ID: 1173583022

View in Genome Browser
Species Human (GRCh38)
Location 20:44160478-44160500
Sequence GGCAAGGGCGGGAGTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 876
Summary {0: 1, 1: 0, 2: 3, 3: 89, 4: 783}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583009_1173583022 3 Left 1173583009 20:44160452-44160474 CCCGCGTGTGCACGGTGGCCTGG 0: 1
1: 0
2: 3
3: 13
4: 155
Right 1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG 0: 1
1: 0
2: 3
3: 89
4: 783
1173583008_1173583022 4 Left 1173583008 20:44160451-44160473 CCCCGCGTGTGCACGGTGGCCTG 0: 1
1: 0
2: 1
3: 3
4: 77
Right 1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG 0: 1
1: 0
2: 3
3: 89
4: 783
1173583011_1173583022 2 Left 1173583011 20:44160453-44160475 CCGCGTGTGCACGGTGGCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 165
Right 1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG 0: 1
1: 0
2: 3
3: 89
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583022 Original CRISPR GGCAAGGGCGGGAGTGGGCA AGG Intronic
900102372 1:967368-967390 GGCTGGGGGGGGGGTGGGCATGG - Intronic
900382441 1:2391590-2391612 CGCAAGGGGGGGTGTGGCCACGG + Exonic
900429406 1:2594747-2594769 GGCATGGGCGGGGGGGGCCAGGG - Intronic
900998191 1:6134096-6134118 AGCCGGGGCGGGGGTGGGCAGGG + Intronic
901120000 1:6883441-6883463 GGAGAGGGCAGGAGAGGGCAGGG + Intronic
901209070 1:7514379-7514401 GGGAAGGGCATGAGTGGGGAAGG + Intronic
901225178 1:7609125-7609147 GGCTAGGCCGGTAGTGGGAAGGG - Intronic
901266277 1:7913284-7913306 GGCAGGGGAGGAAGTGAGCAGGG - Intergenic
901417970 1:9129759-9129781 GGCAAGAGCAGGGGTGGGCCTGG - Intergenic
901639857 1:10687686-10687708 GGCAAGGGAGGAAGTGGAGAAGG + Intronic
901671049 1:10856612-10856634 GGCAAGGGCTGGCGTGGGGTGGG - Intergenic
901675575 1:10881744-10881766 GGCAAGGGCAAGAGTGGACGTGG - Intergenic
901845245 1:11978000-11978022 GGAAGAGGAGGGAGTGGGCAGGG + Intergenic
901857537 1:12054024-12054046 GGCAAGGGAGGCAGATGGCAGGG - Intergenic
902375071 1:16026726-16026748 GGCAGCGGCGGCAGTGGGCGTGG + Exonic
902380042 1:16048533-16048555 GGCAGCGGCGGCAGTGGGCGTGG + Exonic
902387396 1:16083638-16083660 GGGAAGGGCAGGAGTGGGCTGGG - Intergenic
902402499 1:16165906-16165928 GGGAACGGAGGGAGTGAGCAGGG - Intergenic
902536462 1:17121684-17121706 GGCAAGGCCGAGTGAGGGCAGGG + Intergenic
902608400 1:17582222-17582244 AGCAGGGGCGGGATGGGGCAAGG - Intronic
902723870 1:18322695-18322717 GGCAGGGGCGGGAGGGCCCAGGG - Intronic
902799661 1:18821368-18821390 GGCAAGGCCTGGTGTGGGCAGGG - Intergenic
903022074 1:20401583-20401605 GGCCGGGGCAGGAGTGAGCAGGG - Intergenic
903193694 1:21669907-21669929 GCCCAGGGCGGGTGTGGGGAGGG + Intergenic
903227930 1:21904345-21904367 GGCCAGGGCTGGAGAGGGCACGG + Intronic
903268666 1:22174158-22174180 GTCCAGGGCTGGAGGGGGCAAGG - Intergenic
903363477 1:22792065-22792087 GCCAAGGGAGGGAGGGGCCAGGG + Intronic
903419030 1:23205241-23205263 GGGAAGGGTGGGAGGGGGAAAGG + Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903773382 1:25778077-25778099 AGCAAGGTGGGGATTGGGCAGGG - Intronic
904090954 1:27944900-27944922 AGCAAAGGCGGGAGAGGGTATGG - Intronic
904373049 1:30062765-30062787 GGTAAGGGGGGAAGTGTGCAAGG - Intergenic
904624440 1:31794108-31794130 TGCAAGGGTGGGAGGGGACACGG - Exonic
904773663 1:32894292-32894314 AGCAAGGGCTGGGGTGGGAAGGG - Exonic
904826938 1:33280167-33280189 GTCAAGCGCGGGCGCGGGCACGG + Exonic
904842118 1:33379394-33379416 GGCAAGGGGGACAGTGGGCAGGG - Intronic
905331325 1:37201140-37201162 GGGAAGAGTGGGAGGGGGCAAGG + Intergenic
905873485 1:41417979-41418001 GGCAAGGGTGGGTGTGAGCTTGG + Intergenic
906449371 1:45931782-45931804 GGCTGGGGTGGGACTGGGCATGG - Intronic
906777194 1:48540471-48540493 GGAGAAGGCAGGAGTGGGCAGGG - Intronic
907246357 1:53111514-53111536 GGCAATGGCGGGAGTGGCAGGGG + Intronic
907850078 1:58247902-58247924 GGCAAAGGAAGGAGTGGGTAGGG - Intronic
909081063 1:71112204-71112226 GGCGAGGGGGGGAGTGGGGAGGG + Intergenic
909792170 1:79693387-79693409 AGCCAGGGCTGGAGTGGACATGG + Intergenic
909887587 1:80962145-80962167 GGCTGGGGCAGGATTGGGCAGGG - Intergenic
911082657 1:93949210-93949232 GGCAGAGGAGGGAGAGGGCAAGG + Intergenic
911087010 1:93987528-93987550 GGAAAGGGAGGGAGAGGGGATGG - Intergenic
911519303 1:98909253-98909275 GGGAAGGGAGGGAGGGGGAAGGG - Intronic
912033315 1:105276917-105276939 GGGAAGGGTGGGAGGGGGGAAGG + Intergenic
912270470 1:108203570-108203592 GGGAGGGGAGGGAGTGGGGAGGG - Intergenic
912430024 1:109624100-109624122 GGCAGGGGCCGGGGTGCGCAGGG + Intronic
912451129 1:109768459-109768481 GCCAAGGGGTGAAGTGGGCAGGG - Intronic
912502161 1:110129861-110129883 GGCAGGGGTGGGAGTGGGGAAGG + Intergenic
912909655 1:113745004-113745026 GGGCAGGGCAGGAGAGGGCAAGG + Intronic
913012991 1:114703073-114703095 GGGTGGGGCGGGAGTGGGAATGG - Intergenic
913661305 1:121008574-121008596 GGCGAGGGGGGCAGTGGGTAGGG - Intergenic
914165158 1:145169430-145169452 GGCGAGGGGGGCAGTGGGTAGGG + Intergenic
915130031 1:153689521-153689543 GGTGAGGGTGGGAGTGGGGATGG + Exonic
915177672 1:154030167-154030189 GGAAAGGGTGGGAGGGGGCGAGG + Intronic
915278858 1:154808708-154808730 GGGAGGCGGGGGAGTGGGCAGGG - Intronic
915530134 1:156498594-156498616 GGGAAGGGGGGGAGGGGGGAAGG - Intronic
916065409 1:161132327-161132349 GGCAACTGCGGGAGAGGGCAGGG - Intronic
916811162 1:168306968-168306990 GGACAGAGTGGGAGTGGGCAGGG + Intronic
917663517 1:177201034-177201056 GGCAAGGGTGGGAGTTGGTGAGG + Intronic
917980828 1:180267920-180267942 GTCCATGGCAGGAGTGGGCAGGG + Intronic
919360889 1:196593066-196593088 GGAAAGGGTGGGAGGGGGTAAGG - Intronic
919548932 1:198960655-198960677 GGGAAGAGTGGGAGGGGGCAAGG - Intergenic
919823012 1:201484670-201484692 GAAAAGCGCAGGAGTGGGCAGGG + Exonic
919924666 1:202186209-202186231 GGCAAGGGGGCAAGGGGGCAAGG - Intergenic
919924670 1:202186217-202186239 GGCAAGGGGGCAAGGGGGCAAGG - Intergenic
919929921 1:202214429-202214451 GGCAGGGGCGGGCAGGGGCACGG + Intronic
920328524 1:205186619-205186641 GGCAGGGTCAGGAGTGGGTAGGG - Intronic
920369658 1:205470219-205470241 GGAGAGGGTGGGAGGGGGCAGGG + Intergenic
920524953 1:206659554-206659576 GGCCAGGGAGGGAGTGGGCCAGG + Intronic
920979171 1:210815890-210815912 GGCAGGGGAGGAAGTGAGCAAGG - Intronic
921051710 1:211515786-211515808 GCCAAGGTCGGGAGTGGGGAAGG + Intergenic
921279807 1:213555270-213555292 TGCCAGGGAGGGAGTGGGCATGG - Intergenic
921540309 1:216406043-216406065 GGGAAGGGAGACAGTGGGCATGG + Intronic
922555124 1:226527095-226527117 GGCAGGGGCGGGGGAGGGTAAGG + Intergenic
922674899 1:227544058-227544080 GGCAGGGGCGGGGGGGGGGAAGG - Intergenic
922775845 1:228213896-228213918 GGCAGGGGCGGGACTGGGGCGGG + Intronic
922870106 1:228895737-228895759 GGAAAGGGCGGGAGGGGGTGAGG + Intergenic
923506789 1:234611156-234611178 GGCGAGGGCGCGAGTGGGGGGGG + Intergenic
923711376 1:236390161-236390183 GGGAAGAGTGGGAGGGGGCAAGG + Intronic
924623224 1:245680172-245680194 GGCAGGGGAGGGAAGGGGCAGGG - Intronic
1062843426 10:688371-688393 GGCAAAGAAGGGAGTGAGCAGGG - Intronic
1063507552 10:6614631-6614653 GGAAAGGGTGGGAGGGGTCAAGG - Intergenic
1063610073 10:7554308-7554330 GGCCAGGATGGGCGTGGGCAGGG - Intergenic
1064035269 10:11909095-11909117 GGCCAGTGCTGGAGTGGGCTTGG - Intergenic
1064621592 10:17222946-17222968 GGGAAGGGAGGGAGGAGGCAAGG - Intergenic
1064711993 10:18137829-18137851 GGGAAGTGTGGGAGGGGGCACGG - Intergenic
1065159268 10:22902323-22902345 GGCAAGAGAGAGAGTGTGCAGGG + Intergenic
1065214724 10:23438943-23438965 GGCGCGGGCCGGAGTGGGCGGGG + Intergenic
1065526500 10:26626956-26626978 GGCAAGGTGGGGAGAGTGCAAGG + Intergenic
1066340455 10:34527480-34527502 GACATGGGCTGGAGTGGGGAGGG + Intronic
1066653227 10:37679075-37679097 TGGAAGGGTGGGAGTGGGGAGGG + Intergenic
1067053299 10:43037521-43037543 GGCATGGGTGGGAGTGGACCAGG + Intergenic
1067762313 10:49057602-49057624 GGCAGGGGTGGGAGTGGGGAGGG - Intronic
