACGTTGTCCGAAGGTGG - Intergenic
1197706415 X:129637675-129637697 TCCAGGACTCAGCCAGCAGGGGG + Intergenic
1198995791 X:142572073-142572095 TTCTGGATGTTTTCAGCAGGTGG - Intergenic