ID: 1173583864

View in Genome Browser
Species Human (GRCh38)
Location 20:44166946-44166968
Sequence ATGAGGCAGGGGAGGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1374
Summary {0: 1, 1: 1, 2: 10, 3: 110, 4: 1252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583864_1173583874 17 Left 1173583864 20:44166946-44166968 CCCTGCCACCTCCCCTGCCTCAT 0: 1
1: 1
2: 10
3: 110
4: 1252
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583864_1173583876 19 Left 1173583864 20:44166946-44166968 CCCTGCCACCTCCCCTGCCTCAT 0: 1
1: 1
2: 10
3: 110
4: 1252
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583864_1173583875 18 Left 1173583864 20:44166946-44166968 CCCTGCCACCTCCCCTGCCTCAT 0: 1
1: 1
2: 10
3: 110
4: 1252
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583864 Original CRISPR ATGAGGCAGGGGAGGTGGCA GGG (reversed) Intronic
900422116 1:2560164-2560186 TGGAGGCAGGGGAAGGGGCAAGG + Intronic
900427671 1:2587854-2587876 AGCAGGGAGAGGAGGTGGCAGGG - Intronic
900480540 1:2896006-2896028 GTGAGGCAAGGGAGCGGGCAAGG + Intergenic
900571827 1:3362433-3362455 AGGAGGCTGGGGAGGTGCCCGGG + Intronic
900576325 1:3384255-3384277 AGGAGGGAGGGCAGGGGGCAGGG - Intronic
901435302 1:9243861-9243883 AAGAGGCGGGGGCGGTGGGAGGG + Intronic
901456336 1:9364997-9365019 ATGAGCCAGGCATGGTGGCATGG - Intronic
901465126 1:9416599-9416621 ATGGGCCAGGGCAGGGGGCATGG + Intergenic
901921014 1:12537777-12537799 AGGAGGCAAGGGAGGAAGCAAGG - Intergenic
902334209 1:15745744-15745766 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
902446520 1:16469019-16469041 GAGAGGCAGGGGAGAGGGCAGGG + Intergenic
902546541 1:17193976-17193998 ATGAGCCAGGCAAGGTGCCAGGG + Intergenic
902625344 1:17673192-17673214 GTGAGGAAGGGGAGCTGGCACGG + Intronic
902688062 1:18091776-18091798 ATGAGCTGGGAGAGGTGGCAGGG - Intergenic
902793921 1:18787963-18787985 GGGAGGCAGGGGAGGAGGGAGGG + Intergenic
902911960 1:19605207-19605229 ATGAGGCAGGAAAGGTGGAAGGG + Intronic
903264951 1:22152495-22152517 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
903450265 1:23448984-23449006 ATGAGGCAGGGAAGGAGGAATGG - Intronic
903913174 1:26743682-26743704 AATAGGCAGGTGTGGTGGCAGGG + Intronic
903952817 1:27005974-27005996 GTGAGCCAGGAGAGGTTGCACGG + Exonic
904341376 1:29837093-29837115 AGGAAGCAGGGGAGGGAGCAGGG - Intergenic
904513896 1:31037929-31037951 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
904618250 1:31761260-31761282 TGGGGGCAGGGAAGGTGGCACGG - Intronic
904650208 1:31999821-31999843 AGGAGGCGGAGGAGGTTGCAAGG + Intergenic
904768711 1:32869601-32869623 ATGCAGGTGGGGAGGTGGCAGGG + Intronic
905225140 1:36473851-36473873 ATGAGGCAGGAGAGGTTGTGGGG + Exonic
905263679 1:36736589-36736611 CTGGGGGAGGGGAGGTGACAAGG + Intergenic
905272349 1:36795294-36795316 ATGAGGGAGGGGTGTTGCCAAGG + Intergenic
905295695 1:36953188-36953210 ATGAGGCAGGGGCAGGGGGAGGG - Intronic
905510551 1:38516386-38516408 AAGAGGCAGGGAAGGAGACAAGG + Intergenic
905540999 1:38760402-38760424 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
905547098 1:38808508-38808530 CTGAGGCAGAGGAAGTGGAAGGG + Intergenic
905761229 1:40559453-40559475 ATTAGCCAGGTGTGGTGGCACGG - Intergenic
905982311 1:42241026-42241048 CTGAGGCAGGGAAGGAGGCGAGG + Intronic
906105122 1:43286905-43286927 AGGAGGCAGGAAAGGTGGGAAGG - Intergenic
906141861 1:43538540-43538562 ATGAAGGAGGGGAGGTGTCAAGG + Intronic
906160178 1:43642328-43642350 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
906608371 1:47186412-47186434 ATGAGGCTGGTGAGGTGGGCAGG - Intronic
906697031 1:47829986-47830008 AAGAGGCTTGGGGGGTGGCAGGG - Intronic
907246361 1:53111525-53111547 GAGTGGCAGGGGAGGTGGAAGGG + Intronic
907249147 1:53126410-53126432 ATAAGGCGGGGGTGGTGGGAGGG + Intronic
907291030 1:53412921-53412943 AGGGGGCAGGGGAGGTGGCCTGG + Intergenic
907409954 1:54276824-54276846 ATGAGGCTGGAGAGGTTGCCGGG - Intronic
907495224 1:54839260-54839282 ATAAGGCAGGAGAGGTGGTTCGG + Intronic
907663450 1:56414496-56414518 ATGGGGCAGTGGAGGGGGGATGG - Intergenic
907891979 1:58645236-58645258 ATTAGCCAGGGATGGTGGCACGG + Intergenic
908148135 1:61268954-61268976 ACGAGGCAAGGGAGGGAGCACGG - Intronic
908275909 1:62470920-62470942 AGGAGGTGGGGGAGGTAGCAGGG - Intronic
908324105 1:63006544-63006566 ATGAGACAGAAGAGGTAGCAAGG - Intergenic
909078148 1:71077706-71077728 ATGAGCCAGGCATGGTGGCATGG + Intronic
909887936 1:80965701-80965723 ATGAGCCAGGAGAGTTTGCATGG + Intergenic
909917114 1:81333856-81333878 ATGATGCAGTGGTGGTGGCATGG + Intronic
910660020 1:89661774-89661796 ATAAGGCAGGGCAGGAGGAAAGG + Intronic
910974040 1:92887030-92887052 ATGAGGCAGGGAAGGTGAGGCGG - Intronic
911049194 1:93655124-93655146 CTGAGGCTGGAGAGGAGGCAGGG + Intronic
911380474 1:97107437-97107459 ATGAGGTAGGGGAGGTGACATGG + Intronic
911404033 1:97413618-97413640 ATTAGGCAGGTGTGGTGGCATGG - Intronic
911514185 1:98846969-98846991 ATTAGCCAGGAGTGGTGGCAGGG - Intergenic
911527553 1:99004785-99004807 ACGAGGCACGGGAGGCGGGATGG + Exonic
912155838 1:106918372-106918394 TTGGGGTAGGGGAGGAGGCAGGG - Intergenic
912326591 1:108769297-108769319 CAGAGGCAGAGGAGGTGGCAGGG + Intronic
912334251 1:108847533-108847555 AGGAGACAGGGGAGGTGGACAGG - Intronic
912385467 1:109269152-109269174 AGGAGCCAGAGGAGCTGGCACGG + Exonic
913468218 1:119164733-119164755 ATTAGCCAGAGGTGGTGGCATGG + Intergenic
913665895 1:121048700-121048722 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
913697797 1:121344553-121344575 ATGAGGCTGAGGAGGTGGGCAGG + Intronic
913998573 1:143672808-143672830 GTGAGGCAGGGGAGAGGGCAGGG - Intergenic
914017293 1:143831976-143831998 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
914139758 1:144935498-144935520 ATGAGGCTGAGGAGGTGGGCAGG - Intronic
914256389 1:145963465-145963487 TGGAGACAGGGCAGGTGGCAAGG - Exonic
914433210 1:147638593-147638615 ATGAGGCTGGAGAGGTGGGCAGG + Intronic
914730899 1:150369420-150369442 ATTAGCCAGGTGTGGTGGCATGG - Intronic
914871357 1:151477597-151477619 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
914979948 1:152405679-152405701 ATTAGCCAGGTGTGGTGGCAAGG + Intergenic
915223296 1:154392114-154392136 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
915314219 1:155018819-155018841 ATGGGGCAGGGCAGGGGGCAGGG - Intronic
915345015 1:155193004-155193026 AGGAGGTAGGGGAGGGGGCGGGG - Intergenic