1069542529 10:69306064-69306086 GGAAAGGGTGGGGCTGGGCACGG + Intronic
1069576468 10:69533514-69533536 GGGAAGGGGGAGAGTGGGCAAGG + Intergenic
1069723043 10:70561692-70561714 GGCCAGGCCTGGAGTGGGTATGG - Intronic
1069734806 10:70646920-70646942 GGAAAGGGTGGGAGTGGGTGAGG + Intergenic
1069915777 10:71785751-71785773 GGCACTGGTGGGAGTGGGCTGGG + Intronic
1069956804 10:72057030-72057052 GCCCAGGGAGGGGGTGGGCAGGG + Intergenic
1069994614 10:72334839-72334861 GGCAAAGGAGGGGGTGGGCAGGG + Exonic
1070657483 10:78281344-78281366 GGCATGGCCTGGAGTGGGCCTGG + Intergenic
1071507324 10:86240588-86240610 GGCGGGGGCGGGGGTGGGCAGGG + Intronic
1072591612 10:96832699-96832721 AGCAGGGGCGGGAGCGGGGAGGG - Intronic
1072637677 10:97188005-97188027 AGGAAGGGTGGGAGTGAGCAGGG + Intronic
1072737519 10:97889126-97889148 GGGAAGGGGGGGAGGGGGAAGGG + Intronic
1072896585 10:99372407-99372429 TGCAAGAGCAAGAGTGGGCAAGG + Intronic
1072921521 10:99581059-99581081 GCCAAGGGAGGAAGTGGGCATGG + Intergenic
1073214870 10:101830645-101830667 GGCGAGGGCGGGTGCTGGCAAGG - Intronic
1073467999 10:103705292-103705314 GGGAAGGGCGGGCGTGGGCCAGG + Intronic
1073645279 10:105295186-105295208 GGGAAGAGTGGGAGGGGGCAAGG - Intergenic
1074415886 10:113266253-113266275 GGGAGGGGCGGGATTGGGCAAGG - Intergenic
1075603593 10:123788543-123788565 GGCAAGGGCGGGAACAAGCAAGG - Intronic
1076068499 10:127467769-127467791 GGCAAGGGAGGCAGAGGACATGG - Intergenic
1076083806 10:127607291-127607313 AGCAAGGGCAGGAGGGGGCTGGG - Intergenic
1076189227 10:128470903-128470925 GGCACGGGCGGGAGGGGCCCTGG + Intergenic
1076670349 10:132117586-132117608 GGCAGGGGCGGGCGTGGGCGAGG + Intronic
1076670358 10:132117610-132117632 TGCAGGGGCGGGCGTGGGCGAGG + Intronic
1076670367 10:132117634-132117656 TGCAGGGGCGGGCGTGGGCGAGG + Intronic
1076890485 10:133280879-133280901 GGCCAGGGCGGTGCTGGGCAGGG + Intronic
1076890507 10:133280949-133280971 GGCCAGGGCGGTGTTGGGCAGGG + Intronic
1076890564 10:133281143-133281165 GGCCAGGGCGGTGTTGGGCAGGG + Intronic
1077009727 11:374700-374722 GGGAAGGGAGGGAGGGGGAAGGG + Intronic
1077094003 11:791783-791805 GGCAGGGGCAGCAGGGGGCAGGG - Exonic
1077474848 11:2781509-2781531 GGCCAGAGGGGGAGTGGGCAGGG - Intronic
1077499379 11:2902335-2902357 TGCAGGGGCGGGCTTGGGCACGG - Intronic
1077635902 11:3841088-3841110 GGCAAGCCCGGGACTGGGCCGGG - Intergenic
1077863699 11:6205588-6205610 GGTATGGGAGGGATTGGGCAGGG - Exonic
1078059620 11:8034734-8034756 GGGAATGGAGGGGGTGGGCAGGG - Intronic
1078870738 11:15342304-15342326 GGGAAGGCGGGAAGTGGGCAGGG - Intergenic
1078914111 11:15761771-15761793 GGCAGGGGTGGGGGTGGGGAGGG - Intergenic
1079094548 11:17502085-17502107 GGGTAGGGCGGGAGAAGGCACGG + Intronic
1079234239 11:18676325-18676347 GGCAAGGTTGGGGCTGGGCACGG - Intergenic
1079692630 11:23438968-23438990 GGCAGGGGAGGAAGTGAGCAAGG + Intergenic
1080211651 11:29793600-29793622 GGCAAGGAGAGGAGTGGTCATGG - Intergenic
1080383506 11:31797181-31797203 GGCATGGGCATGAGTGGCCATGG - Intronic
1080742910 11:35082448-35082470 AGCAGGGGCTGGACTGGGCAGGG + Intergenic
1081021787 11:37957193-37957215 AGCAAGGCCTGGAGTGGGAAGGG - Intergenic
1081783939 11:45733184-45733206 AGCAAGGGCAGCAGTGGGCAGGG + Intergenic
1081808283 11:45901663-45901685 GGCAAGAGGGGGAGGAGGCAGGG - Intronic
1081808767 11:45903772-45903794 GCCAAGGGAGGGTGTGGGCAGGG - Intronic
1081992541 11:47345605-47345627 GACAAGGGCGGGTGTGAGCCGGG - Intronic
1082983178 11:59142946-59142968 GGCAAGGACCGCCGTGGGCACGG + Exonic
1083225740 11:61283355-61283377 GGCAAGGAAGGAGGTGGGCAAGG - Intronic
1083305721 11:61761153-61761175 GGCAGGGGAGGGGGTGGGCAGGG + Intronic
1083409483 11:62482020-62482042 GGCCAGGGATGGAGTGAGCATGG - Intronic
1083493087 11:63027488-63027510 GGCAAGAGAGGGTGTGTGCAGGG + Intergenic
1083535352 11:63461817-63461839 GGCAAAGGTGGGAGTAGCCAGGG + Intronic
1083722258 11:64609151-64609173 AGGAAGGAGGGGAGTGGGCAGGG + Intronic
1083763267 11:64830155-64830177 GGCTAGGGTGGGCGTGGGCAGGG - Intronic
1083764721 11:64836304-64836326 GGCAGGGGAGGGAGCGGGGAAGG + Intronic
1083898052 11:65630137-65630159 GGGCAGGGCGGGAGGGAGCAGGG - Intronic
1084263340 11:67992359-67992381 GGGAAGGGAGGGAGGGGGCGCGG - Intronic
1084515738 11:69637233-69637255 GGAAAGGGCGGGGGAGGGCGCGG + Intergenic
1084691567 11:70730302-70730324 TGCAAGGGCAGGAGTGGAGAAGG - Intronic
1084810067 11:71606768-71606790 GGGAAGGGAGGGAGGGGGCGCGG + Intergenic
1084902255 11:72318390-72318412 GGCAAGGAGGGGTGAGGGCAGGG + Intronic
1085029897 11:73264649-73264671 GGTAAGGGCGTGCGCGGGCAGGG + Intronic
1085109545 11:73875515-73875537 GACAAGGGCAGGAATAGGCAGGG + Intronic
1085165836 11:74398502-74398524 AGCAAGGGCGGGAAGGGGCGGGG - Intergenic
1085205602 11:74730555-74730577 GGCAGCGGGGGGAGAGGGCAGGG - Intronic
1087639532 11:100741503-100741525 GGCAAGGCAGGGAATGTGCAAGG - Intronic
1087714499 11:101592924-101592946 GGCAAGAGCGAGCGTGTGCAGGG - Intronic
1088442537 11:109887765-109887787 GGCCAGGGTAGGAGTGGTCAAGG + Intergenic
1089016058 11:115166441-115166463 GGCAAGGGAGGGACTGGTGATGG + Intergenic
1089626147 11:119752264-119752286 GGCAAGGGCAGGAGAGGACCTGG + Intergenic
1089883249 11:121794994-121795016 TTCAAGGGCGGGGGTGGGGAGGG + Intergenic
1090044209 11:123316828-123316850 GGGAAGGGAGGGAGAGGGGAAGG + Intergenic
1090067947 11:123519296-123519318 GCCAAGGGAGGGAGAGGACAGGG + Intergenic
1090132312 11:124157612-124157634 GGAAAGAGTGGGAGGGGGCAAGG + Intergenic
1090373864 11:126275504-126275526 AGCAAGGGCTGGAGGGGGAAAGG + Intronic
1090399333 11:126438937-126438959 GTCCAGGGGTGGAGTGGGCAGGG - Intronic
1090710025 11:129375719-129375741 GGCACGGGCGGGCGGGGGCGGGG + Intergenic
1090736597 11:129616655-129616677 GCCAAGAGCTAGAGTGGGCAGGG + Intergenic
1091300044 11:134501955-134501977 GGCAGGGGCTGGGCTGGGCAGGG + Intergenic
1091401342 12:182465-182487 GGCACGGGAGGGAGGGCGCAGGG - Intergenic
1091588006 12:1827128-1827150 GGCAAGGGCGGGGATGGGCAGGG - Intronic
1091616198 12:2052917-2052939 GGCAGGGGCGGGCGCGGGCGCGG + Intronic
1091695759 12:2627102-2627124 ACAAAGGGCAGGAGTGGGCAGGG - Intronic
1091756632 12:3056665-3056687 GGGAAGGGCTGGAGTGGGTGGGG - Intergenic
1092238832 12:6825458-6825480 GGGAAGGGTGGGAGCGGGCTGGG - Intronic
1092387634 12:8048204-8048226 GGGCAGGGTGGGAGTGGGGATGG - Exonic
1092696626 12:11178346-11178368 GGGAGGGGAGGGAGTGGGGATGG + Intergenic
1095561749 12:43574156-43574178 GGAAAGGGAAGGAGTGGGAATGG + Intergenic
1095802351 12:46281889-46281911 GGCATGGGCTGTGGTGGGCAGGG - Intergenic
1096466324 12:51849010-51849032 GCCAGGGGCGGGAGGGGGCGGGG - Intergenic
1096588999 12:52644749-52644771 GGTGGGGGCGGGAATGGGCATGG + Exonic
1096866989 12:54570484-54570506 GGCTAGGCTGGGCGTGGGCATGG - Intronic
1097071600 12:56359171-56359193 GGGAAGGGAGGGATTGGGCAGGG + Intronic
1097369410 12:58758285-58758307 GGGAATGAGGGGAGTGGGCATGG + Intronic
1097925392 12:65121431-65121453 GGCGCGGGCGGGAGTGGGGGCGG + Exonic
1098357828 12:69627726-69627748 GGCAGGGGCAGGAGTGGGGGCGG - Intergenic
1099113159 12:78587345-78587367 AGCAGGGGCAGCAGTGGGCAGGG + Intergenic
1100503974 12:95201655-95201677 GGGAAGGGCAGAAGTGGGGAGGG - Intronic
1100592766 12:96044885-96044907 GGGAAGAGTGGGAGTGGGAAGGG - Intergenic
1101504302 12:105331403-105331425 GGGAAGGGTGGGAGTGGGGTTGG + Intronic
1101541052 12:105665781-105665803 GGCAAGAGAGGGAGCTGGCAGGG - Intergenic
1101580065 12:106034829-106034851 GGAAAGGGTGGGAGCGGGTAAGG - Intergenic
1102060386 12:109926749-109926771 GTCCTGGGTGGGAGTGGGCAGGG + Intronic
1102531104 12:113547236-113547258 GGCAGGGATGGGAGTGGGAAGGG + Intergenic
1103155944 12:118684987-118685009 GGGAAGGGAGAGAGTGGGCTAGG + Intergenic
1103568466 12:121829064-121829086 AGCAAGGGAGGCAGTGGGCATGG + Intronic
1103621457 12:122189719-122189741 GGACAGGGCAGGAGTGGACAGGG - Intronic
1103945388 12:124523306-124523328 GGCAAGGACGGCTGGGGGCAGGG + Intronic
