ID: 1173581866

View in Genome Browser
Species Human (GRCh38)
Location 20:44152675-44152697
Sequence ACAGGTCACCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173581866_1173581877 6 Left 1173581866 20:44152675-44152697 CCCTCTTCCCTCTGGTGACCTGT 0: 1
1: 0
2: 5
3: 28
4: 317
Right 1173581877 20:44152704-44152726 CATGGTGTGGAAATGAGTGTTGG 0: 1
1: 0
2: 2
3: 17
4: 221
1173581866_1173581871 -7 Left 1173581866 20:44152675-44152697 CCCTCTTCCCTCTGGTGACCTGT 0: 1
1: 0
2: 5
3: 28
4: 317
Right 1173581871 20:44152691-44152713 GACCTGTGTCCCCCATGGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173581866 Original CRISPR ACAGGTCACCAGAGGGAAGA GGG (reversed) Intronic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
901131020 1:6962635-6962657 GCAGGTCCACAGAGGAAAGAGGG - Intronic
901143588 1:7051083-7051105 CCAGATCACCAGAGGGACGTGGG - Intronic
901493029 1:9606241-9606263 ACAGGTCAGCAGGCGGAACAAGG + Intronic
901817727 1:11804506-11804528 ACAGGCCAACAGAGGGCATAGGG + Intronic
902348316 1:15835321-15835343 TCAGGCCACCAAAGTGAAGATGG + Intergenic
904909226 1:33921656-33921678 ACAGGCCCTCAGAGGCAAGAAGG + Intronic
905810913 1:40912502-40912524 AGAGTTCACCAGAGTGAGGAGGG + Intergenic
906684625 1:47755551-47755573 ACAGGTGACCTGACGGAACAAGG - Intergenic
906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG + Exonic
907190523 1:52644369-52644391 ACTGGGCACCACAGGGAATAAGG + Intronic
908558581 1:65282574-65282596 ACCTGTCACCAGAAGGAGGAGGG + Intronic
908768125 1:67572400-67572422 ACAGGAGAGCAGAGGGAAGGAGG + Intergenic
909023098 1:70453402-70453424 GCAGGTGAAAAGAGGGAAGAAGG + Intergenic
909081570 1:71118669-71118691 CCAGGTCAGCAGTGGGATGAGGG + Intergenic
912626111 1:111205307-111205329 AGAGGTAGGCAGAGGGAAGAAGG + Intronic
912681936 1:111734310-111734332 AAAGGTGGTCAGAGGGAAGAGGG - Intronic
914419670 1:147517842-147517864 GCAGGACACCAGAGGGCAGCGGG + Intergenic
915822675 1:159042102-159042124 GCTGGACACCAGAGGGAAAATGG - Intronic
916056453 1:161071996-161072018 AGAGGCCACCAGAGGGCAGAGGG + Exonic
916147119 1:161749934-161749956 CCAGATCACCTGAGGGAAGCGGG + Exonic
916687103 1:167157433-167157455 ACAGGGCCTCAGTGGGAAGAGGG + Intergenic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
917580979 1:176377550-176377572 ACAGGGTAACAGAGGGAAAAAGG - Intergenic
917683736 1:177394806-177394828 AAAGGTTACCAGAGGGAGGTAGG + Intergenic
918188015 1:182144612-182144634 ACAGCTCAGCACAGGGAAGGGGG - Intergenic
918424385 1:184393299-184393321 ACAGGGGCCCTGAGGGAAGAAGG - Intronic
918434870 1:184500918-184500940 GCAAGTCTCAAGAGGGAAGAAGG - Intronic
919660145 1:200236262-200236284 AAAGGGCACCAGAGGTAAGGTGG - Intergenic
920356641 1:205378189-205378211 ACAGGTCACCAGAAAGATCAAGG - Intergenic
920719563 1:208374640-208374662 ACAGGTCTCCAGAGGGACAATGG - Intergenic
921799527 1:219386092-219386114 ACTGGGCAACAGAGGGGAGACGG + Intergenic
922532027 1:226351960-226351982 AGAAGTCATCAAAGGGAAGAGGG - Intergenic
922604290 1:226879693-226879715 TCAGGTCACAAGAAGTAAGAGGG - Intronic
922966913 1:229698018-229698040 TCAGGTCACCAGAAAGAACAAGG - Intergenic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