915915271 1:159937006-159937028 ATGAGGCAGGGCTGGTGGGTGGG - Intronic
915956410 1:160224023-160224045 ATGAGGCAGAAGAGGAGGAATGG - Intronic
916115337 1:161480909-161480931 GTCAGGCAGAGGTGGTGGCAGGG - Intergenic
916681345 1:167108058-167108080 TTGAGGCTGGGGAGGAGGAAGGG + Intronic
916817248 1:168366116-168366138 AGGAGCCAGGAAAGGTGGCAGGG - Intergenic
916876740 1:168977685-168977707 ATGAGGCAGAGGAGAGGGCAGGG + Intergenic
916959333 1:169873049-169873071 ATGAGACTGGGGAGGGGCCAGGG + Intronic
917219204 1:172709576-172709598 ATGAGGATGGGGAGGTAGAAAGG - Intergenic
917243233 1:172972194-172972216 TTGTGGCAGGAGAGGTGGTAAGG + Intergenic
917536292 1:175876974-175876996 CTGAAGATGGGGAGGTGGCAGGG - Intergenic
917582654 1:176395226-176395248 GTGAGGAAGGGAAGGAGGCAAGG - Intergenic
917818837 1:178739891-178739913 ATGAAGCAGATGAGGTGGCTAGG - Intronic
918077862 1:181183992-181184014 ATGAGGAAGGGGCCGTGCCATGG - Intergenic
919786004 1:201259197-201259219 GGGGGGCAGTGGAGGTGGCATGG + Intergenic
919880507 1:201897814-201897836 ATGTGGCAGGGGCAGTGGCCTGG - Exonic
919942653 1:202298879-202298901 ATGAGGCAAGGGAGGTGGCATGG - Intronic
920194433 1:204217485-204217507 ATGAGGAGGGGGACGTGGCGTGG + Intergenic
920195487 1:204223544-204223566 GGGAAGCAGGGGAGGTGGGAGGG + Exonic
920261736 1:204692959-204692981 GTGAGGCAGGGGAGGTGCCTAGG - Intergenic
920351364 1:205340160-205340182 ATTAGTCAGGTGTGGTGGCATGG - Intronic
920460415 1:206135339-206135361 ATGAGGTAGGGGAGGAGAGAAGG + Intergenic
920485189 1:206363203-206363225 ATGAGGCTGAGGAGGTGGGCAGG + Intronic
920504930 1:206508718-206508740 AGGAGGAAGGGGAGGAGGCAGGG - Intronic
920928150 1:210362372-210362394 ATTAGCCAGGTGTGGTGGCATGG - Intronic
921126116 1:212179578-212179600 ACCAGGCTGGGGTGGTGGCATGG - Intergenic
921872118 1:220152443-220152465 ATGAGGCAGGGAGGCTGGCCCGG - Intronic
922056573 1:222048065-222048087 ATGGGGAAGGGGAGGTGAGATGG - Intergenic
922595397 1:226809164-226809186 ATGAGGGAGGGGTGCTGGGAAGG + Intergenic
922725342 1:227920406-227920428 CTGCAGCCGGGGAGGTGGCAGGG + Exonic
922764199 1:228149129-228149151 GGCAGGCAGGGAAGGTGGCAGGG + Intergenic
922919528 1:229290339-229290361 AAGAGGTAGGGGAGGTGGGTTGG - Intronic
922966453 1:229694904-229694926 ATGAGGCTAGAGAGGTGGGAAGG - Intergenic
923139712 1:231151049-231151071 ATGAGATTTGGGAGGTGGCAGGG - Intergenic
923632280 1:235659250-235659272 ATTAGGCAGGCGTGGTGGCACGG - Intergenic
923689135 1:236176070-236176092 TTGAGGCTGGGGATGTGGGAGGG + Intronic
923784702 1:237055629-237055651 AGGAGGAAGGGGAGGTTTCAGGG + Intronic
924036748 1:239945605-239945627 GGGAGCCAGGGGAAGTGGCAGGG - Intergenic
924041998 1:239992834-239992856 GGGAGCCAGGGGAAGTGGCAGGG + Intergenic
924129104 1:240887374-240887396 ATGAGCCGGGCGTGGTGGCAGGG - Intronic
924131371 1:240912001-240912023 ATTAGCCAGGCGAAGTGGCAGGG + Intronic
924941714 1:248816731-248816753 TTGAGGCAGTGGCGGTGGGAGGG - Intronic
1063137015 10:3226585-3226607 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1063194656 10:3730129-3730151 GTGTGGCAGAGGAGGTGGCAGGG + Intergenic
1063454122 10:6171201-6171223 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1063588949 10:7377874-7377896 GGGACACAGGGGAGGTGGCACGG + Intronic
1063625890 10:7689632-7689654 AAGAGGCAAGGCATGTGGCAGGG - Intergenic
1063764098 10:9117280-9117302 ATTAGCCAGGCGTGGTGGCAAGG + Intergenic
1063957551 10:11280815-11280837 AAGAGGCAGGGGAGGTCCTAGGG + Intronic
1064446297 10:15396756-15396778 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1064769715 10:18711134-18711156 ATTAGCCAGGCGTGGTGGCACGG - Intergenic
1065025040 10:21533932-21533954 AAGAGGCCTGGGAGGTGGCGGGG - Intergenic
1065679826 10:28217684-28217706 ATGAGGCAGGGGAAGGGAAAAGG + Intronic
1065755764 10:28929046-28929068 AGGAGAGAGGGGAGGTGGCTAGG + Intergenic
1066261446 10:33733152-33733174 AGGAGGGAGGGGAGGAGGGAGGG + Intergenic
1067079877 10:43206811-43206833 ATGAGGCAGGGCTGTGGGCAGGG + Intronic
1067467497 10:46511767-46511789 GAGAGGCAGGGGAGGTGGGTGGG - Intergenic
1067538682 10:47136021-47136043 AGGAGGCAGAGAAGGTGGCCTGG - Intergenic
1067619689 10:47872838-47872860 GAGAGGCAGGGGAGGTGGGTGGG + Intergenic
1067777506 10:49174244-49174266 CTGAGGCAGGGGCAGGGGCAGGG - Intronic
1067815878 10:49476623-49476645 ATGGGTCATGGGAGGTGGGATGG - Intronic
1068521789 10:58085161-58085183 ATGAGACAGGGGAGTAGACATGG - Intergenic
1069463811 10:68620044-68620066 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1069478343 10:68757561-68757583 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
1069567221 10:69471737-69471759 ATTAGCCAGGTGTGGTGGCACGG - Intronic
1069569152 10:69484038-69484060 ATGCAGGAGGGGAGGTGGCCTGG - Intronic
1069720513 10:70546801-70546823 ATTAGCCAGGCGTGGTGGCATGG + Intronic
1069722621 10:70559510-70559532 AGGGGGCGGGAGAGGTGGCAGGG + Intronic
1069780082 10:70949889-70949911 ATGAGGCAGGGGAAGTGAGGTGG + Intergenic
1069916521 10:71790218-71790240 ACAGGGCAGGGGAGGTGGGAGGG + Intronic
1069976087 10:72214521-72214543 ATTAGCCGGGGGTGGTGGCAGGG - Intronic
1070168412 10:73914616-73914638 ATGGGGCAGGGGAGGTTTCCAGG + Intronic
1070431496 10:76343963-76343985 ATTAGCCAGGCGTGGTGGCACGG - Intronic
1070706158 10:78640325-78640347 CAGAGGCAGGAAAGGTGGCATGG - Intergenic
1070898097 10:80002940-80002962 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1071470901 10:85983554-85983576 TTCAGGCAGGGGATGTGGCCTGG + Intronic
1071481433 10:86067874-86067896 ATGGGGCAGGGGAGGAAGCTTGG - Intronic
1071488910 10:86122842-86122864 ATGAGGGAGGGGTGGAGACAAGG + Intronic
1071858215 10:89646670-89646692 ATGAGGCAGGAGAGGTAGGGAGG - Intergenic
1072679150 10:97493421-97493443 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1072690840 10:97571430-97571452 AGGAGGCAGGGCAGGCAGCATGG - Intergenic
1072996062 10:100245168-100245190 ATTAGCCAGGTGTGGTGGCACGG - Intronic
1073047124 10:100646126-100646148 CTGAGGGAGGGGAGGAGGCTGGG + Intergenic
1073076376 10:100827726-100827748 GTGAGGCTGGGGCGGTGGCCGGG - Exonic
1073148852 10:101298201-101298223 ATGAAACAGGGCAGGTGGCCAGG + Intergenic
1073174289 10:101542843-101542865 ATGAAGCAGGCCAGGTGCCATGG - Intronic
1073288436 10:102401933-102401955 AGGAGGCTGGGGAGGGGGCAGGG - Intronic
1073403102 10:103275050-103275072 ATGAGCCGGGTGTGGTGGCACGG - Intergenic