1103948279 12:124538956-124538978 GGCAAGGAAGGGAGTGAGCCAGG + Intronic
1104411310 12:128560345-128560367 GGTAAGGTCCAGAGTGGGCAGGG - Intronic
1104642547 12:130476616-130476638 GGCTGGGGCAGGAGTGTGCAAGG - Intronic
1104801608 12:131558554-131558576 GGGAAAGGCGGATGTGGGCAGGG + Intergenic
1104836282 12:131793905-131793927 GGCTCGGGGGAGAGTGGGCACGG + Intronic
1105745735 13:23375566-23375588 TGCAGGGCCGGGAGTGGGCCGGG - Intronic
1106021541 13:25920458-25920480 GGCAGAGGAGGAAGTGGGCAGGG - Intronic
1108119853 13:47172675-47172697 AGCGGGGGCGGGAGTGGGGAGGG + Intergenic
1110259566 13:73470273-73470295 GGGAAGAGTGGGAGGGGGCAAGG + Intergenic
1110425720 13:75364078-75364100 GGCAGGGTGGGGAGTGTGCATGG + Intronic
1111296158 13:86280331-86280353 GGCAAGGGAGGGAGTAGGGCTGG + Intergenic
1111794431 13:92899732-92899754 GGGAAGGGAGGGAGCGAGCAAGG + Intergenic
1111822250 13:93228048-93228070 CGCAAGGGCGGGAGTGGAGAAGG - Intronic
1112034949 13:95488507-95488529 GGGAAGAGTGGGAGGGGGCAAGG - Intronic
1112734151 13:102399461-102399483 GCCAAGGGCTGCAGTGGGAAGGG - Intronic
1113166640 13:107450369-107450391 AGCATGGGAGGGAGTGGTCAGGG + Intronic
1113581971 13:111436454-111436476 GGGATGGGCAGGAGTGCGCAGGG - Intergenic
1113677262 13:112215332-112215354 GGTGAGGGCTGGAGTGGGGAGGG + Intergenic
1113677300 13:112215448-112215470 GGTGAGGGCTGGAGTGGGGAGGG + Intergenic
1113841568 13:113364187-113364209 GGCGGGGGCGGGGGGGGGCAGGG + Intergenic
1113847894 13:113402932-113402954 GGCATGGTGGGGTGTGGGCAGGG + Intergenic
1114514016 14:23285961-23285983 GGGAAGTGGGGGAGAGGGCAGGG + Exonic
1118258989 14:64230065-64230087 GGCGAGGGCGGGAATGGGGTGGG + Intronic
1118332683 14:64826088-64826110 GGCAGGGCCTGGGGTGGGCATGG - Intronic
1118366630 14:65102212-65102234 GGCGACGGCGGGAGGGGGCCGGG - Intronic
1119438851 14:74614696-74614718 GGCAAGGTGAGAAGTGGGCAGGG - Intergenic
1119604809 14:76006273-76006295 TTCAAGGGCAGGAGTGGGGAGGG + Intronic
1119769331 14:77210649-77210671 GGCAAGGGGTGGTGGGGGCAGGG + Intronic
1120542044 14:85762686-85762708 GGCTAGGGATTGAGTGGGCATGG - Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121111810 14:91317788-91317810 GGCCAGGGAGGAAGTGGGTAGGG + Intronic
1121125870 14:91406461-91406483 GTCATGGGAGGGAATGGGCAGGG - Intronic
1121284774 14:92726674-92726696 GGCAAGGTAGGGTGAGGGCATGG - Intronic
1121347516 14:93147083-93147105 GCCATGGGGGGGACTGGGCACGG - Intergenic
1121471708 14:94160496-94160518 GGTCAGGGCAGGAGTGGGAAGGG - Intronic
1121637711 14:95465121-95465143 GGCAAGGGCAAGAGAGAGCAAGG + Intronic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1121654902 14:95588182-95588204 GGTGAGGGCGGGAGTGGGGAGGG + Intergenic
1122114266 14:99520074-99520096 GGTATGGGCAGCAGTGGGCAGGG + Intronic
1122371037 14:101229185-101229207 GGCAAGGGCAGGGGAGGGCCAGG - Intergenic
1122420199 14:101571603-101571625 GACCAGGGAGGGAGAGGGCATGG + Intergenic
1122464009 14:101918378-101918400 GGCAAGGGGGTGAGGGGACAGGG - Intronic
1122487123 14:102088737-102088759 GGCAAAGGCGGCAGTCGCCAGGG - Intronic
1122609196 14:102969678-102969700 GCGGAGGGCGGGAGTGGGGAAGG - Intronic
1122790946 14:104183967-104183989 TGCTAGGGCTGGTGTGGGCAGGG - Intergenic
1122802354 14:104238027-104238049 TGCACGGGCGGCAGAGGGCAAGG + Intergenic
1122901025 14:104782424-104782446 GGCAAGGCTGGGGTTGGGCACGG - Intronic
1122924942 14:104895153-104895175 GGCAGGGGTGGGGGTGGCCATGG - Exonic
1123014055 14:105365184-105365206 AGCAGGGGCAGGAGTGGGAATGG + Intronic
1124141270 15:27079150-27079172 GGCATGGTCGGGTGTGAGCAAGG + Intronic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1125346248 15:38721905-38721927 GGGCAGGGAGGGAGTGGGCATGG + Intergenic
1125533628 15:40429713-40429735 TGGGAGGGCAGGAGTGGGCAGGG + Intronic
1125676008 15:41502912-41502934 GGCAAGGGCGTCTCTGGGCAGGG + Intronic
1125833451 15:42731665-42731687 GGGAAGGTGGGGGGTGGGCAGGG + Exonic
1126113389 15:45187996-45188018 GGCGGGGGCGGGGGTGGGGAGGG + Intronic
1128107572 15:65055896-65055918 GGCAGAGGCAGGAGAGGGCAGGG + Intronic
1128361041 15:66962001-66962023 GGCAGGAGGAGGAGTGGGCAAGG - Intergenic
1128519225 15:68364649-68364671 GGCAGGGGTGGGGGTGGGGAGGG - Intronic
1128737738 15:70062811-70062833 GGCAGAGGCAGCAGTGGGCAGGG - Intronic
1128865834 15:71115011-71115033 GGCAAAGCGGGGAGTGGGCGAGG - Intronic
1128912110 15:71524943-71524965 GACAAGGGAGGGAGGGAGCATGG - Intronic
1129253712 15:74322299-74322321 GGCAGGGGCGGGAGCAGCCAGGG + Intronic
1129300257 15:74621336-74621358 GGCCAGGGCAGGAGCTGGCATGG + Intronic
1129525699 15:76212727-76212749 GGCAAGGCTGGCAGAGGGCAGGG - Intronic
1129535445 15:76310847-76310869 GTCAAGGGCGGGGGTGGGGTGGG - Intronic
1129605252 15:77021814-77021836 GGGATGGGTGGGACTGGGCAGGG - Intronic
1129979492 15:79854325-79854347 GGGAAGGGCTGGGGAGGGCATGG + Intronic
1130951131 15:88589452-88589474 GGGAAGGGTGGGAGGGGGCAAGG + Intergenic
1131947498 15:97642321-97642343 GGGAAAGGAGGGTGTGGGCATGG + Intergenic
1132372578 15:101308737-101308759 TGCAAGGGCAGGTGTGGGGAGGG - Intronic
1132569356 16:637287-637309 GGCAGGGGCGGCAGAGGGCGGGG + Intronic
1132678877 16:1131596-1131618 CGCAAGGGCAGGAGAGGCCAGGG - Intergenic
1132887449 16:2188916-2188938 GGATAGGGCGGGAGCAGGCAGGG - Intronic
1132892254 16:2210112-2210134 GGGCAGAGCGTGAGTGGGCAGGG - Exonic
1132986439 16:2770000-2770022 GGCAAGGCAGGGAAGGGGCAGGG - Intronic
1133283192 16:4678611-4678633 GGCAGGGGCTGTGGTGGGCAGGG + Intronic
1133317672 16:4894437-4894459 GGCAAAGGCGGGAGTCTGCATGG - Intronic
1133390195 16:5403982-5404004 GGGAAGGGTGGGGCTGGGCATGG + Intergenic
1133510325 16:6451884-6451906 GTCATGGGAGGGAGTGGCCATGG - Intronic
1133801563 16:9090154-9090176 GGGAAGAGGGGGAGTGCGCAAGG + Intergenic
1134308545 16:13055663-13055685 GGGAAGAGGGTGAGTGGGCATGG - Intronic
1134366805 16:13586433-13586455 GGGGAGGGTGGGAGTTGGCAAGG - Intergenic
1134566727 16:15258057-15258079 GGCGGGGGCAGGAGGGGGCAGGG - Intergenic
1134735766 16:16498642-16498664 GGCGGGGGCAGGAGGGGGCAGGG + Intergenic
1134931760 16:18213580-18213602 GGCGGGGGCAGGAGGGGGCAGGG - Intergenic
1135107741 16:19665304-19665326 GGCATGGTGGGGAGTGGGAATGG - Intronic
1135175875 16:20228439-20228461 GGGAAGGGCGGGAGGGGACAAGG + Intergenic
1136365096 16:29806210-29806232 GGCAGGAGGGGGTGTGGGCAGGG - Intronic
1136475906 16:30513260-30513282 GCCAAGGGCAGGTGTGTGCAGGG + Intronic
1136777726 16:32880648-32880670 GGGCAGGGCGGGACAGGGCACGG + Intergenic
1136892897 16:33980866-33980888 GGGCAGGGCGGGACAGGGCACGG - Intergenic
1136897213 16:34002176-34002198 GGGCAGGGCAGGAGAGGGCATGG + Intergenic
1137054387 16:35736326-35736348 GGCAGGGGCGCAGGTGGGCAGGG - Intergenic
1137366433 16:47863553-47863575 GACAAGGGTGGGAGTTGTCAGGG - Intergenic
1137685567 16:50384503-50384525 GGCAAGGGTGGCAGTGGAGATGG - Intergenic
1137802893 16:51277366-51277388 AACAAGGGTGGGAGTGGGGAGGG + Intergenic
1139210045 16:65068049-65068071 AGGAAGGGAGGGAGGGGGCAGGG + Intronic
1139521114 16:67483237-67483259 AGCAAGGGTGGGACTGGGCGGGG - Intronic
1139727865 16:68916450-68916472 GGCAGGGGCGGGAGGGGGAGAGG - Intronic
1139796384 16:69486337-69486359 TGCATGGGCTGGGGTGGGCAGGG - Intergenic
1140037865 16:71384836-71384858 GGTAAGAGAGGGAGTTGGCATGG + Exonic
1141382594 16:83589341-83589363 GGCAAGGGAGGGAGGAGGGAGGG - Intronic
1141594423 16:85088655-85088677 GGCGAGGGTGGGGGCGGGCAAGG + Exonic
1142108440 16:88318548-88318570 GCCAAGGGCAGGAGTGGGGTGGG + Intergenic
1142121703 16:88389758-88389780 GGCAAGGGAGTGAGTGGCCATGG + Intergenic
1142126104 16:88411447-88411469 GGCAGGGGTGCGAGTGGGCAGGG + Intergenic
1142126113 16:88411479-88411501 GGCAGGGGTGCGAGCGGGCAGGG + Intergenic
1142126122 16:88411511-88411533 GGCAGGGGTGCGAGCGGGCAGGG + Intergenic
1142126126 16:88411527-88411549 GGCAGGGGTGGGTGTGAGCATGG + Intergenic
1142148424 16:88502338-88502360 GGGCAGGGCGGGAGAGGGCGGGG - Intronic