923251663 1:232184153-232184175 ACAGATAGACAGAGGGAAGAGGG + Intergenic
923886198 1:238159366-238159388 ACAGGCAACCAAAGGAAAGATGG - Intergenic
924703772 1:246481195-246481217 ACAGATCTGCAGAAGGAAGATGG - Intronic
1062885290 10:1011397-1011419 ACAGCTCAGCTGAGAGAAGAAGG - Intronic
1063368057 10:5503188-5503210 ACAGGTCCCCAGAGGCAGGAAGG + Intergenic
1063563199 10:7148290-7148312 TGAGAGCACCAGAGGGAAGAAGG - Intergenic
1064909399 10:20383974-20383996 CCAGGACACCAGAGGGACCAAGG + Intergenic
1067030556 10:42876719-42876741 ACAGGTCACTAGTGGGGAGCTGG - Intergenic
1067048128 10:42997357-42997379 ACATGTGATCAGAGGGAAGCTGG - Intergenic
1068136838 10:52957406-52957428 ACAGGTCATCAGAGAGCAGCAGG - Intergenic
1068428504 10:56900091-56900113 TCATGTCAGCAGAGGAAAGATGG - Intergenic
1068650316 10:59515306-59515328 AAAAGGCACCAGAGAGAAGAAGG + Intergenic
1069650629 10:70044779-70044801 GCAAGTTTCCAGAGGGAAGAAGG + Intergenic
1070219891 10:74430356-74430378 ATAGGTGAACAGAGGGAAGTGGG - Intronic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1070915954 10:80154824-80154846 CCAGGTCCCAGGAGGGAAGAAGG - Exonic
1072520084 10:96223559-96223581 ACAGGAAACCCCAGGGAAGAAGG + Intronic
1073116438 10:101094327-101094349 AGAGGTCACCAAAGAGAAGGAGG + Intronic
1073911276 10:108347791-108347813 AGAGGTTACTAGAGGCAAGAGGG + Intergenic
1074820462 10:117174579-117174601 ACAGGGCAGCTGGGGGAAGAGGG + Intergenic
1076641913 10:131923155-131923177 AGTGGTTACCAGAGGGCAGAGGG - Intronic
1076644660 10:131944666-131944688 ACTGGACAGCAGAGGGAGGACGG - Intronic
1076858407 10:133128379-133128401 ACAGGTGACCAGGGTGATGATGG - Exonic
1076912648 10:133399417-133399439 CCAGGTCAGCTCAGGGAAGAAGG - Intronic
1077140503 11:1022202-1022224 ACAGGGCTGCAGAGGGCAGAGGG - Intronic
1077896270 11:6455973-6455995 ACAGGTCACCTCCTGGAAGATGG - Intronic
1078437854 11:11340230-11340252 ACAGGTGACCAGAGGGATAGAGG + Intronic
1079749384 11:24178080-24178102 ACAGGAAACAAGAGGGAAAAAGG - Intergenic
1080813568 11:35730369-35730391 ACATGTCACCAGTGTCAAGAGGG + Intronic
1081079230 11:38718851-38718873 GCAGGTCAGCAGAGGGGAGCAGG - Intergenic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1081891651 11:46547542-46547564 ACAGCTCACCAGTGGTATGATGG - Intronic
1084215665 11:67645649-67645671 ACAGCTCCCCAGAGGGGAGTGGG - Intronic
1085395023 11:76202790-76202812 CCAGGACTCCAGAGTGAAGAGGG + Intronic
1089572602 11:119420360-119420382 GCAGGTCTCCCGAGGGCAGAAGG - Exonic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089870673 11:121670211-121670233 ACAGGTCCCCGGAAAGAAGAAGG - Intergenic
1090022115 11:123137456-123137478 ACAGGGTCCCAGAGGGGAGATGG + Intronic
1090873901 11:130771830-130771852 ACACATCCCCAGAGGGAAGGAGG + Intergenic
1091702688 12:2674314-2674336 ACGGGGCACAAGAGGGAAGGGGG + Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092119944 12:6036755-6036777 GCAGGGCACGAGAGGGCAGAGGG - Intronic
1092209734 12:6638515-6638537 ACAGGGCAGTAGAGGGAAGGAGG + Intronic
1093182974 12:15988192-15988214 GCAGGTAACGAGAAGGAAGAAGG - Intronic
1094133303 12:27098022-27098044 TCAGGTCACCAGATGGAAGATGG - Intergenic