1073444181 10:103571125-103571147 AGGAGGCGGGGGCGGGGGCAGGG - Intronic
1073495140 10:103883940-103883962 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1073592863 10:104772876-104772898 ATGAGTCAAGGGAGATGCCAAGG + Intronic
1074139221 10:110657162-110657184 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1074405670 10:113178404-113178426 ATGGGGCAGGCGTGGGGGCATGG + Intergenic
1074566071 10:114578932-114578954 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
1075263872 10:120984508-120984530 ATGAGGCAGGGGCTGTGTCAGGG - Intergenic
1075423649 10:122325195-122325217 ATGAGGCTGGAAAGTTGGCAGGG + Intronic
1075558139 10:123448065-123448087 ATGAGTCTGGGGAGGGGGCCTGG + Intergenic
1075670490 10:124260991-124261013 GTGAAGGAGGGGAGGAGGCAGGG - Intergenic
1076001094 10:126913545-126913567 ATGGGGCAAGGGAGGGGGCTTGG + Intronic
1076029058 10:127142322-127142344 GTGAGGCCTGGGAGGTTGCAAGG - Intronic
1076172093 10:128327636-128327658 ATGTGGCTGGGGAGGAAGCAGGG - Intergenic
1076245849 10:128946956-128946978 GTGAGAGAGGGGAGCTGGCAGGG - Intergenic
1076379049 10:130012554-130012576 ATGAGGTGGGGGAGGTGGGAGGG + Intergenic
1076559015 10:131349000-131349022 ATGAGGCTGGGGAGGAGGAAAGG + Intergenic
1076559392 10:131351232-131351254 ATGAGGCTGGGGAGGAGGGAAGG + Intergenic
1076706800 10:132306908-132306930 AGAAGGCAGGTGAGGTGACATGG - Intronic
1076762152 10:132611232-132611254 ATGAGGGAGGTGAGGTGGGCAGG + Intronic
1076762166 10:132611277-132611299 ATGAGGGAGGTGAGGTGGGCAGG + Intronic
1076762179 10:132611322-132611344 ATGAGGGAGGTGAGGTGGGCAGG + Intronic
1076762249 10:132611546-132611568 GTGAGGGAGGTGAGGTGGGAAGG + Intronic
1076817648 10:132922703-132922725 ATGAGGCTGCGGGGGTGGCGTGG + Exonic
1076834643 10:133014905-133014927 ATGAGACAGAAGAGATGGCATGG + Intergenic
1076839847 10:133040604-133040626 GTGAGGTGGGGCAGGTGGCAGGG + Intergenic
1077269373 11:1668045-1668067 AGGAGGGAGGTGAGGGGGCAAGG - Intergenic
1077378046 11:2214834-2214856 AGGTGGCAGGGCAGGTGGCAGGG - Intergenic
1077432886 11:2524805-2524827 CTGAGGCAGGGGAGCTGCCTGGG + Intronic
1077908587 11:6555174-6555196 ATGAGGGAGGAGAGGAGGGATGG - Intronic
1078180624 11:9006994-9007016 ATGAGGCAGGGGACGTTGATTGG - Intergenic
1078217268 11:9322002-9322024 ATTAGCCAGGCGTGGTGGCACGG - Intergenic
1078239569 11:9518566-9518588 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1078417320 11:11176474-11176496 CTGAGGGAAGGAAGGTGGCAGGG + Intergenic
1078645423 11:13137515-13137537 AAGAGGCAGGGGAGCTGGAAGGG + Intergenic
1078696295 11:13635604-13635626 ATGAGGCAAGTGAGGTGTCCAGG + Intergenic
1078797249 11:14604700-14604722 AGGAGGGAGGGAAGGGGGCAAGG - Intronic
1078858478 11:15225904-15225926 CTGAGGCAGGGGAGAGAGCATGG + Intronic
1079023493 11:16927072-16927094 CTGAGGCGGGGGTGGGGGCAGGG + Intronic
1079110228 11:17601273-17601295 ATGTGGCAGGAGAGGGTGCAGGG + Intronic
1079311968 11:19374892-19374914 ATCAGGAAGGGGATGGGGCAAGG - Intronic
1079325991 11:19493160-19493182 AGGAGAGAGGGGAGGGGGCAGGG - Intronic
1079627070 11:22628780-22628802 TGGAAGCAGGGGAGGTGGGATGG - Intronic
1080055563 11:27902904-27902926 TAGAAGAAGGGGAGGTGGCAAGG + Intergenic
1080261499 11:30354078-30354100 ATGAGGCAAGGGAAGCGCCAAGG + Intergenic
1080663453 11:34315600-34315622 TTGGGGCAGGGGAGGAGGGATGG - Intronic
1081591729 11:44427782-44427804 ATCAGACATGGGAGGTGACAGGG - Intergenic
1082037578 11:47657875-47657897 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1083046426 11:59740113-59740135 ATTAGACAGGTGTGGTGGCATGG - Intronic
1083264775 11:61541676-61541698 ATGGGGGAGGGCTGGTGGCAGGG + Intronic
1083298129 11:61726167-61726189 ATGGGGCAGGGCTGGTGGGAAGG + Intronic
1083511088 11:63209938-63209960 ATGAGGCAAGGGACATGGAATGG + Intronic
1083544800 11:63540286-63540308 ATGAGGCAAAGGATCTGGCACGG - Intronic
1083764720 11:64836300-64836322 AGGAGGCAGGGGAGGGAGCGGGG + Intronic
1084126088 11:67099942-67099964 TGGAGGCAGAGGAGGCGGCAGGG + Intergenic
1084213751 11:67635686-67635708 GTGGGGCGGGGGAGGGGGCAGGG + Intronic
1084344198 11:68533555-68533577 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1084356574 11:68642442-68642464 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1084379538 11:68802584-68802606 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1084382034 11:68818708-68818730 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1084445600 11:69201886-69201908 AGGTGGCAGGGAAGGTGGTAGGG + Intergenic
1084532687 11:69738066-69738088 AGGATGCAGGGGAGGTGGGGTGG + Intergenic
1084636930 11:70398842-70398864 AGGAGGCCGGGCAGGGGGCAAGG + Intronic
1085023991 11:73226022-73226044 ACGGGGCAGGGGTGGAGGCACGG + Intronic
1085074063 11:73573962-73573984 AAGGGGCAGGGGTGGGGGCAGGG + Intronic
1085107023 11:73853836-73853858 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
1085124941 11:73993778-73993800 ATTAGTCAGGTGTGGTGGCAGGG - Intergenic
1085243589 11:75078711-75078733 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
1085300578 11:75456018-75456040 ATGTAGCAGGGGAGGCTGCAGGG + Intronic
1085460214 11:76689004-76689026 CTGAGGCCTGGGAGGGGGCAAGG + Intergenic
1086001573 11:81990942-81990964 GTGAGGTAGGGGAGGTGGGAGGG + Intergenic
1086066001 11:82745460-82745482 AAGTGGCAGGAGAGGTGGCCAGG + Intergenic
1086617517 11:88840066-88840088 AAGAGGCAGATGAGGTGGAAGGG + Intronic
1088389928 11:109302914-109302936 TTGCAGCAGGGGAGGGGGCAGGG - Intergenic
1088915824 11:114227086-114227108 TTGTGGCAGGGAAGGTGGCCTGG + Intronic
1088973491 11:114794172-114794194 ATGAGGCTGGGGAAGTGGACAGG - Intergenic
1089080877 11:115775339-115775361 CAGAGCCAGGGGAGGTGGCGAGG + Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089171897 11:116517826-116517848 ATGTGGCCAGAGAGGTGGCAGGG + Intergenic
1089227808 11:116940727-116940749 ATGAAGGAGGGGAGCTGGCGGGG - Intronic
1089408256 11:118216885-118216907 ATGGGGCAAGGTGGGTGGCACGG - Intronic
1089453975 11:118615045-118615067 ATTAGCCAGGCGTGGTGGCACGG + Intronic
1089665357 11:120014476-120014498 AAGAGGCAGGGGAGGTAGGCGGG - Intergenic
1089875290 11:121715454-121715476 ATGTGGCAGGGGTGGGGGCACGG + Intergenic
1090044015 11:123315331-123315353 AGGAGGGAGGGGAGGAGGGAGGG - Intergenic
1090077771 11:123590400-123590422 AGTAGGGAGGGGAGGTGGCAGGG - Intronic
1090185201 11:124734450-124734472 CTGAGGAAAGGGAGGTGGAAAGG + Intergenic