1142156436 16:88534657-88534679 GGCGGGGGCGGGAGCGGGCGAGG - Exonic
1142203813 16:88773350-88773372 GGCCAGGGAGGAGGTGGGCAGGG + Intronic
1142208000 16:88793095-88793117 GGCAGGGGCAGGAGTGGGCAGGG - Intergenic
1142308319 16:89298102-89298124 GGCAAGGGTGGGAAGGAGCAGGG + Intronic
1142349740 16:89574709-89574731 GGCAGGGCCGGGAGAGGCCATGG - Intergenic
1203080142 16_KI270728v1_random:1142757-1142779 GGGCAGGGCGGGACAGGGCACGG + Intergenic
1142578843 17:927830-927852 GGTGAGGGGGCGAGTGGGCACGG - Intronic
1144996917 17:19276091-19276113 GGCTAGGGCTGGAGTGGGGAAGG + Intronic
1145275358 17:21425952-21425974 GGCGAGGTTGGGAGAGGGCACGG + Intergenic
1145711667 17:26983800-26983822 GGCGAGGTTGGGAGAGGGCATGG + Intergenic
1145783791 17:27581175-27581197 AGCAAGAGCGAGAGGGGGCAGGG + Intronic
1146173204 17:30648498-30648520 GGGAAGGGTGGGGGCGGGCAGGG + Intergenic
1146370431 17:32262780-32262802 GGCAGAGGAGGGAGTAGGCATGG - Intergenic
1146915357 17:36674917-36674939 GGAAAGGGCGGGAGTGATGAGGG + Intergenic
1147187749 17:38721998-38722020 GGCTGGGGCGGGAGTGGGGCAGG - Exonic
1147556644 17:41483657-41483679 AGCAGGAGCGGGTGTGGGCAGGG - Intergenic
1147556766 17:41484613-41484635 GGCAGGGGGGGCAGTTGGCATGG - Intergenic
1147662602 17:42125076-42125098 GGTAAGGGGGGGAGTGGGAGGGG - Intronic
1147935402 17:44007815-44007837 GGCAAGGGTGGGAGAGGGGAGGG - Intronic
1148020117 17:44547920-44547942 GGAAGGAGGGGGAGTGGGCAAGG + Intergenic
1148152593 17:45405309-45405331 GGGCAGGGCTGGAGTGGGCGGGG - Intronic
1148356330 17:46978346-46978368 GGGCAGGGTGGGAGTGGGTATGG - Exonic
1148566030 17:48633581-48633603 GGCGAGGGCGGGAGGGAGCCTGG - Intergenic
1148798265 17:50207906-50207928 TGCAAAGGCAGGAGGGGGCATGG + Intergenic
1148808008 17:50273842-50273864 GGGACCGGCGGGAGTGGGAAGGG - Intronic
1148896828 17:50843765-50843787 GCCGAGGGTGGGAGGGGGCAGGG - Intergenic
1149315149 17:55431895-55431917 GGGAAGGGCAGGAGAGGGGAAGG + Intergenic
1149651367 17:58278544-58278566 GACAGGGCTGGGAGTGGGCAGGG - Intronic
1150320055 17:64206152-64206174 GGAAAGGGTGGGTTTGGGCACGG - Intronic
1151349165 17:73521538-73521560 GGCAAGGGCGGGAGGCAGGAAGG - Intronic
1151494512 17:74451384-74451406 GGCCCGGGCGGGAGTAAGCAGGG - Intronic
1151698639 17:75731004-75731026 GGCAGGGCAGGAAGTGGGCAGGG + Intronic
1151818842 17:76485956-76485978 GGGAAGGTGGGGACTGGGCAGGG + Intronic
1151835645 17:76581199-76581221 GGCAAGGGAGGGATGGGGGAAGG - Intronic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152210684 17:79001555-79001577 GGCCTGGGCGGGGGTGGGAAGGG - Intronic
1152325802 17:79635223-79635245 GTTAAGGGCTGGAGGGGGCATGG + Intergenic
1152535504 17:80948423-80948445 GGCAGGGGCCGGTGGGGGCAAGG + Intronic
1152539761 17:80969076-80969098 GGCAGGGGCAGGTGTGGGCCTGG - Intergenic
1152554711 17:81047047-81047069 GGCGAGGGAGTGGGTGGGCAGGG + Intronic
1152754986 17:82083481-82083503 CGCCTGGGCGGGGGTGGGCATGG - Intronic
1153427500 18:4982228-4982250 GGGAAGAGTGGGAGGGGGCAAGG + Intergenic
1153829341 18:8907449-8907471 GGTAAGGGTGGGAGTGGGGGAGG + Intergenic
1153869412 18:9303504-9303526 GGGAAGGATGGGAGGGGGCAAGG - Intergenic
1154294284 18:13135986-13136008 GGCTAGGGCGGTCGTGGGGAGGG + Intergenic
1155546256 18:26919025-26919047 GGCAAGAGGGAGAGTGTGCAGGG + Intronic
1155570339 18:27185357-27185379 GGCGCGGGCGGGAGCGGGCGCGG - Intergenic
1156240842 18:35252414-35252436 GGTAAGGAGGGGTGTGGGCAGGG - Exonic
1156340846 18:36209480-36209502 GGGAAGGGTGGGATTGGGGAGGG - Intronic
1156557334 18:38082357-38082379 GACAAGGGCAGGAGTCGGGATGG + Intergenic
1157307567 18:46528315-46528337 AGCAAGGGCGGGGAGGGGCAGGG + Intronic
1157556116 18:48613845-48613867 GGGGAGGGCCGGTGTGGGCACGG - Intronic
1157689789 18:49671926-49671948 GGCGGGGGCGGGGGTGGGCATGG + Intergenic
1157812015 18:50704033-50704055 GGAAAGGGCAGGTGTGGGGAAGG - Intronic
1157933208 18:51845797-51845819 GGTAAGCGTGGGAGGGGGCAAGG - Intergenic
1158005991 18:52672657-52672679 GGGAAGGGGGGAAGGGGGCAAGG - Intronic
1158390253 18:57039208-57039230 GCCCAGGGAAGGAGTGGGCAAGG + Intergenic
1158543069 18:58374445-58374467 GGAAAGGGGGGCAGTGGGGAGGG - Intronic
1158647908 18:59264233-59264255 GGCAAGGCTGGGAGTGGGGCTGG + Intergenic
1159300659 18:66562122-66562144 GTCAGGGTGGGGAGTGGGCATGG + Intronic
1160682226 19:417105-417127 GGCAAAGGAGGGGGTGGGCAGGG + Exonic
1160741168 19:686771-686793 GGGAAGGCAGGGAGTTGGCAAGG - Intronic
1160741280 19:687223-687245 GGCAGGAGCGGGGGTGGGGAGGG - Intronic
1160751783 19:737835-737857 GGCAGGGGCGGGAGGGGACGTGG + Intronic
1160912523 19:1481547-1481569 GGTTTGGGCGGGAGTGGGCTGGG - Exonic
1160996687 19:1885319-1885341 GGCAGGGGCGGGGGCGGGCGCGG - Intronic
1161008649 19:1949306-1949328 GCCAGGGGCTGGAGAGGGCACGG - Intronic
1161133323 19:2604676-2604698 AGGAAGGGAGGGAGTGGGGAGGG + Intronic
1161253798 19:3295217-3295239 GGCAGGGGCGGGGGTGGGGGAGG + Intronic
1161479139 19:4501955-4501977 GGCAGGAGCGCGAGAGGGCACGG + Exonic
1161589092 19:5120765-5120787 GGAAAGGGTGGGAGAGGGAAGGG - Intronic
1161905165 19:7151093-7151115 GGCAAGGGAGGGAGAGAGGAGGG - Intronic
1162353587 19:10166523-10166545 TGCTTGGGCGGGAGTGCGCAGGG - Intronic
1162435293 19:10654510-10654532 GGCAGAGGCGGGAGCGGGCCCGG - Intronic
1162789692 19:13056335-13056357 GGCAGAGGAGGGAGTGGGGAGGG + Intronic
1163149733 19:15403910-15403932 GCCAAGGTTGGGAGTGGGGAGGG - Intronic
1163573866 19:18099199-18099221 AGCCAGGTCGGGAGTGGTCAGGG + Intronic
1163633291 19:18427649-18427671 GGGCAGGGAGGGAGTGGGGAGGG - Intronic
1163643535 19:18475392-18475414 GTCGTGGGCGGGAGTGGACAAGG + Intronic
1163654813 19:18539523-18539545 GGCTGGGGCGGGACAGGGCAGGG - Intronic
1164319538 19:24130750-24130772 GGGAAGAGTGGGAGTGGGGAGGG - Intergenic
1164467753 19:28502208-28502230 GTGAAGGGCGGGAGCAGGCAAGG + Intergenic
1164937863 19:32229188-32229210 CCCAAGGGAGGGACTGGGCAAGG - Intergenic
1164946187 19:32295046-32295068 GGCAAGGACAGGAATGGGCAGGG + Intergenic
1165017461 19:32891226-32891248 GGCAATGGAGGCATTGGGCAGGG - Intronic
1165330923 19:35140923-35140945 GGAAAGGGAGGGAGGGGACAGGG - Intronic
1165380734 19:35477885-35477907 GGGAGGGGCAGGGGTGGGCATGG - Intergenic
1165465969 19:35975031-35975053 TGCAGGGGCAGGAGTGGGGATGG - Intergenic
1165831813 19:38734275-38734297 GGTGAGGGAGGGAGTGGGGAAGG - Intronic
1165901613 19:39172045-39172067 GGCAGGGGCCGGGGAGGGCAGGG + Intronic
1165904833 19:39187524-39187546 AGCCAGGTCGGGAGGGGGCAGGG - Intergenic
1165957654 19:39511662-39511684 GGCAAGGGAGGGAGTGAGAGGGG + Intergenic
1166023442 19:40055245-40055267 GGCAAGGTGGGGAGCGGGCGGGG + Intronic
1166225436 19:41392218-41392240 TGCTAGGGTGGGAGTGGGCGTGG - Intronic
1166265588 19:41682354-41682376 TGCAAGGGAGGGAAGGGGCAGGG - Intronic
1166311907 19:41967617-41967639 GGCAGGCGCTGGTGTGGGCAGGG + Intronic
1166673445 19:44725211-44725233 GGCGGGGGCGGGGGAGGGCAGGG - Intergenic
1166840794 19:45695766-45695788 GGCAAGGGAGGGTGGGGGCTTGG - Intronic
1167433948 19:49468478-49468500 GGCCAGGGCGGGAGCCAGCAGGG - Exonic
1167454533 19:49591468-49591490 GGCGGGGGAGGGAGGGGGCAGGG - Intergenic
1167524127 19:49973067-49973089 AGCAAGGGCAGCATTGGGCATGG + Intergenic
1167684612 19:50949003-50949025 GGCCAGGGTGGGAGTAGCCAGGG + Exonic
1167767973 19:51496930-51496952 GGCAAGGCCAGCAGTGGGCGTGG - Exonic
925165701 2:1714340-1714362 GGCATGGGAGCGAGTGGGCCAGG - Intronic
925876590 2:8316517-8316539 GGCAAGAGAGGGAGTGAGCAGGG + Intergenic
926188031 2:10706999-10707021 AGCCAGGCAGGGAGTGGGCACGG + Intergenic
926692840 2:15748986-15749008 GACAAGAGCAAGAGTGGGCAGGG - Intergenic
927158456 2:20236044-20236066 GGCAGGGGAGCAAGTGGGCAGGG + Intergenic
927192289 2:20524935-20524957 GGCAGAGGCGGAAGTGGGGAGGG + Intergenic
927508338 2:23628880-23628902 GGGGAGGGCGGGGGTGGGCCTGG + Intronic
927573766 2:24183154-24183176 GGGAAGGGCAGGAGGGGGCGAGG - Intronic