1094183126 12:27613253-27613275 TCAGGTCACCAGATGGAAGATGG - Intronic
1096111151 12:49030141-49030163 ACAGGGCACCTGAGGTAGGAAGG - Intronic
1097442801 12:59632126-59632148 ACATGCTAGCAGAGGGAAGATGG + Intronic
1099061091 12:77910283-77910305 GCAGGTCACATGAGGAAAGAGGG + Intronic
1099215407 12:79847045-79847067 ACACGTCCACAGAGGGAAAAAGG + Intronic
1101258666 12:103006503-103006525 ACAGGCCACAAGAAGGAAAATGG - Intergenic
1101647785 12:106647103-106647125 ACAGTTTACCAGAAGGAAGATGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102598449 12:114011345-114011367 CCAGGCTACCTGAGGGAAGAGGG - Intergenic
1103618226 12:122169117-122169139 ACAGAGCACAAGAGGGAATACGG - Intronic
1104967158 12:132513535-132513557 AGAGGTGACCAGAGGGCTGATGG - Intronic
1105934049 13:25082024-25082046 AAAGGCAACCAGAGGCAAGAGGG - Intergenic
1106692833 13:32136872-32136894 ACAGGTCACCAGGGGGTACAAGG - Exonic
1107905384 13:45056700-45056722 ACAGGACAGCAGAGGGACAAAGG + Intergenic
1107987370 13:45786952-45786974 ACAGGTCAGGACAGAGAAGATGG - Intronic
1108935394 13:55875403-55875425 CCAGTTTACCAGAGAGAAGAAGG - Intergenic
1109867770 13:68287971-68287993 ATAGGTCATAAGATGGAAGAGGG - Intergenic
1110694493 13:78472323-78472345 AGATGTCAGCAGAGGAAAGAGGG - Intergenic
1111027875 13:82556136-82556158 AGTGGTTACCAGAGGTAAGAGGG + Intergenic
1111193763 13:84844859-84844881 ACAGGTTAGCAGGGGGAAAAAGG - Intergenic
1112174693 13:97010462-97010484 ACAGACAACCCGAGGGAAGATGG - Intergenic
1114259612 14:21026809-21026831 ACTGGCATCCAGAGGGAAGAGGG - Intronic
1114517293 14:23308243-23308265 GCTGGTCTCCAGGGGGAAGATGG + Intronic
1115829173 14:37315839-37315861 AAAGCTCACCAAAGAGAAGAGGG + Intronic
1116677437 14:47923977-47923999 ACAGGTAACCAGAGCAAAAATGG - Intergenic
1117711476 14:58533767-58533789 ACACGACACCAGTGGGAATAAGG - Intronic
1118347089 14:64948303-64948325 ACGGGCCTCCTGAGGGAAGAGGG + Exonic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1119568121 14:75646172-75646194 TGAGGTCATCAGAGGGAAAAAGG - Intronic
1121108497 14:91296229-91296251 ACAGGTCACGAGAGGGGACAAGG - Intronic
1121576103 14:94989515-94989537 GGAGGTAACCAGAGGGAATAAGG + Intergenic
1121586223 14:95064800-95064822 AGATGTCACCAGAGAGAAGAAGG + Intergenic
1122280028 14:100616514-100616536 ACAGGGCAGCAGAAGAAAGATGG + Intergenic
1122461013 14:101895484-101895506 ACAGGTCAGCAGGGGCCAGAGGG - Intronic
1122610370 14:102978252-102978274 ACAGGTAAAAAGAGGAAAGATGG + Intronic
1123570555 15:21602879-21602901 ACAGGTCACCAAAGCAAAAACGG + Intergenic
1123606669 15:22038233-22038255 ACAGGTCACCAAAGCAAAAACGG + Intergenic
1126730224 15:51674819-51674841 AGAGGTCTCCACAGGGCAGAAGG - Intergenic
1126961823 15:54005028-54005050 ACAGGTGACCAGAGCAAACATGG - Intergenic
1127783932 15:62339762-62339784 ACAAGGGACCAGAGGGAAAAGGG - Intergenic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1130924167 15:88372766-88372788 ACAGGTCAAAAAAGTGAAGATGG + Intergenic
1131177220 15:90217638-90217660 AGAGGACCACAGAGGGAAGATGG + Intronic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1132232828 15:100197130-100197152 ACAGGTCATCAGGGAGAAAATGG + Intronic