1090252014 11:125258156-125258178 ATGAGGAAGCTGAGGTTGCAGGG - Intronic
1090260979 11:125319897-125319919 ATGAGGCTGGAAAGGTGGGAAGG + Intronic
1090530929 11:127591095-127591117 ATTAGTCAGTGGAGGAGGCAGGG - Intergenic
1090797305 11:130146193-130146215 GGGAGGCAGGGGCGGGGGCATGG + Intergenic
1090812916 11:130262911-130262933 ATTAGGCGGGTGTGGTGGCATGG + Intronic
1091021208 11:132101791-132101813 GTGAGGCAGGACAGGAGGCAGGG - Intronic
1091255893 11:134185089-134185111 AGGAAGCAGGGTAGGTAGCATGG + Intronic
1091686762 12:2567848-2567870 AGAGGGCAAGGGAGGTGGCAAGG + Intronic
1091806366 12:3359340-3359362 ATGAGGCAGGGCAGGAGGGAAGG - Intergenic
1092286438 12:7131458-7131480 ATGAGGCGTGGGAGGGGGTAAGG + Intronic
1093200631 12:16182242-16182264 AGGAGGATGGGGAGGTGGAATGG - Intergenic
1093203730 12:16221710-16221732 ATGGGGCAGGAGAGGAAGCAGGG + Intronic
1093330286 12:17828091-17828113 ATTAGTCAGGTGTGGTGGCACGG - Intergenic
1093966466 12:25332038-25332060 ATTAGCTAGGGGTGGTGGCATGG + Intergenic
1094010816 12:25807634-25807656 AAGAGGCAGAGGAAGTGGAAAGG + Intergenic
1094026932 12:25969092-25969114 ATGAGGCAGAGGAGGTAGTGGGG + Intronic
1094436829 12:30430224-30430246 ATGGGACAGGGGAGATGGTAGGG - Intergenic
1094535878 12:31323061-31323083 AGGAGGCTGGGGAGCTGGCTGGG - Intronic
1094809695 12:34125296-34125318 ATGAGGCAAGGGACATGGAACGG - Intergenic
1094839830 12:34338242-34338264 ATGCGGCAGGGGCGGTGTCCGGG - Intergenic
1095933711 12:47654613-47654635 AACAGACAGGGAAGGTGGCATGG - Intergenic
1095989900 12:48027451-48027473 GGGAGGAAGGGGATGTGGCAAGG - Intergenic
1096067946 12:48756023-48756045 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1096428471 12:51523760-51523782 ATTAGCCAGGCGTGGTGGCAAGG - Intergenic
1096865402 12:54559808-54559830 ACGAGGCAGGGAAGTTGGCCTGG + Intronic
1097103175 12:56603863-56603885 ATCAGCCAGGTGTGGTGGCATGG + Intronic
1097345962 12:58492840-58492862 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1097989333 12:65818632-65818654 AAGAGACAGGGCAGGTGGCTTGG + Intergenic
1098001667 12:65950535-65950557 CTTAGGCATGGGAGGTGGCTAGG + Intronic
1098073423 12:66700324-66700346 ATGAGGCTGGGGAGGTAGGCAGG + Intronic
1098089815 12:66889311-66889333 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1098311611 12:69154364-69154386 AGGAAGAAGGGGAGTTGGCAGGG + Intergenic
1098396950 12:70029060-70029082 ATGGGGTTAGGGAGGTGGCAGGG + Intergenic
1098525975 12:71487560-71487582 ATGAGCCGGGTGTGGTGGCATGG - Intronic
1100306215 12:93352325-93352347 ATGAGGCATGGAAGGGTGCAAGG + Intergenic
1100385866 12:94104209-94104231 ATCAGACAGGGGTGGTGGAAAGG + Intergenic
1101002689 12:100372495-100372517 TTGAGCCAGGTGTGGTGGCATGG - Intronic
1101176708 12:102159275-102159297 ATTAGCCAGGCGTGGTGGCACGG - Intronic
1101645570 12:106628097-106628119 GTGAGGAAGGGGAGGAGCCAAGG - Intronic
1101755820 12:107619950-107619972 AGGAGCCAGGGAAGGTGGCAGGG - Intronic
1101909144 12:108849820-108849842 GGGAGCCAGGGGAGGAGGCATGG + Intronic
1102269566 12:111521511-111521533 AGGAGGAAGGGGAGGTTGCCAGG - Intronic
1102409703 12:112707025-112707047 AAGAGGCAGTGGAGTGGGCAGGG + Intronic
1102427843 12:112858411-112858433 ATGAGGCTGGAGAGATGGCAGGG - Intronic
1102508978 12:113401787-113401809 AGAAGGCAGGGGAGATGGGAAGG - Intronic
1102646241 12:114405690-114405712 GTGAGGCGGGGGAGCAGGCATGG + Intronic
1103024442 12:117562257-117562279 ATGAGGAAGGGGAGGGGGTGGGG + Intronic
1103156423 12:118688998-118689020 GTGAGGCTGGGGAGGTGGCCAGG + Intergenic
1103228411 12:119307563-119307585 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1103322582 12:120100632-120100654 ATGGGGCAGGGGCGGTGGCAGGG - Intronic
1103478256 12:121233937-121233959 ATGCGGCAGGGGAGGCCGCCTGG + Exonic
1103795381 12:123499636-123499658 ATGAGGCTGGGGAGGAGGCCGGG - Intronic
1103840963 12:123863936-123863958 ATGAGGTAGGAGTTGTGGCAGGG + Intronic
1103876339 12:124130429-124130451 ATGAGGCAGGGGAGGTGCGGTGG - Intronic
1103905404 12:124325127-124325149 AAGGGGCCGGGGAGGGGGCACGG - Exonic
1103955355 12:124573400-124573422 ATTAGCCAGGTGTGGTGGCACGG - Intergenic
1103997869 12:124841800-124841822 ACGAGGCAGGTGAGCTGACATGG - Intronic
1104010859 12:124929102-124929124 AGGAGTGAGGGGAGGGGGCAAGG + Intergenic
1104024330 12:125014912-125014934 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1104159556 12:126165177-126165199 ATGAGGCTGGAGATGTGGCAGGG + Intergenic
1104489477 12:129181591-129181613 ATGAGGTGGGAGAGGTGGGAAGG - Intronic
1104665794 12:130646438-130646460 AGGTGGCGAGGGAGGTGGCAAGG - Intronic
1104707159 12:130955934-130955956 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1104713213 12:130999674-130999696 ATGAGGCAGTGGGGATGGCGGGG + Intronic
1104731716 12:131108882-131108904 GTGGGGCAGGGCAGGTGGGATGG + Intronic
1104864261 12:131943422-131943444 ATGAGGGAGTGGTGGGGGCAAGG + Intronic
1104932005 12:132344943-132344965 AGGATGGAGGGGAGGTGGGAGGG - Intergenic
1105303817 13:19155788-19155810 AGTAGGCAGGGGAGGGGTCAGGG - Intergenic
1105330728 13:19412817-19412839 ATGGGGGAAGGGAGGGGGCACGG - Intergenic
1105453558 13:20520954-20520976 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1105620333 13:22060425-22060447 ATGAGGCACGGGAGGAGAGATGG + Intergenic
1105621742 13:22074258-22074280 ATGAGGTAGGGAAGATGGGATGG + Intergenic
1105949825 13:25219644-25219666 ATGAGGCAGTGGAATTGGAATGG - Intergenic
1106382343 13:29252493-29252515 AGGAGGCAGGGGAGGACACATGG + Intronic
1106397127 13:29391979-29392001 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1106811336 13:33361148-33361170 AAGAAGCAGAGGAGGTGGAAGGG - Intergenic
1107453434 13:40533437-40533459 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1107482329 13:40795121-40795143 ATGGGGGAGGGGAGGGGGAAAGG - Intronic
1107809790 13:44189332-44189354 ATGAGGGACTGGAGGTTGCAAGG - Intergenic
1107819502 13:44273483-44273505 GTGAGGCAGAGGATGTAGCATGG - Intergenic
1108075910 13:46679706-46679728 ATGGGGGAGGTGGGGTGGCACGG - Intronic
1108327797 13:49351470-49351492 ATGAGGCAGGGGTGGAGAGAAGG + Intronic
1108681163 13:52781641-52781663 ATGAGCCAGAGGAGGTGGTGTGG + Intergenic
1109138409 13:58682455-58682477 ATGAGGCAGGGTAGGTAGTCAGG + Intergenic
1109279693 13:60341817-60341839 ATGAGACTGGGGAAGTGGAAGGG - Intergenic
