ID: 1173583863

View in Genome Browser
Species Human (GRCh38)
Location 20:44166945-44166967
Sequence TGAGGCAGGGGAGGTGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2001
Summary {0: 1, 1: 2, 2: 19, 3: 192, 4: 1787}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583863_1173583874 18 Left 1173583863 20:44166945-44166967 CCCCTGCCACCTCCCCTGCCTCA 0: 1
1: 2
2: 19
3: 192
4: 1787
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583863_1173583875 19 Left 1173583863 20:44166945-44166967 CCCCTGCCACCTCCCCTGCCTCA 0: 1
1: 2
2: 19
3: 192
4: 1787
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583863_1173583876 20 Left 1173583863 20:44166945-44166967 CCCCTGCCACCTCCCCTGCCTCA 0: 1
1: 2
2: 19
3: 192
4: 1787
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583863 Original CRISPR TGAGGCAGGGGAGGTGGCAG GGG (reversed) Intronic
Too many off-targets to display for this crispr