1202978908 15_KI270727v1_random:330003-330025 ACAGGTCACCAAAGCAAAAACGG + Intergenic
1132557176 16:577840-577862 ACAGGTCCCCAGAGGGAGGATGG - Intronic
1134093351 16:11403161-11403183 ACAGGTCACCAGCGTGCACAGGG - Intronic
1134453197 16:14376003-14376025 ACAGGTCCCCAGAGAGAGGCAGG + Intergenic
1135674574 16:24404537-24404559 ACAAGGCACAAGAGAGAAGATGG + Intergenic
1137057471 16:35752523-35752545 ACAGGCCACCTCAGGGATGAAGG - Intergenic
1137941510 16:52692553-52692575 ACAGGCACCCAGAGGAAAGAAGG + Intergenic
1138514223 16:57527080-57527102 CCAGGTCACCCCAGGGAAGAGGG + Intronic
1139558510 16:67727625-67727647 CCAGGTCTGCAGAGGGAAGTGGG - Intronic
1140481366 16:75264679-75264701 GCAGATGACCAGAGGGAAGCTGG - Intronic
1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG + Intergenic
1141286587 16:82678472-82678494 ACAAGTCTCCAGAGATAAGAAGG - Intronic
1141486289 16:84342389-84342411 CTAGGTCAGGAGAGGGAAGAGGG + Intergenic
1142021425 16:87785283-87785305 GCAGGTCACCACAGAGAAAATGG - Intergenic
1142035672 16:87861033-87861055 AAAGGGCAGCAGCGGGAAGAGGG + Intronic
1143768627 17:9153593-9153615 ACAGCTCAAGAGAAGGAAGAGGG + Intronic
1143951918 17:10639405-10639427 AAAGTTAACCAGAGAGAAGAAGG - Exonic
1144630929 17:16872067-16872089 ACTGGGCACCAGAGGGCAGATGG - Intergenic
1144650387 17:17003409-17003431 ACTGGGCACCAGAGGGCAGATGG + Intergenic
1145058740 17:19719339-19719361 TCATGTCAGCAGATGGAAGAAGG + Intergenic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146235608 17:31158103-31158125 AGAGGACACTAGAGGTAAGAAGG - Intronic
1147835444 17:43327463-43327485 ACAGGACACTAAAGAGAAGAAGG - Intergenic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150715971 17:67572872-67572894 ACAGAGACCCAGAGGGAAGAAGG + Intronic
1151115776 17:71733281-71733303 ATTGATCACCAGAGAGAAGAAGG + Intergenic
1151734694 17:75931825-75931847 CCAGATCACAAGAGGGAGGAGGG + Intronic
1151858953 17:76744634-76744656 AAAGGTCACCAGAGGAAGGGAGG + Intronic
1152915909 17:83035784-83035806 TCCGGTCACAAGAGGGAAGTTGG + Intronic
1152998091 18:427123-427145 ACAGATGACTTGAGGGAAGAGGG + Intronic
1155068441 18:22289659-22289681 ACAGGTTACCAGTGGGTAGGGGG - Intergenic
1155236596 18:23826053-23826075 ACATATCTGCAGAGGGAAGAGGG - Intronic
1157005324 18:43576342-43576364 ACATGATACCAGAGGGAAAAAGG - Intergenic
1157965729 18:52206164-52206186 ACAGGTGAGCAGAGGGAGCAAGG + Intergenic
1160707214 19:535275-535297 ACCGGACACCTGAGGGCAGACGG + Intronic
1161327992 19:3672641-3672663 ACAGGTGGCCAGAGGGAGGGAGG + Intronic
1161405807 19:4090561-4090583 GCAGGTCACCAGCGGGACGCAGG + Exonic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1162599239 19:11654890-11654912 CCAGGTCACCAGAGATAACATGG - Intergenic
1163345198 19:16736818-16736840 ACTGATCAGCAGAGGGAAGTAGG + Intronic
1163667763 19:18611096-18611118 CCAGGTCGCCTGAGGGGAGAAGG - Intronic
1163720831 19:18897419-18897441 CCAGGATACCAGACGGAAGAGGG - Intergenic
1166337258 19:42115906-42115928 ACAGGTGCACAGAGAGAAGATGG + Intronic
925183663 2:1832722-1832744 ACAGCTCACCACAGGGAGGAAGG - Intronic
925298896 2:2795968-2795990 ACAGATCAGCAGAGGGAGGGAGG - Intergenic