1110701420 13:78553123-78553145 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1111029961 13:82583703-82583725 ATGAGGAAGGGGAACTGTCATGG - Intergenic
1111219201 13:85181523-85181545 ATGAGTCAAGGGAGGAGGCTAGG + Intergenic
1111597108 13:90426540-90426562 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1112100612 13:96184733-96184755 CTGAGGCTGGGGTGGGGGCAGGG - Intronic
1112160440 13:96861372-96861394 AAGAGGTAGAGGAGGTGGAAGGG - Intergenic
1112373540 13:98816887-98816909 ATGAGGCTGTGGAGGTGGGAAGG + Intronic
1112511829 13:100016507-100016529 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
1112705316 13:102061363-102061385 ATGTGGACGGGCAGGTGGCAGGG - Intronic
1113265058 13:108607732-108607754 AAGAGGCAGTGGAGGTGTCGGGG - Intronic
1113269636 13:108659498-108659520 GGGGGGCAAGGGAGGTGGCAGGG - Intronic
1113332593 13:109344820-109344842 ATGAGGCAGGTGGTGAGGCAAGG - Intergenic
1113477928 13:110598560-110598582 ATGTGACAGGAGAGGTGGCCTGG + Intergenic
1113705042 13:112424767-112424789 AAGAGGCAGGGCCGGTGGCATGG + Intronic
1113779000 13:112965337-112965359 ATGCTGCAGCGGAGGTGACATGG - Intronic
1114249952 14:20950754-20950776 ATTAGCCAGGCGTGGTGGCACGG - Intergenic
1114407553 14:22470887-22470909 GTGAGGCTGGGGAGGAAGCAAGG - Intergenic
1114487541 14:23071781-23071803 AGGGGGCAGGGGAGGGGGCTGGG + Intronic
1114514452 14:23288874-23288896 ATGAGGGAGGAGAGGAGGCAGGG - Intronic
1115475073 14:33805714-33805736 CTGGGGCTGAGGAGGTGGCAGGG - Intergenic
1115505524 14:34090312-34090334 AGGAGGAACGGGAAGTGGCAGGG + Intronic
1115627601 14:35209681-35209703 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1115665840 14:35544897-35544919 ATCAGCCAGGAGTGGTGGCATGG + Intronic
1115945435 14:38654489-38654511 ATGAAGCAGGGAAGGAGGCAAGG - Intergenic
1116048986 14:39780909-39780931 CTGTTGCAGTGGAGGTGGCAGGG + Intergenic
1116168202 14:41361634-41361656 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1116655742 14:47651449-47651471 ATGAGGCAGCAGAGTGGGCAGGG + Intronic
1116855734 14:49950809-49950831 ATGAGGGAGGGGACATGGGAGGG + Intergenic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1117770207 14:59126577-59126599 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1117826649 14:59710978-59711000 ATGAGGCTTGGGAGGTTTCAGGG + Intronic
1117876531 14:60256269-60256291 ATTAGCCAGGCGTGGTGGCACGG + Intronic
1118062159 14:62151441-62151463 GTGAGGCAAGGGAAGAGGCAAGG + Intergenic
1118285976 14:64473258-64473280 TTGAGGTGGAGGAGGTGGCAGGG - Exonic
1118512329 14:66489132-66489154 ATGAGGCATGGGTGGAAGCAAGG - Intergenic
1118747568 14:68785263-68785285 AAGAGGCAGGGGTCATGGCAGGG - Intergenic
1118854127 14:69608153-69608175 GGGAGGCAGGGAAGGTGGTAGGG + Intergenic
1119007192 14:70942631-70942653 ATGAGGCAAGGCATGTGGGAAGG + Intronic
1119405667 14:74397315-74397337 AAGAGGCCAGGGAGGAGGCAGGG + Intergenic
1119409329 14:74419908-74419930 ATGAGGCAGGAGAGGTGGGAAGG + Intronic
1119505261 14:75167372-75167394 AAGAGGCAGGGGAGGGAGGAAGG - Intronic
1119591214 14:75889679-75889701 ATTAGCCAGGCGTGGTGGCATGG + Intronic
1119717494 14:76869086-76869108 ACGGGGCAGGTGAGGAGGCACGG - Intronic
1119717500 14:76869105-76869127 ACGGGGCAGGTGAGGAGGCACGG - Intronic
1119717506 14:76869124-76869146 ACGGGGCAGGTGAGGAGGCACGG - Intronic
1119791964 14:77359053-77359075 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1119806541 14:77485786-77485808 ATGAGACGGGAGGGGTGGCAAGG - Intronic
1119857215 14:77909554-77909576 ATGAGCCCAGGGGGGTGGCAGGG + Intronic
1120050779 14:79862966-79862988 AAGAGGAAGGGGAGGTGGGCTGG + Intronic
1120230666 14:81837256-81837278 ATGAGGTTTGGGAGGTGCCAGGG + Intergenic
1120601650 14:86517567-86517589 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1120977389 14:90261111-90261133 ATGAGCAAGGGGGAGTGGCAGGG - Intronic
1121369798 14:93346885-93346907 ATGAGGGCTGGGAGGTTGCAGGG + Intronic
1121904369 14:97726288-97726310 ATGACCCAGGGAATGTGGCAGGG - Intergenic
1121909109 14:97772959-97772981 CTGAGGCAGGAGAGGTGGGCAGG + Intergenic
1122119511 14:99544565-99544587 CTGAGGCAGGGGATGGGGCTTGG + Intronic
1122254190 14:100464663-100464685 ATGAGGTAGGGGAGATGAGATGG - Intronic
1122254248 14:100464966-100464988 ATAAGGCAGGGGAGATGAGATGG - Intronic
1122425124 14:101601337-101601359 GTGAGGCAGAGGAGATGGGAAGG + Intergenic
1122644446 14:103184257-103184279 GTGAGGCATGGCAGGTGCCAAGG - Intergenic
1122668959 14:103355280-103355302 ATTAGCCAGGCGTGGTGGCAAGG - Intergenic
1122720462 14:103719049-103719071 ATCAAGCTGGGGAGGTGGGATGG + Intronic
1122818355 14:104326493-104326515 AGAAGGCAGGGCAGGGGGCAGGG - Intergenic
1122825199 14:104367376-104367398 AGCACGCAGTGGAGGTGGCAAGG - Intergenic
1122853464 14:104548744-104548766 CTGGGGCAGGGGTGGGGGCAGGG - Intronic
1122967584 14:105138517-105138539 TGGTGGCAGGGGTGGTGGCACGG + Intergenic
1123093182 14:105751198-105751220 CTGAGGAAGGGGTGGGGGCAGGG - Intergenic
1202927815 14_KI270725v1_random:7793-7815 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1123484031 15:20668356-20668378 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1123679964 15:22755963-22755985 ATTAGCCAGGCGTGGTGGCAAGG - Intergenic
1124161929 15:27278473-27278495 ATTAGGGATGGGGGGTGGCATGG - Intronic
1124256497 15:28146889-28146911 AAGAGGCAGGGGAGGAAGGAGGG + Intronic
1124332177 15:28830408-28830430 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1124527130 15:30466694-30466716 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1124567733 15:30832204-30832226 AAGAGGCAGGGGAGGAAGGAGGG - Intergenic
1124706276 15:31968486-31968508 GTGAGGCTGGGGAGTTGCCAGGG + Intergenic
1124771523 15:32540989-32541011 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1124783552 15:32658504-32658526 ATGGGGAAGGGAGGGTGGCAGGG + Intronic
1124797445 15:32795585-32795607 ATGGGGGTGGGGGGGTGGCAGGG + Intronic
1124989006 15:34652165-34652187 ATGAGGAAGTGGAAGTGGAATGG + Intergenic
1125024882 15:35020033-35020055 ATGAGGCTGAGGAACTGGCAGGG - Intergenic
1125260398 15:37817769-37817791 AGGAGGCAGGGAATGAGGCAGGG + Intergenic
1125385113 15:39129008-39129030 ATGAGAAAAGGGAGGAGGCAAGG - Intergenic
1125388990 15:39171833-39171855 ATGAGGCAGGGGTAGGGTCAAGG - Intergenic
1125409236 15:39387778-39387800 AAAAGGCAGGGGAGATGGCGAGG + Intergenic