928072153 2:28227712-28227734 GGCCAGGGCTGGAATGGGAAGGG - Intronic
928283174 2:29966423-29966445 GGCCAGGGCAGAACTGGGCAGGG - Intergenic
929533192 2:42764865-42764887 GGCAAGGAGTGGAGTGGACAAGG - Intergenic
929891037 2:45918766-45918788 GGCGAGGGGGGGAATGGGAAGGG + Intronic
930023180 2:47013581-47013603 GGCAAGGGCGGCCGTTGGCTGGG - Intronic
930160986 2:48155975-48155997 GGCAATGGTGGTAGTGGACAGGG - Intergenic
930700631 2:54456097-54456119 GGAGCGGGCGGGAGTGGGGAGGG + Intergenic
931152394 2:59588868-59588890 GACAAAGAAGGGAGTGGGCAGGG - Intergenic
931220379 2:60283849-60283871 GGAACGGGCTGGAGTGGGGAGGG - Intergenic
931350462 2:61483365-61483387 GGGAAGGGCAGGAGTGGGTGAGG + Intronic
932036579 2:68252305-68252327 GGCACGCGAGGGAGCGGGCAGGG + Exonic
932403638 2:71499672-71499694 GGCAAGGGAAGGAGAGGCCAAGG - Intronic
932657153 2:73620065-73620087 GGGATGGTGGGGAGTGGGCATGG + Intergenic
932663826 2:73680308-73680330 GGGATGGTGGGGAGTGGGCATGG + Intergenic
932886546 2:75554184-75554206 GACAAGGGCAGGAGGGGGCAAGG + Intronic
933767570 2:85720503-85720525 GGCAGGGGCTAGATTGGGCAGGG + Intergenic
933796916 2:85927301-85927323 GGGAGGGGTGGGAGTGGGAATGG - Intergenic
934112696 2:88757390-88757412 GACAGGGGCCGGAGTGGCCAGGG + Intergenic
934553607 2:95276453-95276475 GGCAAGGGCGGGAGAGGAGGCGG - Intronic
934655601 2:96115503-96115525 GCCAAGGGGGGGCCTGGGCAGGG - Exonic
934717845 2:96553586-96553608 GCCAAGGCCGGGGATGGGCAGGG + Intergenic
935185810 2:100731914-100731936 GGGCAGGGCTGGTGTGGGCAGGG + Intergenic
936163903 2:110103851-110103873 GACAGGGGCCGGAGTGGCCAGGG + Intronic
936449734 2:112625231-112625253 GGACAGGGCGGGAGTGGGGGAGG + Intergenic
936531339 2:113278687-113278709 GACAGCGGAGGGAGTGGGCACGG - Intronic
937305834 2:120870115-120870137 GGCAAGGGGGTGAGGGAGCACGG - Intronic
937982144 2:127622111-127622133 GGCAGGGGTGAGAGCGGGCAGGG + Intronic
938027815 2:127965497-127965519 GGCGGGGCAGGGAGTGGGCATGG + Intronic
938403880 2:131016458-131016480 GGCATGGGGGGCACTGGGCAGGG - Intronic
938414446 2:131093046-131093068 GGCAAGGCCGGGCGGGGGCCGGG - Intronic
938614425 2:132982650-132982672 GGAAAGGGAGGGAGGGGGCAAGG - Intronic
938730503 2:134143375-134143397 GGAGAGGGCAGAAGTGGGCAGGG + Intronic
938735750 2:134185137-134185159 GGGAAGGGTGGGAGTGGGTGAGG + Intronic
938797707 2:134732118-134732140 GGGAAGGGTGGGAGGGGGCGAGG - Intergenic
939982252 2:148795848-148795870 GGGAAGGACTGGAGTGAGCAGGG - Intergenic
940374859 2:152946338-152946360 GGCAAGAGAGGGAGTGAGGAAGG - Intergenic
940706721 2:157114576-157114598 GGGAAGGGTAGGAGCGGGCAAGG + Intergenic
941029427 2:160493864-160493886 GGGAAGGGCGGGCGGGGGCGGGG + Intergenic
941874819 2:170421631-170421653 GACAAGGGCAGAAGAGGGCACGG - Intronic
942574959 2:177353601-177353623 GGGAAGGGTGGGAGGGGGCAAGG - Intronic
942745141 2:179223266-179223288 GCCTAGGGCTGGAGTGGGTATGG + Intronic
942920937 2:181373020-181373042 GGTAGGGGCAGGAGTGGGGAGGG - Intergenic
943118435 2:183704575-183704597 GGACAGGGAGGGAGTGGGCAAGG + Intergenic
943907355 2:193516368-193516390 GGGAAGGGGGGGAGTGGGGAGGG + Intergenic
944081372 2:195792218-195792240 GGAAAGGGAGTGAGGGGGCAAGG + Intronic
944197856 2:197074117-197074139 GGCGAGGGTGGGGGTGAGCATGG - Intronic
944382468 2:199127315-199127337 GGTAAGGGTGGGGGTGGGCAGGG + Intergenic
944553378 2:200865454-200865476 GGTAAGGGCGGGAGGGGCCTGGG + Intergenic
946131688 2:217611530-217611552 GGCAAGAGTGAGAGTGAGCAGGG - Intronic
946146903 2:217738059-217738081 GCCCAGGGTGGGAGTGGGAATGG - Intronic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946253496 2:218427845-218427867 GGCCAGGGTGGGAGTAGGCGAGG - Intronic
946410891 2:219514670-219514692 GGCTAGGGAGGGACAGGGCAGGG + Exonic
946549016 2:220779821-220779843 GGGAAGGGAGGGAGGGAGCAAGG + Intergenic
947713561 2:232329147-232329169 GGACAGGGCAGGAGTGGGGATGG - Intronic
947983245 2:234427419-234427441 GGCCAGAGCTGGAGTGGCCAAGG + Intergenic
948040916 2:234900840-234900862 GCCCAGGGCGAGGGTGGGCAGGG - Intergenic
948660108 2:239501744-239501766 GGCAAGGGAGGGAGAGGGGTAGG + Intergenic
948853916 2:240721313-240721335 GGCATGGGCAGGAGGCGGCAGGG - Intronic
1168840279 20:905625-905647 GGCAAGGGAGGGAGTCAGCTTGG + Intronic
1169144706 20:3244726-3244748 AGCATGGGCAGGAGTGGGCTAGG + Intergenic
1169252277 20:4069801-4069823 GGAATGGGTGGGTGTGGGCAGGG - Intergenic
1169910010 20:10640337-10640359 GCCAAGGGAGAGATTGGGCATGG - Intronic
1170535365 20:17335636-17335658 GGGAAGGATGGGAGGGGGCAAGG - Intronic
1170588313 20:17752200-17752222 GGCAGGGGAGGGGCTGGGCATGG + Intergenic
1170630206 20:18058637-18058659 GGCAACGGTGGGAGTGGGCGAGG - Intronic
1170948438 20:20912439-20912461 GGCAAGGGAGGAAATGAGCAAGG + Intergenic
1171179627 20:23083184-23083206 GGCTAGGGCGAGAGAGGCCAGGG - Exonic
1171403242 20:24892760-24892782 CGCAAGGGAGGGGGTGAGCAGGG + Intergenic
1171981767 20:31633553-31633575 GGCGGGGGCGGAAGAGGGCAGGG + Intergenic
1172010020 20:31841239-31841261 GGGAAGGAAGGGGGTGGGCAGGG + Intergenic
1172010634 20:31844067-31844089 GGCAAGGGAGAGACTGGGCAGGG - Intergenic
1172032371 20:31991086-31991108 GGAGGGGGCAGGAGTGGGCAGGG + Intronic
1172133562 20:32672736-32672758 GGCAGGGGAGGGAGTGGGGAGGG - Intergenic
1172444175 20:34984624-34984646 GGGAAGGGCGGGGTGGGGCAGGG - Intronic
1172612914 20:36265074-36265096 GGCCAGAGCGGGGGTGGGTAGGG + Intronic
1172646380 20:36472854-36472876 AGCAAGGGTGGGAGTGGGTAGGG - Intronic
1172650764 20:36500004-36500026 GGCTTGGGCGGGATGGGGCAAGG + Intronic
1172757758 20:37299085-37299107 GGCAGGGTCGGGTGGGGGCAGGG + Intronic
1172773128 20:37393026-37393048 GGCCTGGGCGGGAGCGGGGAGGG - Intronic
1172791169 20:37506479-37506501 GCAAAGGGCGAGGGTGGGCAAGG - Intronic
1172793588 20:37522581-37522603 GGGTGGGGCGGGGGTGGGCACGG + Intronic
1172843595 20:37916330-37916352 GGCAAGCGCGGGAGTGTTCAGGG - Intronic
1172900229 20:38329336-38329358 GGAGAGGGCGGGACTGGGCAGGG - Intronic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173294143 20:41740687-41740709 GGGCAGGGAGGGAGGGGGCAGGG - Intergenic
1173572690 20:44087745-44087767 GGCTCTGGCGGGAGTGGGCAGGG - Intergenic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1173729242 20:45317113-45317135 GACAAGGGAGGGAGTGAGCCGGG - Exonic
1173731964 20:45335437-45335459 GGACAGGGTGGGAGTGGGGAAGG - Intronic
1173855865 20:46250538-46250560 GGCAGTGGCAGGAGTGTGCATGG + Intronic
1174147550 20:48462743-48462765 GGAAAGGGCAGGAGTGGACCCGG - Intergenic
1174390748 20:50217010-50217032 GGCAGGGGCTGGGGTGGACATGG - Intergenic
1175400261 20:58696223-58696245 AGCAAGAGCAGGAGTGGGCGTGG - Intronic
1175523599 20:59618588-59618610 GGGAAGGGCAGGAGAGGGAAGGG + Intronic
1175564995 20:59967655-59967677 CGAAAGGGTGGGAGTGGGGAGGG - Intronic
1175581235 20:60101598-60101620 TGCAAGAGTGAGAGTGGGCATGG + Intergenic
1176098875 20:63356135-63356157 GGCAGGGGCGGGACAGGGCCAGG + Intronic
1176098907 20:63356211-63356233 GGCAGGGGCGGGACAGGGCCAGG + Intronic
1176195904 20:63836240-63836262 GGCAGGGGAGAGCGTGGGCAGGG + Intergenic
1176301685 21:5101695-5101717 GGCAAGACAGGGAGGGGGCAGGG + Intergenic
1176742288 21:10615810-10615832 GGCGAGGAGGGGAGGGGGCACGG + Intergenic
1177727526 21:24989065-24989087 GGCGAGGGCTGGAGTGGCGAGGG + Intergenic
1177727538 21:24989110-24989132 GGCGAGGGCTGGAGTGGCGAGGG + Intergenic
1178471929 21:32901535-32901557 GGAGAGGGAGGGAGGGGGCATGG + Intergenic
1178526045 21:33330293-33330315 GGCAGGGGAGTGAGTGGGGAGGG - Intronic
1179007575 21:37529018-37529040 AGCAGGGGAGGGGGTGGGCATGG - Intergenic
1179605800 21:42514350-42514372 GGCCCGGGCCGGGGTGGGCAGGG - Exonic
1179726679 21:43344882-43344904 GGCAAGGTCGGGTGGGGGCTGGG - Intergenic
1179855346 21:44160204-44160226 GGCAAGACAGGGAGGGGGCAGGG - Intergenic
1180700606 22:17779588-17779610 GGAAGGGGCGGGATTGGACAGGG + Intergenic
1180801350 22:18633585-18633607 GGGAAGGCCAGGAGTGGTCATGG - Intergenic