927016569 2:18969500-18969522 AGAGGACACCAGAGGAAAGGCGG + Intergenic
927422585 2:22948749-22948771 ACAGGTCCACAGATGGAATAAGG + Intergenic
927935866 2:27076098-27076120 ATAGGACATCAGAGGCAAGATGG + Intergenic
928995227 2:37282335-37282357 ACAGGTGGCCAGAGGAAAGACGG + Intronic
930439940 2:51392043-51392065 ACAGAGCACCTGAGGGAAGGGGG + Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
932645710 2:73499371-73499393 ACAGGTAACCAAAGCGAAAATGG - Intronic
935373507 2:102371872-102371894 ACTGGTTACTAAAGGGAAGATGG + Intronic
936158863 2:110069203-110069225 ACAGGTGGCCAGAGGCAGGAGGG + Intergenic
936185797 2:110302129-110302151 ACAGGTGGCCAGAGGCAGGAGGG - Intergenic
939249694 2:139667857-139667879 GCAGGTCACCAATGGGAAGAGGG - Intergenic
939868216 2:147498751-147498773 ACAGTTTAACAGAGTGAAGAGGG + Intergenic
941339153 2:164284655-164284677 ACTGGTTTCCAGAGGGTAGAGGG + Intergenic
941712567 2:168729540-168729562 ACTGGTCCACACAGGGAAGAAGG - Intronic
941885814 2:170525980-170526002 ACATGAAACCAGAGGGAAAATGG + Intronic
941918606 2:170828317-170828339 AGATGACAGCAGAGGGAAGAGGG - Intronic
942576937 2:177373807-177373829 ACAGAGCACCTGGGGGAAGAAGG - Intronic
944060509 2:195567049-195567071 AGAGGTCTCCAGAGGCAAAAGGG + Intergenic
944427105 2:199594852-199594874 ACAGGTCACAAGAAGCAAGTGGG + Intergenic
945225361 2:207528125-207528147 ACATAAGACCAGAGGGAAGAGGG + Intergenic
945409837 2:209495221-209495243 ACAGAGCACCTGGGGGAAGAGGG + Intronic
945576116 2:211531286-211531308 ACAGGTAACCAGAGCAAAAAAGG + Intronic
945775825 2:214104753-214104775 ACAGGTCACCAGCAGGAAAGAGG + Intronic
945806892 2:214501242-214501264 ACACTTCATCAGAGGGAAGGTGG - Intronic
946032849 2:216718563-216718585 ACAGGTCACAGGAGAGCAGAGGG + Intergenic
947115115 2:226761540-226761562 ACAGTTGACCAGAGTGGAGAAGG - Intronic
947501742 2:230675879-230675901 ACAGGTGGGCAGAGGAAAGAGGG - Intergenic
947865743 2:233397083-233397105 AGAGGACACCAGAGGGGAGCAGG + Intronic
947865862 2:233397456-233397478 AGAGGACACCAGAGGGGAGCAGG + Intronic
1168842224 20:916854-916876 ACATGGAACCAGAGGGAGGAAGG - Intergenic
1169190983 20:3659299-3659321 GCAGGAAACCAGGGGGAAGATGG + Intronic
1170465751 20:16621141-16621163 ACAGGTAGCCTGAGGGAGGATGG - Intergenic
1170479008 20:16746551-16746573 AAAGGTTACCAGAGGGATCATGG - Intergenic
1171368606 20:24645502-24645524 ACAGGGCTCCAGAGAAAAGAGGG + Intronic
1172851460 20:37969233-37969255 ACAGGTCACCAGGGAAATGAGGG + Intergenic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1175124741 20:56742816-56742838 ACAAGGCACCAGCGGCAAGAGGG + Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175488095 20:59359802-59359824 GCAGGGCACCAGTGCGAAGAGGG + Intergenic
1175693275 20:61081894-61081916 GCAGGTAACTTGAGGGAAGAGGG - Intergenic
1176074586 20:63242753-63242775 ACATGACAGCAGAGGGAACATGG + Intronic
1176238558 20:64065388-64065410 TCAGGTCACCTTAGGGCAGAGGG + Intronic
1178890864 21:36520183-36520205 ACAGACCCACAGAGGGAAGACGG - Intronic
1179472335 21:41620066-41620088 ACTTGTCTCCAGAGGGAAGGAGG + Intergenic
1179556723 21:42183189-42183211 ACTGGTCAGCTGAGGGATGAGGG + Intergenic
