ID: 1173583862

View in Genome Browser
Species Human (GRCh38)
Location 20:44166942-44166964
Sequence GGCAGGGGAGGTGGCAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4178
Summary {0: 1, 1: 4, 2: 50, 3: 514, 4: 3609}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583862_1173583876 23 Left 1173583862 20:44166942-44166964 CCGCCCCTGCCACCTCCCCTGCC 0: 1
1: 4
2: 50
3: 514
4: 3609
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583862_1173583874 21 Left 1173583862 20:44166942-44166964 CCGCCCCTGCCACCTCCCCTGCC 0: 1
1: 4
2: 50
3: 514
4: 3609
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583862_1173583875 22 Left 1173583862 20:44166942-44166964 CCGCCCCTGCCACCTCCCCTGCC 0: 1
1: 4
2: 50
3: 514
4: 3609
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583862 Original CRISPR GGCAGGGGAGGTGGCAGGGG CGG (reversed) Intronic
Too many off-targets to display for this crispr