1125990847 15:44106365-44106387 ATGAGGCTGGAGATATGGCAGGG - Intronic
1126783757 15:52160093-52160115 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1127084201 15:55409255-55409277 ATTAGCCAGGAGAGGTGGCGCGG + Intronic
1127138634 15:55950971-55950993 ATGAGGCAGATGGGGTGGAAAGG + Intronic
1127190454 15:56525183-56525205 AAAAAGGAGGGGAGGTGGCAGGG - Intergenic
1127426725 15:58865323-58865345 ACGGGGGAGGGGAGGAGGCAGGG + Intronic
1127682685 15:61312826-61312848 ATGAGGCAGAGGAGCTTGCAAGG - Intergenic
1127706327 15:61550566-61550588 ATGAGGGAGGGGAAGGAGCAGGG - Intergenic
1127863601 15:63014019-63014041 ATGATGCAGGGCAGGTAACAGGG - Intergenic
1127913203 15:63435338-63435360 ATGAGGACGGGGAGGTAGCCAGG - Intergenic
1128036411 15:64530160-64530182 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1128237309 15:66077128-66077150 GTGGGCCAGGGCAGGTGGCATGG - Intronic
1128312128 15:66637367-66637389 AGGAGACAGGAGAGGTGGGAGGG + Intronic
1128628068 15:69232071-69232093 CTGAGGCCGGGGTGGTGGCTTGG - Intronic
1128768961 15:70267609-70267631 ATGAGGCTGGAGAGGAGCCATGG - Intergenic
1128975180 15:72147062-72147084 AAGAGGCAGGGAAAGTGGGAAGG - Intergenic
1129042735 15:72704076-72704098 ATGGGGCAAGAGAAGTGGCAAGG + Intronic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129237927 15:74234798-74234820 GTGAGGCAGGCAAGGTGGCCAGG + Intergenic
1129394227 15:75235538-75235560 CAGAGGCTGGGGAGGGGGCAGGG - Intergenic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1129449910 15:75645566-75645588 ATCAGCCAGGTGAGGTGGCCAGG - Intronic
1129451210 15:75652290-75652312 GTAGGGCAGGGGAGGTGGCCAGG + Intronic
1129828148 15:78648922-78648944 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1130060213 15:80564227-80564249 ATGAGGAAGAAGAGGTGGTAGGG - Intronic
1130133629 15:81163640-81163662 GGGAGGCAGAGGAGGTTGCAGGG - Intronic
1130233743 15:82115631-82115653 ATGAACCATGGCAGGTGGCATGG - Intergenic
1130510563 15:84585719-84585741 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1130758992 15:86797734-86797756 ATGGGGCAGGGGTGGTGGGGAGG + Intronic
1130908682 15:88256803-88256825 ACGAGGGAGGGGAGGAGGGAGGG - Intergenic
1130983638 15:88830118-88830140 CTGGGCCAGGGGAGGTGACATGG + Intronic
1131166419 15:90145233-90145255 TTGAGGAAGGGGAGGTGCTAAGG - Intergenic
1131178481 15:90224718-90224740 ATGAGGCTGGGGTGGTGGGCAGG + Intronic
1131316671 15:91344918-91344940 ATGAGGTGGGGGAGGTGGGTGGG - Intergenic
1131353583 15:91723886-91723908 AAGAGGCAGGGAAGAGGGCAGGG + Intergenic
1131401434 15:92128498-92128520 ATGGGGCAGGGGATGGGGCAGGG + Intronic
1131777999 15:95823189-95823211 CTGGGGAAGGGGAGGTGTCAAGG + Intergenic
1132056200 15:98651170-98651192 AGGAGGCAGCGGAGGTTGTATGG + Intronic
1132104187 15:99051015-99051037 ATGTGGCAGGGTATGAGGCAAGG + Intergenic
1132363150 15:101235127-101235149 ATGAGGACGTGGAGGTGGGAAGG - Exonic
1132489847 16:221552-221574 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
1132552397 16:558984-559006 CTGTGTCAGGGAAGGTGGCATGG + Intergenic
1132587433 16:711697-711719 ATGAGGCTGGGGAGGAGGCAGGG + Intronic
1132676227 16:1122437-1122459 GTGAGGGAGGGCAGGGGGCAGGG + Intergenic
1132692868 16:1189339-1189361 GTGAGGAAGGGGAGGTGGCCAGG + Intronic
1132758605 16:1497926-1497948 CTGAGGCAGGTGAGCTGGCAGGG - Intronic
1132941964 16:2512954-2512976 ATCAGGCAGAGGGGGTGCCAGGG + Intronic
1133159531 16:3901251-3901273 ATTAGCCAGGTGCGGTGGCAGGG + Intergenic
1133304284 16:4800103-4800125 AGGGGGCAGGGGAGGAGGCTGGG + Intronic
1133606488 16:7393019-7393041 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1133945662 16:10346023-10346045 GGGAGGCAGGAGAGGAGGCAAGG + Intronic
1134016231 16:10890365-10890387 TTGAGCCTGGGGAGGTGTCAAGG - Intronic
1134132124 16:11657106-11657128 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1134205691 16:12236320-12236342 ATGGGGCAGGGGAGAAGCCAGGG + Intronic
1134222633 16:12367031-12367053 ATGATGAAGGGGAGATGGAAAGG - Intronic
1134338974 16:13327802-13327824 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1135606895 16:23833319-23833341 ATGAGGTCAGGGAGGTAGCAGGG - Intergenic
1135964479 16:27024389-27024411 CTGAGTCCCGGGAGGTGGCATGG - Intergenic
1136065416 16:27755178-27755200 ATGAGGATGGGGAGGTGGGGAGG - Intronic
1136088956 16:27904635-27904657 ATAAGGCAGGAGAGGTGGGCAGG - Intronic
1136219656 16:28820558-28820580 ATGAGGGTAGAGAGGTGGCATGG + Intergenic
1136408666 16:30064358-30064380 AGGAGCCAGGGAGGGTGGCAGGG + Intronic
1136484320 16:30561551-30561573 ATGAACCAGGGAAGGTGGAAGGG - Intergenic
1136778252 16:32882816-32882838 GGGTGGCAGGGGAGGTGGCCAGG - Intergenic
1136867264 16:33768213-33768235 ATGAGCTAGGGGAGCGGGCATGG - Intergenic
1136892368 16:33978698-33978720 GGGTGGCAGGGGAGGTGGCCAGG + Intergenic
1137672842 16:50289611-50289633 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1138098600 16:54233217-54233239 ATTAGCCAGGTGCGGTGGCATGG + Intergenic
1138194791 16:55044186-55044208 AGAAGCCAGGAGAGGTGGCAGGG - Intergenic
1138489007 16:57365250-57365272 AGGAGGCAGGGAAAGTGGAATGG - Exonic
1138579896 16:57933868-57933890 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
1139304311 16:65970278-65970300 ATGGGGCAGGGGTGGGGGTAGGG - Intergenic
1139529199 16:67534265-67534287 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1139544072 16:67640890-67640912 ATGAGCCAGGTGTGATGGCATGG - Intergenic
1139654358 16:68378268-68378290 ATGCTGCAGAGGAGTTGGCATGG + Intronic
1140194391 16:72844860-72844882 ATGAGGAAGGGGAGGGGGCGGGG - Intronic
1140837681 16:78810319-78810341 ATGAGGCAGGGTAGGTGATTGGG - Intronic
1140847977 16:78907937-78907959 ATGAGAAAGGGGAGGAGGCTGGG + Intronic
1141137022 16:81473110-81473132 AGGAGGCCGGGCAGGAGGCAGGG - Intronic
1141396333 16:83708352-83708374 ATTAGCCAGAGGAGGTAGCATGG + Intronic
1141499368 16:84432993-84433015 TGGAGGCAGGGGTGGCGGCAGGG + Intronic
1141625111 16:85257255-85257277 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1141680424 16:85540757-85540779 ATTAGCCAGGTGAAGTGGCATGG + Intergenic
1141763976 16:86046593-86046615 AAGTGGCAGGGGAGGGGGCTGGG + Intergenic
1142185302 16:88692069-88692091 ATGGGGCAGGGGTGGGGGCCGGG - Intergenic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1203080674 16_KI270728v1_random:1144925-1144947 GGGTGGCAGGGGAGGTGGCCAGG - Intergenic