1179939961 21:44630945-44630967 ACAGCAAACCACAGGGAAGAGGG + Intronic
1180062123 21:45390870-45390892 ACAGGAGCTCAGAGGGAAGAGGG + Intergenic
1180074223 21:45454654-45454676 ACAGGTCCTCAGAGGGCATAAGG + Intronic
1180835597 22:18928081-18928103 TCAAGGCACCACAGGGAAGAGGG + Intronic
1180911529 22:19454241-19454263 ACAGGACACCAGGGAGCAGAGGG + Intronic
1181398543 22:22637636-22637658 GCAGCTCCCCAGAGGGAAGCAGG + Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182857210 22:33528321-33528343 ACACTTCACCAGAGGGAAAAAGG + Intronic
1183120965 22:35729733-35729755 ACAGATGACAGGAGGGAAGAGGG - Intergenic
1183588783 22:38768141-38768163 ACAGGGCCCCTGAGGGCAGAGGG - Intronic
1184186509 22:42868693-42868715 GCAGGGCAGGAGAGGGAAGATGG + Intronic
1184257069 22:43293371-43293393 ACAGCACACCAGAGTGAAGGCGG + Intronic
1184280227 22:43433255-43433277 ACAGGGCAGCAGAGGGGACAGGG - Intronic
1184319937 22:43733557-43733579 ACAGGTCATCAGAGGGTAAAGGG + Intronic
1184322272 22:43751601-43751623 GCAGGACACCAGAGAGAAAAGGG + Intronic
1184355354 22:43975875-43975897 AGAGAAAACCAGAGGGAAGAAGG - Intronic
1184542050 22:45132610-45132632 AAAGGAGGCCAGAGGGAAGAAGG + Intergenic
1185105189 22:48864956-48864978 ACCTGTCCCAAGAGGGAAGAAGG - Intergenic
1185148303 22:49150963-49150985 CGAGGTCACCAGAGGAAGGAGGG + Intergenic
1203285685 22_KI270734v1_random:153380-153402 TCAAGGCACCACAGGGAAGAGGG + Intergenic
949111547 3:267273-267295 ACAGGTCACCAGGGAAATGATGG - Intronic
949181983 3:1143471-1143493 ACAGGTCACTTGAGGCAAAATGG - Intronic
950969705 3:17174067-17174089 ACATGTCATTATAGGGAAGATGG - Intronic
951580695 3:24159776-24159798 ACTGGTGTCCAGTGGGAAGAGGG + Intronic
951891998 3:27576102-27576124 CCTGGTCACCAGAAGGAACAAGG - Intergenic
952305027 3:32137979-32138001 ACATGTCACCAGCCTGAAGAGGG + Intronic
953967678 3:47322553-47322575 CCAGGGCACTAGAGGAAAGAGGG - Exonic
954676305 3:52317615-52317637 AAAGGGCACAGGAGGGAAGATGG + Intronic
955711212 3:61780958-61780980 ACAGGCCTCCAGAGGGAATGGGG + Intronic
956789252 3:72668230-72668252 ACAGGATGCCAGAGGCAAGAAGG - Intergenic
960270374 3:115667615-115667637 AGAGCTCACCAGCAGGAAGAGGG - Intronic
960779798 3:121306977-121306999 ACAGGTTAACAGAGAGATGAAGG + Intronic
962668545 3:137681123-137681145 ACAGGTAACCAAAGGGAAAATGG + Intergenic
965854450 3:173071428-173071450 ACAGGTAACCAAAGGAAAAATGG + Intronic
966770694 3:183501100-183501122 ACAGGTCAGCAGAGTGGGGATGG + Intronic
967778333 3:193407848-193407870 ACGGGACACCAGGGAGAAGAGGG - Intronic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968846431 4:3044808-3044830 GCTGGTCACCAGAAAGAAGAAGG + Intergenic
972826074 4:42760646-42760668 ACAGATTACTAGAGGGGAGAGGG + Intergenic
973681482 4:53324761-53324783 AGAGCCCAGCAGAGGGAAGAGGG + Intronic
974456414 4:62134168-62134190 ACATGTGACTAGAGGGAAGGAGG + Intergenic
976131882 4:81893179-81893201 ATGGGTCACCAGAGAGAAGCCGG + Intronic
977188936 4:93976118-93976140 ACAGATACACAGAGGGAAGATGG - Intergenic
979457646 4:120944610-120944632 ACAGAGCACCTGAGGGAAGTGGG + Intergenic
980519308 4:133910205-133910227 ACAGGTCACCAGGGGAGTGAGGG + Intergenic