1180933277 22:19607649-19607671 GGCAGGGGAGGGGGTGGGCAAGG + Intergenic
1181220371 22:21361676-21361698 GGGAAGGCCAGGAGTGGTCATGG + Intergenic
1181283971 22:21739128-21739150 GGTTAGGGAGGAAGTGGGCATGG - Intergenic
1181851562 22:25753224-25753246 GGCAGGGGCGGGTGTGGGGGGGG + Intronic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1182079408 22:27518533-27518555 GGCTAGGGAGGGAGGGGGCTTGG - Intergenic
1182233315 22:28855656-28855678 GGCAAGGTCGGTAGAGGGAAAGG - Intergenic
1182869020 22:33629608-33629630 GGCAGGGGTTGGAGTGGGAATGG + Intronic
1183184436 22:36284062-36284084 GGCAAAGGGGCGGGTGGGCAGGG + Intronic
1183248369 22:36711055-36711077 GTCAAGGCCCTGAGTGGGCAAGG - Intergenic
1183361340 22:37384769-37384791 GGTCAGGTCGGGAGAGGGCAGGG - Intronic
1183404899 22:37625651-37625673 GGCAGGGGCTGGTGTGGCCAAGG + Intronic
1183704678 22:39469381-39469403 AGCAAGGAGGGCAGTGGGCATGG - Intronic
1184074673 22:42168705-42168727 TGCAAGGGGGGGAGAGGGCACGG + Exonic
1184089224 22:42283671-42283693 GGCCAGGGCAGGGCTGGGCAGGG - Intronic
1184242866 22:43220611-43220633 GGCAAAGGCGGCATGGGGCAGGG + Intronic
1184403364 22:44286542-44286564 GGCAGGGGAGGAAGGGGGCAGGG - Intronic
1184457976 22:44622119-44622141 AGCAAGGGTGGGAGGGGGAAGGG + Intergenic
1184590048 22:45476109-45476131 GGGAGGGGCGGGCGTGGGGATGG + Intergenic
1185107590 22:48883039-48883061 GGCCGGGACGGGAGTGGGGACGG - Intergenic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185229778 22:49673492-49673514 GGGAAGGGAGGGAGAGGGGAAGG + Intergenic
1185247456 22:49780726-49780748 TCCCAGGGCGGGAGTTGGCAGGG - Intronic
1185373407 22:50471112-50471134 GCCAAGGGGAGGAGTGGGGAGGG - Intronic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
1185394820 22:50581586-50581608 GGCTGGGGCAGGAGTGGGAAGGG + Intronic
1185420327 22:50731317-50731339 GGCCGGGGCGGGAGTGGGGGTGG - Intergenic
949987336 3:9551618-9551640 TGCAGGGGTGGGAGTGGGGATGG + Intronic
950553530 3:13681736-13681758 GGCATGGGCTGGGGTGGGGAGGG + Intergenic
950680258 3:14580268-14580290 GGGAAGGGCAGGAGAGGCCATGG - Intergenic
951080368 3:18444937-18444959 GGCGGGGGCGGGAGGGGGAAGGG + Intronic
951372127 3:21862521-21862543 GGCAATGGTGGGAGTTGCCATGG - Intronic
952141586 3:30484980-30485002 GGGAAGGGAGGGAGGGGGCAAGG + Intergenic
952293886 3:32043914-32043936 GGGAATGGAGGGAGGGGGCAAGG + Intronic
952347603 3:32502875-32502897 GCCAAGGGCGGGGGCGGGAAGGG - Exonic
952616113 3:35276224-35276246 AGCAAAGGTGGGTGTGGGCAAGG - Intergenic
952746583 3:36787610-36787632 TGCAGGGGTGGGTGTGGGCAGGG - Intergenic
952852350 3:37739816-37739838 GGTGGGGGCGGGAGTGGGCCAGG + Intronic
952919315 3:38274388-38274410 TGCTAGGCAGGGAGTGGGCAGGG - Intronic
953489431 3:43336283-43336305 AGCAAGGGAGGGAGAGAGCAAGG - Intronic
953839733 3:46379987-46380009 GGCAGGGGAGGAAGTGAGCAAGG + Intergenic
953924637 3:46976407-46976429 CGCATGCGCGGGGGTGGGCAAGG - Intronic
953947946 3:47164660-47164682 GGCAAGGGAGAGAGAGGGCGAGG - Intergenic
953980041 3:47409061-47409083 GGAGAGGGCCGGTGTGGGCAGGG - Exonic
954198111 3:49008000-49008022 GGCGGGGCCGGGAGAGGGCAAGG + Intronic
954252630 3:49379968-49379990 GGGAAGGGCGGGAATTGGGATGG - Intronic
954575151 3:51671703-51671725 GGCAAGGCCCGGGGTGAGCAGGG + Exonic
954602252 3:51878698-51878720 GGTAAGGGTGGGCATGGGCATGG + Intergenic
954793016 3:53146697-53146719 TGCAAGGGGGGGACAGGGCAAGG + Intergenic
956666289 3:71645170-71645192 GGCCAGAGCGGGAGTGTGCTTGG + Intergenic
957602018 3:82349495-82349517 GGAAAGGGTGGGAGTGGGTGAGG - Intergenic
958479401 3:94627723-94627745 GGCAAGGACAGGAGTGAGGAGGG - Intergenic
958861389 3:99449048-99449070 GGAAAGGGCGGGAGAGGGTGAGG - Intergenic
960684000 3:120279156-120279178 GGGAAGGGAGGGAGGGGGCATGG + Intronic
960896829 3:122514647-122514669 GGCGAGGGCGGGTGCCGGCAGGG - Intronic
961044404 3:123698882-123698904 GGTGAGGGAGGGAGTGGGGAGGG + Intronic
961065589 3:123872702-123872724 GGCAATGCCTGGAGAGGGCATGG - Intronic
961143120 3:124572230-124572252 GGGAAGGGCTGCAGTGGGAAGGG + Intronic
961427739 3:126861485-126861507 GGCAGGGGCAGGGGTGGGAATGG - Intronic
961519627 3:127459446-127459468 GGCCAGGGCTGGAGCAGGCAGGG + Intergenic
961655885 3:128441550-128441572 TGCAAGCGCTGGAGTGGCCAAGG + Intergenic
962146824 3:132848388-132848410 GCTAAGGGCTGGAGTTGGCAAGG - Intergenic
962317359 3:134367204-134367226 GGCAAGGGTGCGAGTGTGCAAGG + Intronic
962653198 3:137516842-137516864 GGCAGGGGCTGGAAGGGGCAGGG + Intergenic
963111198 3:141689534-141689556 GGAAAGGGTGCGGGTGGGCAGGG + Intergenic
964436503 3:156659000-156659022 GGAAAGGGGAGAAGTGGGCAGGG - Intergenic
965216372 3:165869330-165869352 GGGAAGAGTGGGAGGGGGCAAGG - Intergenic
966221826 3:177558931-177558953 GGGAAGGGTGGGAGGGGGCGAGG - Intergenic
966744169 3:183259999-183260021 GGCAGGGGAGGAGGTGGGCAGGG - Intronic
966943232 3:184759983-184760005 GGCAGGGCAGGGAGGGGGCATGG + Intergenic
967168595 3:186806234-186806256 ATCAAGGGCAGGAGTGGGGAAGG + Intronic
967848634 3:194064837-194064859 GGAGAGGGCAGGAGAGGGCAAGG - Intergenic
967997051 3:195174676-195174698 GGGAAGGGAGGGAGGGGGGAGGG - Intronic
968178128 3:196568833-196568855 GGCAGGGGCGGGAGTGGTGGAGG + Exonic
968629256 4:1641784-1641806 GGCTGGGGCGGGCATGGGCAGGG - Intronic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
968985124 4:3870799-3870821 GGCGAGGGTGGGGGTGGGGAGGG + Intergenic
969021853 4:4144269-4144291 GGGAAGGGAGGGAGGGGGCGCGG - Intergenic
969272173 4:6110478-6110500 GCCAAGGGCTGGAGAGGGCGGGG - Intronic
969417198 4:7068428-7068450 CGCAAGGGCGGGTGCGGGCCGGG - Intergenic
969422099 4:7103448-7103470 GGCAAGGGCGGGGCAGGGCGGGG - Intergenic
969498628 4:7540138-7540160 GGCAGGGGCGGGGAGGGGCAGGG - Intronic
969639704 4:8389431-8389453 GGCAAAGGCTGGGGTGGGGAGGG - Intronic
969732014 4:8963146-8963168 GGGAAGGGAGGGAGGGGGCGCGG + Intergenic
969988350 4:11235143-11235165 GGGAAGGGAGGGAGAGGGGAGGG - Intergenic
972066059 4:34945625-34945647 GGCAAGGCCGGAAGTGGGTGAGG - Intergenic
972793745 4:42397295-42397317 GGCATGGGCGGGGGTGGCCGGGG + Intergenic
972955930 4:44391174-44391196 GGAAAGGGTGGGAGTGGGTGAGG + Intronic
972960640 4:44448396-44448418 GGGAAGGGCGAGGGTGCGCAGGG + Exonic
974074299 4:57154852-57154874 GGCAAGGGAAGGGGCGGGCAGGG - Intergenic
974379919 4:61126025-61126047 GGAAATGGAGGGAGTGGGGAAGG - Intergenic
974413230 4:61569071-61569093 GGCAGGGGTGGGAGTGGGGCCGG + Intronic
976113042 4:81697377-81697399 GAGAAGGGTGGGAGTGGGAAAGG - Intronic
978554637 4:109966198-109966220 TGCAAGGGTGGGAGGGTGCAGGG - Intronic
980481611 4:133395172-133395194 GCCACGGGCTGGAGAGGGCAAGG + Intergenic
982129252 4:152212507-152212529 GTCAAGGCCAGGAGGGGGCAGGG + Intergenic
983406453 4:167337114-167337136 GTCAAGGCTGGGAGTGGGCATGG - Intergenic
983689063 4:170446010-170446032 GGAAAGTGAGGGAGTGGGGAAGG + Intergenic
985517486 5:354403-354425 GGCACGGCCTGGCGTGGGCAGGG - Intronic
986006406 5:3672412-3672434 GGCCATGGCTGGAGTGTGCAGGG + Intergenic
986259490 5:6131797-6131819 GGAAAGGGTGGGAGGTGGCAAGG + Intergenic
986305611 5:6512106-6512128 GGCCAGGGGGGAACTGGGCAAGG + Intergenic
986482854 5:8206099-8206121 GGAAGGGGCTGGAGAGGGCATGG - Intergenic
986680854 5:10231621-10231643 AGCAAGGGCGGGGTGGGGCAGGG - Intronic
987074492 5:14368034-14368056 GCCAAGGGAGGGTGTGGTCAGGG - Intronic
989665395 5:43847917-43847939 GGCAAGGGTGGGAGTGGGTGAGG - Intergenic
990207970 5:53450691-53450713 GGGAAGGGCTGGCCTGGGCAAGG - Intergenic
990446205 5:55896617-55896639 GGGGAGGGAGGGAGTGGGCAGGG - Intronic
990446222 5:55896657-55896679 GGGAGGGGAGGGAGTGGGGAGGG - Intronic
990641795 5:57793941-57793963 GGGAAGGGAGGGAGGGGGCAAGG - Intergenic
991419228 5:66424429-66424451 GGAAAGGGTGGGGGTTGGCAAGG - Intergenic
991686455 5:69186818-69186840 GGAAAGGGTGGGTGTGGGTAGGG - Intergenic
992527966 5:77630155-77630177 GGCCGGGGCGGGACGGGGCAGGG + Exonic