1203104898 16_KI270728v1_random:1347990-1348012 ATGAGCTAGGGGAGCGGGCATGG + Intergenic
1203128616 16_KI270728v1_random:1614378-1614400 ATGAGCTAGGGGAGCGGGCATGG - Intergenic
1203142072 16_KI270728v1_random:1773327-1773349 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1142824976 17:2504709-2504731 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1142833761 17:2569199-2569221 ATTAGCCAGGTGTGGTGGCACGG + Intergenic
1142888705 17:2929300-2929322 AAGAGGCTGTGGAGGGGGCAGGG + Intronic
1142976216 17:3646130-3646152 ATCAGGCAGGGGAAGTGAGATGG + Intronic
1143025258 17:3937801-3937823 ATGAGGCTGAGGAGAAGGCAAGG + Intronic
1143091701 17:4452786-4452808 ATGAGGCAGGAAAGGGGGTAGGG + Intronic
1143176651 17:4959485-4959507 CTGGGGCAGGGCAGGGGGCAGGG - Exonic
1143185518 17:5007684-5007706 AAGACGGAGAGGAGGTGGCAGGG - Intronic
1143254193 17:5543684-5543706 CTGAGGAAGTGGAGGTGGCTGGG + Intronic
1143416398 17:6754091-6754113 ATGGGATAGGGGTGGTGGCAGGG - Intergenic
1143518212 17:7430434-7430456 TAGGGGCAGGGGTGGTGGCAGGG - Intergenic
1143587107 17:7855799-7855821 CTCAGGCAGGGGTGGGGGCAGGG - Exonic
1143739408 17:8941671-8941693 ATGTGGCGGGGCAGGCGGCAGGG + Intronic
1143990166 17:10952351-10952373 AGGAGGGAGGGAAGGTGCCATGG + Intergenic
1143990356 17:10954454-10954476 CTCAGGCAGGGGAGGTGGGCAGG - Intergenic
1144035934 17:11366088-11366110 GTGAGGGAGGGAAGCTGGCAGGG + Intronic
1144041819 17:11418751-11418773 AGTAGGCAGGTGGGGTGGCAGGG - Intronic
1144106182 17:11987834-11987856 AGGTGGATGGGGAGGTGGCAGGG - Intronic
1144235651 17:13258025-13258047 AGGAGGCAGTGGAGGGGGAAGGG - Intergenic
1144412481 17:15014478-15014500 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1144837088 17:18162191-18162213 GTGAGGGAGGGCAGCTGGCAGGG + Intronic
1144992641 17:19244309-19244331 ATGAGCCAGGTGTGGTGGCGTGG + Intronic
1145238534 17:21225981-21226003 AAGAGGGAGGGGAGGAGGAAGGG - Intergenic
1145239993 17:21235577-21235599 ATGAGACTGGAGAGGTGGGATGG - Intergenic
1145904150 17:28507230-28507252 AGGAGTCGGGGGAGCTGGCAGGG - Intronic
1145993247 17:29091740-29091762 ATGGGGCAGGGGAGGAGGCTGGG - Intronic
1146281600 17:31548858-31548880 ATTTGGCAGTGGTGGTGGCAGGG + Intergenic
1146323621 17:31866735-31866757 ATTAGCCAGGTGCGGTGGCAGGG + Intronic
1146475119 17:33156606-33156628 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1146644321 17:34567036-34567058 AACAGGCTGGGGAGGTGGCCAGG - Intergenic
1147165372 17:38590381-38590403 ATTAGCCAGGTGTGGTGGCACGG - Intronic
1147419190 17:40313665-40313687 ATGAGGCAGGGTAGGGGAGAGGG - Intronic
1147586299 17:41655586-41655608 CTGGGGGAGGGGACGTGGCAGGG - Intergenic
1147659107 17:42107833-42107855 ATGGGGCAGGGCAGGGGGCGGGG - Intronic
1147787006 17:42986140-42986162 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1147992487 17:44343681-44343703 ATGAGGCAGGGGCAGGGGGATGG - Intergenic
1148152760 17:45405858-45405880 CCGAGGCAGGGGAGGTGGCTGGG + Exonic
1148253612 17:46108225-46108247 ATGAGGCCAGAGAGGTAGCAGGG - Intronic
1148669898 17:49402730-49402752 ATGATGCTGGGGAGGCGGCAGGG + Intronic
1148739010 17:49881300-49881322 ATGAGGGAGGGGAGAAGGGAGGG - Intergenic
1148778142 17:50107185-50107207 TTGGGGCTGGGGACGTGGCAGGG + Intronic
1148908785 17:50928606-50928628 ATGAGGCTGAGCAGGTCGCAGGG - Intergenic
1149382199 17:56105527-56105549 AGGAGGCAGGGAAGGAGGGAGGG - Intergenic
1149779564 17:59386591-59386613 AAGAGGCAGGAGAGGTGGCATGG + Intronic
1149847570 17:60016605-60016627 GTGAGGCCGGGGAGGCAGCAGGG - Intergenic
1149925379 17:60697209-60697231 ATGAGGGAGGGAAGGAGGGAAGG + Intronic
1150008645 17:61485735-61485757 GAGGGGCAGGGCAGGTGGCAAGG - Intergenic
1150085928 17:62273222-62273244 GTGAGGCCGGGGAGGCAGCAGGG - Intronic
1150125671 17:62632919-62632941 ATGAGGCAGGAGTGTGGGCATGG + Intronic
1150457336 17:65317372-65317394 ATGAGGAAGGGGAAGGGGCTTGG + Intergenic
1150620337 17:66803307-66803329 ATGAGGTAGGTGTGGCGGCAAGG - Intronic
1151321742 17:73356680-73356702 AGGAGGGAGGAGAGGGGGCAAGG - Intronic
1151357683 17:73570192-73570214 AACAGGGAGGGGAGGTAGCAAGG - Intronic
1151472745 17:74328018-74328040 ATGAGGCCTGGTAGGTGGGATGG - Intronic
1151684508 17:75638906-75638928 ACGAGGCAGAAGAGGGGGCAAGG + Exonic
1152043879 17:77923504-77923526 CTGAGGCAGGGCAGCTTGCAAGG + Intergenic
1152083194 17:78201469-78201491 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1152149621 17:78590807-78590829 ATTAGCCAGGCGTGGTGGCAAGG - Intergenic
1152266240 17:79296676-79296698 AGGAGGAAGGGGAGGAGGGAGGG - Intronic
1152289003 17:79428281-79428303 GTGAGGGAGGGCAGGTGCCATGG + Intronic
1152310540 17:79547297-79547319 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1152341837 17:79729926-79729948 ATGAGCTAGGGGAGCGGGCATGG - Intergenic
1152593825 17:81228719-81228741 ACGAGGGATGGCAGGTGGCAGGG - Exonic
1152704973 17:81838754-81838776 AGGGGGCAGGGGAGGGGACAGGG - Intergenic
1152722965 17:81931812-81931834 CTGCGGCAGGGCAGATGGCATGG - Intergenic
1152737944 17:82006657-82006679 AGGAGGCTGGGGAGGGGGGACGG + Intronic
1152763604 17:82122752-82122774 AGGAGGCAGGGGAAGGGGCTCGG - Intronic
1152807177 17:82361697-82361719 ATGAGCCCGGGGAGGTCGGATGG + Intronic
1152809815 17:82376068-82376090 GTGGGGCAGGGAAGGTGGCCAGG + Intergenic
1152863364 17:82708965-82708987 AGTGGGCAGGGCAGGTGGCAAGG - Intergenic
1152911176 17:83005738-83005760 CTGAGGCAGGGGTGCTGGCCTGG - Intronic
1153259981 18:3214748-3214770 AGGAGGCAGCAGAGGTTGCAGGG + Intronic
1153409387 18:4776887-4776909 AAGAAGCAGAGGAGGTGGAAGGG - Intergenic
1153434952 18:5059179-5059201 GTGAGGCAGGGAAGGAGGGAGGG - Intergenic
1155304198 18:24463335-24463357 AGGAGGCAGGGGAGATGTGAGGG - Intronic
1155492250 18:26410665-26410687 TTGAGCCTGGGGAGGTGGTAGGG + Intergenic
1155895174 18:31316314-31316336 AAAAGGCAGGGAAGGAGGCAAGG + Intergenic
1156036002 18:32769569-32769591 CGGAGGGAGGGGAGGGGGCAGGG - Intronic
1156387423 18:36618735-36618757 AAGAGGAAGGGGAGGTGGCAGGG - Intronic
1156462147 18:37327165-37327187 AGGAGGCAGGGGAAGCGGCGAGG - Intronic
1156482055 18:37442510-37442532 CTGAGGAAGGGAAGGTGGCTGGG + Intronic
1156509994 18:37628309-37628331 GTGGGGCAGGGCTGGTGGCATGG - Intergenic
1156583889 18:38410296-38410318 ATGAGGTTTGGGAGGTGCCAGGG + Intergenic
1157327347 18:46678669-46678691 AGGAGAAAGGGGAGGAGGCAGGG + Intronic
1157359045 18:46962146-46962168 ATGAGCCCGGCGTGGTGGCACGG - Intronic