981300274 4:143178935-143178957 TCAGTTTACCAGAGAGAAGAAGG - Intergenic
984505281 4:180609825-180609847 ACTGGTCACCAGAAAGAACAAGG - Intergenic
984940714 4:184929846-184929868 ACACATCACCAGTGGGCAGATGG + Intergenic
985840540 5:2301970-2301992 ACAGGCCCCCAGAGGGAACATGG - Intergenic
987207214 5:15640218-15640240 ACAGATCCTCAAAGGGAAGACGG - Intronic
987324983 5:16804401-16804423 ACAGGTCACCAAAGGGAGTGGGG + Intronic
991118528 5:62982935-62982957 ACAGGTTACCTGTGGGAAGCTGG - Intergenic
993573969 5:89578553-89578575 ACAGGTGATCAGAAGAAAGATGG + Intergenic
994742760 5:103642108-103642130 CCAGCTCACAAGAGGCAAGAAGG + Intergenic
997372079 5:133368433-133368455 TAAGATCAACAGAGGGAAGAGGG - Intronic
999197502 5:149792375-149792397 GCAGCTCCCCAGAGGCAAGAAGG + Intronic
999268632 5:150283333-150283355 AGAGTTAACCAGAGGGAAGAGGG - Intronic
999272456 5:150304557-150304579 ACAAGTCACCAGAGGTCAGGTGG + Intronic
999562396 5:152818839-152818861 ACAAGACAGCAGAGTGAAGATGG + Intergenic
1000135095 5:158340253-158340275 ACAGGTTACCAGGGTGAAGATGG - Intergenic
1000231799 5:159322582-159322604 ACAGATCACCAGATGGTACAGGG + Intronic
1000565452 5:162841243-162841265 AGAGATGACCAGAGTGAAGAGGG + Intergenic
1001600776 5:172926708-172926730 ACAGCTAACCAGTGGGAAGGTGG + Intronic
1001966641 5:175914349-175914371 ACAGCACAGCAGAGGGAGGAGGG + Intergenic
1002250306 5:177924855-177924877 ACAGCACAGCAGAGGGAGGAGGG - Intergenic
1002551436 5:179995702-179995724 ACACTTCCCCAGTGGGAAGATGG + Intronic
1003357649 6:5389322-5389344 ACAGGACACAAGAGAGAAGATGG - Intronic
1003712285 6:8605416-8605438 ACAGGGCATCAGAGGGCAGAGGG - Intergenic
1003849540 6:10207754-10207776 ATAGATCACCTCAGGGAAGAAGG + Intronic
1004286172 6:14322806-14322828 AGGGGACTCCAGAGGGAAGAGGG + Intergenic
1004782122 6:18920851-18920873 ACACCTCAGCAGAGGCAAGAAGG - Intergenic
1006786607 6:36671995-36672017 ACAGGCCACCTGAGGGGTGAAGG - Intergenic
1006832947 6:36979812-36979834 ACAGGTGGGCAGATGGAAGAGGG - Intronic
1007492725 6:42236481-42236503 ACAGATCAACAGAGGAGAGAGGG + Intronic
1011747770 6:90423165-90423187 CCAGGTCACCAGGAGGAATAAGG - Intergenic
1011750403 6:90449475-90449497 ATAGGTTACCAGTGGGAAGGAGG + Intergenic
1012408878 6:98933239-98933261 AGAAGTTACCAGAGGCAAGAGGG - Intronic
1013235479 6:108194715-108194737 AAAGGTCACCAGAGAGTAGGGGG - Intergenic
1013871435 6:114766536-114766558 TCAGGTGAGCAGAGGGATGATGG + Intergenic
1018463652 6:164022646-164022668 ACAGGCCACGGGAGGGAAGAGGG + Intergenic
1018847783 6:167567174-167567196 ACAGGGGACAGGAGGGAAGATGG + Intergenic
1020255337 7:6500057-6500079 GGAGGTCCCCAGAGAGAAGATGG - Intronic
1022812693 7:33885336-33885358 ACAGGTCCTCAGGGGCAAGAAGG - Intergenic
1023115959 7:36862763-36862785 ACAGATCACAGGAGGGGAGAGGG - Intronic
1023199075 7:37674212-37674234 ACAGGTTATCAGAATGAAGATGG + Intergenic
1032117311 7:129127732-129127754 GCAGGTCACCAGCGGGACGCGGG - Intergenic
1032256536 7:130301804-130301826 ACTGGTCACAAGAGGGATCAAGG - Intronic
1032267852 7:130381176-130381198 GCAGGTCAGAAGAGGGGAGAAGG + Exonic
1033545364 7:142394644-142394666 CCAGGTCTACACAGGGAAGAAGG - Intergenic
1033552700 7:142462452-142462474 ACAGGACAGCAGAGGGAGGTAGG - Intergenic