995129805 5:108618333-108618355 GTAAAGGGTGGGAGGGGGCAAGG + Intergenic
995188613 5:109297526-109297548 GGCAGGGGCGGGGGCGGGGATGG + Intergenic
995650566 5:114363058-114363080 GGCGGTGGCGGGAGCGGGCACGG + Exonic
996567749 5:124897905-124897927 GGCAAGGGTGGAAATGGGGATGG - Intergenic
996823373 5:127654759-127654781 GGGAAGGGAGGGACTGAGCAAGG + Intronic
996996362 5:129701152-129701174 GGCAAGAGAGGGTGTGTGCAGGG - Intronic
997386754 5:133479669-133479691 GCCTAGGGCTGGGGTGGGCATGG + Intronic
997427942 5:133817010-133817032 GGCAAGTGAGGCAGTGGGCCTGG - Intergenic
997690216 5:135823140-135823162 GGCTAGGGTGGGAGTCGGGAAGG + Intergenic
998429762 5:142060814-142060836 GGCAAGGACAGGAGTGGGAGTGG - Intergenic
999247695 5:150163949-150163971 GGGAAGGGCGGCAGGGGTCAAGG - Intergenic
999282346 5:150374041-150374063 GTCAAGGTGGGGAGTGGGGAGGG + Intronic
999399336 5:151252757-151252779 GGGAAGGGCGGGGCCGGGCAGGG - Intronic
999853569 5:155569092-155569114 GGAAAGGGAGGGAAAGGGCAAGG - Intergenic
1001106924 5:168862210-168862232 GGAAAGGGCGGCAGGTGGCAAGG + Intronic
1001509686 5:172311202-172311224 GCCAAGGGCGGGGGGTGGCAGGG + Intergenic
1001821855 5:174716563-174716585 GGGGTGGGTGGGAGTGGGCAGGG + Intergenic
1002053167 5:176583485-176583507 GGGAAGGGCTGGAGTGCTCAGGG + Intronic
1002093562 5:176818105-176818127 GGGAAGGGCGGGCAGGGGCAGGG - Intronic
1002259929 5:177985828-177985850 GGGCAGGGCGAGTGTGGGCACGG + Intergenic
1002259937 5:177985858-177985880 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259941 5:177985873-177985895 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259945 5:177985888-177985910 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259961 5:177985961-177985983 GGGCAGGGCGAGTGTGGGCACGG + Intergenic
1002463032 5:179386060-179386082 AGCAAGGGCGGGGCTGGGCGTGG + Intergenic
1002978655 6:2112031-2112053 GGCCAGAGCGGGCGTGGGGAAGG - Intronic
1003007779 6:2397747-2397769 AGCAAGGGCAGGAGTGGTCATGG - Intergenic
1003698329 6:8435456-8435478 GGAAAGTGCAGGAGTGGGCGAGG - Exonic
1003869427 6:10390368-10390390 GGCTAGGGGAGGAGCGGGCAGGG + Intergenic
1003939950 6:11014571-11014593 GGCAAGGAGGATAGTGGGCATGG - Intronic
1003940418 6:11019647-11019669 GGCAAGGAGGATAGTGGGCATGG + Intronic
1005582192 6:27245985-27246007 GGCAAGGGAGTGAGTGGGGAGGG - Intergenic
1006106339 6:31719147-31719169 GCCCAGGGCTGGAGTGGGCCGGG + Exonic
1006303199 6:33204851-33204873 GGCACGGGGAGGAGAGGGCAGGG - Intronic
1006376975 6:33677081-33677103 GTCAAGGGCGTGAGTGGCCAAGG + Exonic
1006390150 6:33753586-33753608 GGCTGGGGTGGGAGTGGGGATGG + Intergenic
1006793368 6:36717592-36717614 GGTAATGGCAGGAGTGGGAAGGG + Intronic
1006970884 6:38043605-38043627 GGGAAGAGCGGGAGAGGGAAAGG - Intronic
1006981824 6:38153669-38153691 GGGAAGGGTGGGGGTGGGCCTGG + Exonic
1007181886 6:39934492-39934514 AGCAAGGGCGGGGAGGGGCAGGG + Intronic
1007289234 6:40772697-40772719 GGTAAGGGCAGGAGTGGGACGGG - Intergenic
1007370294 6:41422443-41422465 GGGAAGGGAGGGAGGGGACATGG - Intergenic
1007691866 6:43707650-43707672 GGCAGGGGCAGGAGTCAGCAGGG + Intergenic
1007851603 6:44808117-44808139 GGCAAGGGCCGGTGAGGGCGGGG - Intergenic
1008876810 6:56338453-56338475 GGCCAGGGTGAGAGGGGGCAGGG - Intronic
1011171872 6:84513789-84513811 GGGAAGCGTGGGAGGGGGCAAGG - Intergenic
1012175484 6:96077037-96077059 GGCAAGGGCTGGGGAGGGAATGG - Intronic
1012570992 6:100728754-100728776 GGCAAAGGAGAGAGTGGGAAAGG - Intronic
1013095247 6:106939094-106939116 GGAAAGCACGGGAGTGGCCAAGG - Intergenic
1014447270 6:121543470-121543492 GGAAAGGGTGGGAGGGGGCGGGG - Intergenic
1015361863 6:132349122-132349144 GGAAAGGGTGGGGGTGGGCAAGG - Intronic
1015461375 6:133495500-133495522 GGCAAGGGCTGGACCAGGCAAGG + Intronic
1015895619 6:138013675-138013697 GGGAAGAGCGGGAGCAGGCAGGG + Intergenic
1016268682 6:142261964-142261986 GGCAAGGGCAGGAGTGAGAGAGG - Intergenic
1016546426 6:145229274-145229296 GGGAAGGGTGGGAGAGGGGAGGG - Intergenic
1017019791 6:150130887-150130909 GGCAAGGGGTGGAGAGGGCAGGG + Intergenic
1017183167 6:151573722-151573744 GGCAAGAGAGAGAGTGTGCAGGG + Intronic
1017189987 6:151642855-151642877 GGGAAGGGTTGGAGGGGGCAAGG - Intergenic
1018380259 6:163252451-163252473 GGCAGGGGCCGGAGAGGGCTGGG + Intronic
1018839413 6:167507817-167507839 GGGAAGGGAGGGAATGGGGAGGG - Intergenic
1019125881 6:169839917-169839939 GGCATGGCGTGGAGTGGGCATGG - Intergenic
1019125980 6:169840311-169840333 GGCATGGTGTGGAGTGGGCATGG - Intergenic
1019408858 7:898025-898047 GGCAAGGCTGGGAGAGGGCTGGG + Exonic
1019490798 7:1312313-1312335 GGCAAGGCCTGGGCTGGGCAGGG + Intergenic
1019529363 7:1495858-1495880 GCCACGGGCGGGAGTGGGGAGGG - Intronic
1019552008 7:1607874-1607896 GGCAAGGGTTGGGCTGGGCAGGG + Intergenic
1019660161 7:2219665-2219687 GGCAAGGGGGGCAGAGGGCAGGG + Intronic
1019697306 7:2452721-2452743 GGGGAGGGAGGGAGTGGGGAGGG - Intergenic
1019820899 7:3241950-3241972 GGCAAGGGGTGGAGGGGACAAGG + Intergenic
1020096707 7:5373654-5373676 GGCAAGAGCGGGTGTGTGCATGG + Intronic
1020309274 7:6856299-6856321 GGGAAGGGAGGGAGGGGGCGCGG - Intergenic
1021334863 7:19387420-19387442 GGGAAGGCTGGGAGGGGGCAAGG - Intergenic
1021594742 7:22303005-22303027 GCCAGGGGTGGGAGTGGGTAGGG - Intronic
1021673483 7:23057113-23057135 GGGAAGGTGGGGAGTGGGCCTGG + Intergenic
1021918996 7:25464882-25464904 GGGAAGTGTTGGAGTGGGCAAGG + Intergenic
1021992454 7:26151966-26151988 GCCAAGGGCGGGAGTTGGGGTGG - Intergenic
1022656983 7:32328641-32328663 AGCAAGGGGTGGAGTGGGGATGG - Intergenic
1023714918 7:43034238-43034260 GCCAAGGGCTGGAGTGAGAAAGG + Intergenic
1023839422 7:44088070-44088092 GGCCTGGGCAGCAGTGGGCAGGG + Intergenic
1024059075 7:45685094-45685116 CGCTGGGGCGGGAGAGGGCATGG + Intronic
1024582595 7:50812232-50812254 GGCAGGGGAGGAAGTGAGCAAGG + Intergenic
1025093687 7:56082101-56082123 GGCAAGGGAGGAAGTAGGCAGGG - Intronic
1025265023 7:57449672-57449694 GGCGAAGGCGGGAGAGGGGAGGG - Intergenic
1025983310 7:66425799-66425821 GGCAAGGGGGATAGTGGGGATGG + Intergenic
1026444997 7:70476367-70476389 TGAAAGGTTGGGAGTGGGCAGGG - Intronic
1026491100 7:70864300-70864322 GCCAAGGGCTGGAGTGGGGAGGG - Intergenic
1026853371 7:73738275-73738297 GGGCTGGGCGGGAGTGGGCGGGG - Intronic
1026972625 7:74477496-74477518 GCCAGGGGAGGGAGGGGGCATGG + Intronic
1028498970 7:91496923-91496945 GGGAAGGTTGGGAGGGGGCAAGG - Intergenic
1028831073 7:95327145-95327167 GGCAAGAGAGGGAGTGGGGGTGG - Intergenic
1028896422 7:96046839-96046861 TGCAAGGGGAGGAGTGGGCTTGG + Intronic
1029217948 7:98965374-98965396 GGCAGGGGCTGTGGTGGGCATGG + Intronic
1029252471 7:99246768-99246790 GGTGAGGGTGGGGGTGGGCATGG + Intergenic
1029362963 7:100100641-100100663 GGGAAAGGCGGCAGTGGGCTGGG - Intronic
1029370637 7:100148653-100148675 GGGAGGGGCGGGAGTAGGCCGGG - Intergenic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1032087543 7:128891709-128891731 GGCGAGGCTGGCAGTGGGCATGG + Exonic
1032179708 7:129664147-129664169 GGAAAGGGAGGGAGAGGGTAGGG + Intronic
1032464248 7:132133992-132134014 GGCATGGGCTGGATTGGGCTAGG - Intronic
1033056338 7:138058409-138058431 GGCAGGGGCCGTAGTGGGTAGGG - Intronic
1033346303 7:140527757-140527779 GGTCAGGGCGGGAGAGTGCAGGG - Intronic
1033457066 7:141512123-141512145 GGGAAGGGCAGGAGTGGGCGAGG - Intergenic
1034398873 7:150848310-150848332 GGCAGGGGCGGGGGTGGGAGTGG - Intronic
1035296311 7:157868667-157868689 GGTGAGGGAGGGAGTGAGCAAGG - Intronic
1035311860 7:157974671-157974693 GGCAGGGGCTGGGGTGGGCAGGG + Intronic
1035730484 8:1850476-1850498 GGCAAGTGCGGAAGACGGCATGG + Intronic
1036390359 8:8319129-8319151 GGCAGGGGGGTGTGTGGGCAGGG + Exonic
1037605672 8:20435415-20435437 TGCAAGGCCTGGAGTGGGGACGG + Intergenic
1037722918 8:21459993-21460015 GGCAAGGGAGGAAGTGGGGTTGG - Intergenic
1038455472 8:27669667-27669689 GGCAAGGGCAGGTGGTGGCAGGG + Intronic
1038704503 8:29880957-29880979 GGTAGGGGTGGGAGTGGGGATGG + Intergenic
1039095088 8:33875332-33875354 AGGAAGGGTGGGAGGGGGCAAGG - Intergenic
1039268470 8:35854542-35854564 AGCGAGGCTGGGAGTGGGCATGG + Intergenic
1039440933 8:37594999-37595021 GGTGAAGGAGGGAGTGGGCATGG - Intergenic
1039566023 8:38553357-38553379 GCCAAGGGTGGGGGTGGGGAAGG - Intergenic
1040736604 8:50515853-50515875 GGAAGGGGCGGCTGTGGGCACGG + Intronic
1041177796 8:55214689-55214711 GCCCAGGGGTGGAGTGGGCAGGG + Intronic
1041292569 8:56320659-56320681 GGCAGGGGCAGGAGTGGGTGCGG + Exonic
1041365704 8:57101736-57101758 GGAAAGAGCGGGAGTGGGTGAGG - Intergenic
1041690044 8:60679221-60679243 GGCGAGGGCGGGAGGGGGCCGGG + Intronic
1041717021 8:60941640-60941662 GGCAAGGGCGGGAGAAAGGATGG + Intergenic
1041897604 8:62944007-62944029 GGGAAGGGTGGGAGTGGGTGAGG + Intronic
1043526679 8:81105064-81105086 GCTAAGGGTGGGAGTGGGCAGGG - Intronic
1043568329 8:81572097-81572119 GGGAAGAGTGGGAGGGGGCAAGG - Intergenic
1043827429 8:84946352-84946374 GGAAAGGGTGGGAGTTGGGAAGG - Intergenic
1043954307 8:86342967-86342989 GGGCAGGGCGGGAGGGGGCACGG + Intronic
1045936128 8:107681568-107681590 GGGAAGGGAAGGAGGGGGCAAGG - Intergenic
1046455329 8:114452393-114452415 GGCAATGGCTGGAGTTGGTATGG + Intergenic
1046745517 8:117871789-117871811 GGGTAGGGCTGGGGTGGGCACGG + Intronic
1046788310 8:118292137-118292159 GGAAAGGGCAGGAGGGGGTAGGG + Intronic
1047063795 8:121257615-121257637 GGCCAGGGGTGGAGTGGTCATGG + Intergenic
1047315239 8:123727052-123727074 GGAAAGGGTGGGAGAGGGTAAGG + Intronic
1047342728 8:123998829-123998851 GGCTAGGGCGGCAGTGGTCATGG - Intronic
1047437515 8:124847211-124847233 GGCAAGGGCCTGAGTGGGTCAGG + Intergenic
1048927972 8:139287754-139287776 GCCAAGGGCAGGAGTGGGCAGGG - Intergenic
1049207127 8:141368741-141368763 AGCAAAGCTGGGAGTGGGCAGGG + Intergenic
1049272102 8:141701311-141701333 GGCCAGTGCGGGAGAGGACAGGG + Intergenic
1049424747 8:142533028-142533050 GGCAAGGGCTTGAGAGGGGAGGG + Intronic
1049428843 8:142549936-142549958 GGCAGGGCCAGGAGTGGGCCTGG - Intergenic
1049434526 8:142580209-142580231 GGCAGTGGTGGGAGTGGGCTGGG - Intergenic
1049470765 8:142774160-142774182 TGCGGGGGCGGGAGTGGGGAGGG - Intronic
1049874495 8:145007588-145007610 CGCAAGGGCAGGTGCGGGCAAGG + Intergenic
1051350308 9:16192504-16192526 GGGAAGGGAGGGAGGGGGCAGGG - Intergenic
1051700717 9:19820284-19820306 GGGAAGAGTGGGAGGGGGCAAGG + Intergenic
1052741934 9:32401839-32401861 TGCAAGAACGGGGGTGGGCATGG - Intronic
1053692468 9:40593214-40593236 GGCAAGGCCAGGATAGGGCAGGG - Intergenic
1054272349 9:63044319-63044341 GGCAAGGCCAGGATAGGGCAGGG + Intergenic
1054303710 9:63394132-63394154 GGCAAGGCCAGGATAGGGCAGGG - Intergenic
1054402488 9:64720642-64720664 GGCAAGGCCAGGATAGGGCAGGG - Intergenic
1054436098 9:65204973-65204995 GGCAAGGCCAGGATAGGGCAGGG - Intergenic
1054494294 9:65816714-65816736 GGCAAGGCCAGGATAGGGCAGGG + Intergenic
1054766367 9:69045817-69045839 GGTAAGGGGGGAAGTGTGCAAGG + Intronic
1054827852 9:69590776-69590798 CGCCAGGGTGGGGGTGGGCAGGG + Intronic
1056259496 9:84833649-84833671 GGCAGGGGAGGGAGGGGGCAGGG + Intronic
1056671996 9:88638367-88638389 GCCAAGAGCTGGGGTGGGCAAGG - Intergenic
1056788356 9:89609145-89609167 GGCAATGCTGGGTGTGGGCAAGG - Intergenic
1056824574 9:89867943-89867965 GGCAAGGCAGGGAGCAGGCAGGG - Intergenic
1057187572 9:93065497-93065519 TGCAAGGGCCGCAGTGGGCTGGG + Intronic
1057306960 9:93918118-93918140 GTCAGGGGCGGGAGTGGGGGTGG - Intergenic
1057483373 9:95462990-95463012 GGCAAGGGTGGGTGGGGGGAGGG - Intronic
1057612508 9:96558145-96558167 GGGAAGGGCGTGTGTGGTCAGGG + Intronic
1057867960 9:98696341-98696363 AGCAATGCTGGGAGTGGGCAGGG + Intronic
1057949875 9:99361291-99361313 GGCAAAGGCAGGAGTGGGAAGGG - Intergenic
1058413779 9:104764112-104764134 GGCAGGGGCGGGACTCGGCGGGG - Intergenic
1060266866 9:122116695-122116717 GACAAGGGCGGTAGAGTGCAAGG + Intergenic
1060509755 9:124223407-124223429 GACAAGGCTGGGGGTGGGCAGGG - Intergenic
1060551150 9:124486011-124486033 GGCAGGGGCGGGAGGGGGCTGGG + Intronic
1060753843 9:126194568-126194590 GGGAAGGGAGGGAGTGAGGAAGG - Intergenic
1061075690 9:128340345-128340367 GGCAAGGGCCGGGGTCGGCAGGG + Intergenic
1061398306 9:130355216-130355238 GGCAGGGCTAGGAGTGGGCAGGG + Intronic
1062046536 9:134427003-134427025 GGCAGGAGTGGGAGTGGGCCCGG + Intronic
1062170452 9:135132111-135132133 GGCAAGGCGGGGTGTGGGCACGG + Intergenic
1062184366 9:135209653-135209675 GATAAGGGCAGGAGTGGGAATGG - Intergenic
1062194128 9:135263871-135263893 GGGAAGGAGGGGAGAGGGCAGGG - Intergenic
1062283258 9:135761400-135761422 GGCAAGGGCGGGAGTGAGGGTGG + Intronic
1062345215 9:136111296-136111318 GGGAAGGACAGGTGTGGGCAGGG - Intergenic
1062355810 9:136161730-136161752 GGAAAGGGAGGGAAGGGGCAAGG - Intergenic
1062464856 9:136676420-136676442 GGCAAGTGCAGGAAGGGGCAAGG + Intronic
1062501739 9:136854734-136854756 GGAAAGGACGGGAGTGGGCCAGG - Intronic
1062519780 9:136952836-136952858 GGCAGGGGTGGCAGTGGGCAGGG - Intronic
1062519786 9:136952852-136952874 GGCAGGGGCGGCGGTGGGCAGGG - Intronic
1062529044 9:136991987-136992009 GGCGGGGGCGGGAGGGGGCGAGG + Intergenic
1062537026 9:137025571-137025593 GGCACGGGCTGGGGCGGGCATGG - Intronic
1062582166 9:137233525-137233547 GGAGAGGGCAGCAGTGGGCAGGG + Intronic
1203761296 EBV:13840-13862 GACAGGGGCGGGAGGGGGCTGGG - Intergenic
1203762225 EBV:16912-16934 GACAGGGGCGGGAGGGGGCTGGG - Intergenic
1203763154 EBV:19984-20006 GACAGGGGCGGGAGGGGGCTGGG - Intergenic
1203764083 EBV:23056-23078 GACAGGGGCGGGAGGGGGCTGGG - Intergenic
1203765012 EBV:26128-26150 GACAGGGGCGGGAGGGGGCTGGG - Intergenic
1203765941 EBV:29200-29222 GACAGGGGCGGGAGGGGGCTGGG - Intergenic
1203766870 EBV:32272-32294 GACAGGGGCGGGAGGGGGCTGGG - Intergenic
1185727228 X:2431758-2431780 GGCAAGGAAGGGATGGGGCAAGG + Intronic
1186300472 X:8195296-8195318 GGCAAGAACGGGAGTGGGAGGGG + Intergenic
1187464425 X:19515095-19515117 GGCGAGGGCGAGAGTGGGGGCGG - Exonic
1188515607 X:30982232-30982254 GGCAGGAGTAGGAGTGGGCAGGG - Intergenic
1189128785 X:38477156-38477178 GGAAAGGGTGGGAGGGGGCGAGG - Intronic
1189148461 X:38679856-38679878 GGCCAGGGTAGGAGTGGGAAAGG - Intronic
1189751980 X:44231519-44231541 GGAGGGGGCAGGAGTGGGCAGGG - Intronic
1190427317 X:50345542-50345564 AGGAAGGGAGAGAGTGGGCAAGG - Intronic
1190702229 X:52997564-52997586 GTCAAGGGCTGGAGGGGGTATGG - Intergenic
1192769650 X:74174602-74174624 GGGAAGAGTGGGAGTGGGGAAGG - Intergenic
1193881619 X:86929746-86929768 GTCAAGGGCAGGACTGGGCGGGG + Intergenic
1194075274 X:89384414-89384436 GGCAAGGGTAGGAGCGGGCGAGG - Intergenic
1194173454 X:90617852-90617874 GGCAGGGGAGGGCTTGGGCATGG + Intergenic
1195091045 X:101459346-101459368 GGCAATGGCTGCAGTGGGGAGGG + Intronic
1195686541 X:107592078-107592100 GGGAAGGGCGGGAGGGGGTGAGG - Intronic
1196575481 X:117313083-117313105 GGGAAGAGTGGGAGGGGGCAAGG + Intergenic
1196859743 X:120015782-120015804 GCCCAGGGTGGGAGTGGTCAAGG - Intergenic
1196868668 X:120092147-120092169 GGAAAGGGTGGGAGTGGGGTGGG + Intergenic
1197135883 X:123059265-123059287 GCCAAGGGAGGGAGAGGGGAAGG - Intergenic
1197507639 X:127327488-127327510 GGCAAGGGGGAGTGTGTGCAGGG + Intergenic
1197594656 X:128451058-128451080 GGCAATGGCAGCAGTGGGAAGGG + Intergenic
1198938424 X:141925186-141925208 GGGGACAGCGGGAGTGGGCATGG - Intergenic
1200059786 X:153479116-153479138 GGGAAGGGCTGGGGTGGGCAGGG + Intronic
1200110006 X:153736260-153736282 GGCAAGGGTGGGGCTGGGCCAGG - Intronic
1200161534 X:154012338-154012360 GGCGAGGGAAGGAGTGGGCCAGG + Intronic
1200519676 Y:4195544-4195566 GGCAGGGGAGGGCTTGGGCATGG + Intergenic
1200730872 Y:6738574-6738596 GGCAAGGGTAGGAGCGGGCGAGG - Intergenic
1201146309 Y:11067157-11067179 GGAGAGGGAGGGAGAGGGCAAGG + Intergenic
1201146421 Y:11067503-11067525 AGGAAGGGAGGGAGAGGGCAAGG + Intergenic
1201714265 Y:17026907-17026929 GGGAAGAGTGGGAGGGGGCAAGG + Intergenic