1034828062 7:154284985-154285007 AGAGGTTACCAGAGGCCAGAGGG + Intronic
1035245843 7:157561514-157561536 TCAGGGCCCCAGAGGGAGGATGG - Intronic
1035251909 7:157603296-157603318 ACAGGTCATGACAGGGAAGGGGG + Intronic
1035339586 7:158151658-158151680 AAAGGAAACAAGAGGGAAGAAGG - Intronic
1036206449 8:6809033-6809055 AGAGGTCACCAGAGGGCAAAGGG + Exonic
1036807532 8:11845757-11845779 ACACGTCACCGGAGAGATGATGG - Exonic
1036965124 8:13289056-13289078 ACAGGTCACAGGAGTGAAGTTGG - Intronic
1037748047 8:21662225-21662247 ACAGGCCAGCTGGGGGAAGAGGG + Intergenic
1037913486 8:22758239-22758261 AAGGGTCACCGGAGGGAAGATGG - Intronic
1038437104 8:27543880-27543902 ACGGGTGCTCAGAGGGAAGACGG + Intronic
1045371365 8:101527072-101527094 AAATGTCAACAGAGGGAATAAGG + Intronic
1046310541 8:112430839-112430861 ACAGGTCAACAGAGGGAAAAGGG + Intronic
1047281113 8:123446524-123446546 AAAGCTCTCCAGAGGGAGGAGGG - Intronic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1049790274 8:144469257-144469279 CCAGGACACCTGAGGGAACAGGG - Exonic
1052837520 9:33262972-33262994 GGAGGTCACCAGAGGAAAGCTGG - Intronic
1054760345 9:68999131-68999153 ACAGAACATCACAGGGAAGAAGG - Intronic
1055280741 9:74671213-74671235 ACAGATGAAGAGAGGGAAGAAGG + Intronic
1055394631 9:75861032-75861054 ACATGTCCACAGAGAGAAGAGGG - Intergenic
1055579605 9:77693779-77693801 ACAGGTCACCAAAGCAAAAATGG - Intergenic
1057532089 9:95857913-95857935 TCAGGTCAGCACAGGGAAGTAGG - Intergenic
1058440035 9:104998268-104998290 ACAGGTTACCCCAGGGAACAGGG - Intergenic
1058539792 9:105999764-105999786 ACAGGTCAGCAGAGGGCTGAAGG + Intergenic
1058757545 9:108097319-108097341 ACAGGACAACAGAGGGAAAGAGG + Intergenic
1059610777 9:115890751-115890773 GCAGGTTAGCATAGGGAAGAAGG - Intergenic
1060013521 9:120065753-120065775 ACACGTCATCTGAGGGATGATGG + Intergenic
1060661149 9:125405899-125405921 AGAGGTCACCAGAGGTCAGTTGG - Intergenic
1061562967 9:131418280-131418302 ACAAGTTTCCAGAAGGAAGAGGG - Intronic
1062050663 9:134444817-134444839 ACCTGCCACCAGAGGGAAGGAGG - Intergenic
1062210106 9:135358904-135358926 ACAGGTCCGCAGAGGCAAAAGGG + Intergenic
1062288273 9:135783312-135783334 CCAGCTCAGAAGAGGGAAGAGGG + Intronic
1062616373 9:137398364-137398386 ACAGGGGACAAGAGGGAAGGGGG - Intronic
1186294169 X:8131029-8131051 AGAGGCCATCAGAGGGCAGATGG - Intergenic
1186576787 X:10775198-10775220 AAAGGTCACCAGAAGGGAGTTGG + Intronic
1187734606 X:22290996-22291018 AAAGGTCAACAGAGGGGAAATGG - Intergenic
1189088400 X:38051194-38051216 GGAGATGACCAGAGGGAAGAGGG + Intronic
1190826699 X:54024450-54024472 AGAGGTGTCCAGAGGGAACAGGG - Intronic
1191724109 X:64260588-64260610 ATAGGTCACCTCAGGGAAGGCGG + Intergenic
1192233624 X:69282786-69282808 ACAGGACACCAGAGGCAAGCTGG - Intergenic
1196154484 X:112412826-112412848 ACAGGTAACCAAAGCAAAGACGG + Intergenic
1198262545 X:134977801-134977823 ACAGATAACCAGTGGGAACATGG + Intergenic
1199276855 X:145954453-145954475 ACAGGTAACCATAGCAAAGATGG - Intergenic
1199880983 X:151974314-151974336 ACAGGACGCCAGAAGGAAGACGG - Intronic
1200211598 X:154349075-154349097 GCAGGACACCAGCGGGAGGAAGG - Intronic