1157360039 18:46968073-46968095 ATGAGCCCGGCGTGGTGGCACGG - Intronic
1157360638 18:47021665-47021687 ATGAGCCCGGCGTGGTGGCACGG - Intronic
1157361627 18:47027580-47027602 ATGAGCCCGGCGTGGTGGCACGG - Intronic
1157438227 18:47689458-47689480 ATAAGGGAGGGGTGTTGGCAGGG - Intergenic
1157687378 18:49653099-49653121 TGGATGCAGGGGAGGTGGAAGGG - Intergenic
1158146703 18:54322560-54322582 ATGACACAGGGGAGGTGACAAGG + Intergenic
1158423158 18:57313622-57313644 AGGAGGAAGGGGAGGAGGAAAGG + Intergenic
1158530147 18:58253256-58253278 ATCAGTCAGTGGAGGTGCCAGGG + Intronic
1158973278 18:62687966-62687988 ATTAGCCAGGGGTTGTGGCATGG + Intergenic
1160421525 18:78750722-78750744 AAAAGGCATGGGAGGTGGGAGGG - Intergenic
1160505812 18:79426420-79426442 AAGCGGCATGGGACGTGGCATGG - Intronic
1160872035 19:1282078-1282100 AGGAGGAAGGGGAGGAGGGAGGG + Intergenic
1160872162 19:1282449-1282471 AGGAGGGAGGGGAGGTGGGAGGG + Intergenic
1160872187 19:1282510-1282532 AGGAGGGAGGGGAGGAGGGAGGG + Intergenic
1160876017 19:1296515-1296537 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1161022220 19:2015742-2015764 AGGAGGGAGGGGAGGAGGGAAGG + Intronic
1161262530 19:3345666-3345688 AGGAGGCAAGGGAGGAGCCATGG - Intergenic
1161544855 19:4874233-4874255 ATGAGGAATGGGAGGAGGAAAGG + Intergenic
1162338520 19:10076758-10076780 AGGAGGGAGGGAAGGAGGCAGGG + Intergenic
1162385709 19:10359393-10359415 ATGTGGCTGGGGAGGTGTCAGGG + Intronic
1162473507 19:10886484-10886506 ATGAGGGAGGGGGCGGGGCATGG - Intronic
1162478711 19:10915771-10915793 ATGAGTCAGGGCCAGTGGCAGGG - Intronic
1162695707 19:12472733-12472755 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1162934757 19:13976400-13976422 ATGGGAGAGGGAAGGTGGCATGG + Intronic
1163043137 19:14617543-14617565 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1163093031 19:15034560-15034582 ATGAGGCTGGAGAGGTGGCTAGG + Intergenic
1163102887 19:15108384-15108406 ATGAGACAGGAGAGGAGGGAGGG + Intronic
1163305223 19:16473661-16473683 TTAAAGCAGGGGAGGTGGCTGGG + Intergenic
1163322278 19:16581780-16581802 ATAAGGCAGGGGAGGGGCCAAGG - Intronic
1163408990 19:17141636-17141658 TTGAGGCAGGGAAGGTGCCTGGG - Intronic
1163441419 19:17324195-17324217 TTGGGGCAGGGGAGGTGGTGGGG + Intronic
1163556654 19:17997220-17997242 ATTAGGCTGGGGAGGGGACAGGG - Intronic
1163692449 19:18745102-18745124 ATGAGGCCGGGCATGTAGCAGGG + Intronic
1163769450 19:19182050-19182072 ATGGGGCCAGGGAGATGGCAGGG - Intronic
1164011192 19:21204762-21204784 ATGAGGCAAGGGACATGGAATGG - Intergenic
1164628577 19:29746021-29746043 ATCAGCCAGGTGTGGTGGCATGG - Intergenic
1164715249 19:30386084-30386106 ATGAAGCTGGGAAGGTGGGATGG - Intronic
1165072651 19:33264511-33264533 AGGAGGCATGGGAGTTGTCATGG - Intergenic
1165216450 19:34277192-34277214 ATGAGGCTGGAGAGGTGGGCAGG + Intronic
1165388796 19:35526914-35526936 ACGAGGCCGGGAAGGAGGCAGGG - Exonic
1165490616 19:36120987-36121009 ATGAGGGCCGGGAGGTGTCAGGG + Intronic
1165619372 19:37232220-37232242 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
1165813410 19:38626120-38626142 CAGGGGCAGGGGAGATGGCAGGG + Intronic
1166015262 19:39974634-39974656 GTGAGGCGGTGCAGGTGGCAGGG + Intronic
1166327997 19:42062894-42062916 ATGGGGAAGGAGAGGAGGCAGGG - Intronic
1166658109 19:44627088-44627110 ATGAGGCTGGCCAGGTGGCAGGG + Intronic
1166695235 19:44848083-44848105 ATGAGGCCAGAGAGGTGGCCGGG - Intronic
1166707199 19:44914655-44914677 ATCAGGCTGGGGAGGGGGCGGGG - Exonic
1166709304 19:44926751-44926773 ATCAGGCTGGGGAGGGGGCGGGG - Intergenic
1166745439 19:45139868-45139890 ATGAGCCTGGGAAGATGGCAAGG - Intronic
1166840869 19:45696155-45696177 ATGAGGCTGGAGAGGTAACAGGG - Intronic
1166882359 19:45937390-45937412 ATGAGGAAGGGAAGGAGCCAGGG - Exonic
1166976930 19:46610286-46610308 AAGAGGCAGGGAAGAGGGCACGG - Exonic
1167077849 19:47260061-47260083 ATGAGGTCGGGGAGGTACCAAGG + Intronic
1167081185 19:47277033-47277055 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1167457644 19:49605787-49605809 ACGGGGCAGGGGAGGGGGCCAGG + Intronic
1167465856 19:49650950-49650972 AGGATGCAGAGGAGGGGGCAGGG - Exonic
1167570118 19:50281637-50281659 TGGAGGCAGGGGAGGAGGCACGG + Exonic
1167575294 19:50314901-50314923 GAGAGCCAGGGGGGGTGGCAAGG + Intronic
1167576259 19:50319378-50319400 AGGAGGCAGGTGAGCTGGGAGGG - Intronic
1167590320 19:50401139-50401161 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1167638818 19:50669052-50669074 AGGATGCAGGGGAGGAGGCGGGG + Exonic
1167893859 19:52564936-52564958 ATGAGCCAGGCGCTGTGGCAGGG + Intronic
1168150949 19:54448445-54448467 AGGGCGCAGGGGAGGGGGCACGG - Intergenic
924982301 2:235341-235363 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982314 2:235382-235404 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982321 2:235401-235423 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982328 2:235420-235442 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982355 2:235502-235524 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982362 2:235521-235543 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982389 2:235603-235625 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982423 2:235707-235729 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982442 2:235770-235792 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982448 2:235789-235811 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982455 2:235808-235830 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982482 2:235893-235915 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982508 2:235978-236000 ATGGGTCAGGGGAGGCAGCATGG + Intronic
924982514 2:235997-236019 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982521 2:236016-236038 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982534 2:236057-236079 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982541 2:236076-236098 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982561 2:236139-236161 ATGGGCCAGGGGAGGCAGCATGG + Intronic
924982595 2:236246-236268 ATGGGCCAGGGGAGGCAGCATGG + Intronic
925167974 2:1730581-1730603 CACAGGCAGGGGAGGAGGCATGG + Intronic
925408804 2:3626973-3626995 GTGGGCCAGGGGAGTTGGCAGGG - Intronic
925429348 2:3777898-3777920 ATCAGGGAAGGCAGGTGGCATGG - Intronic
925489833 2:4378678-4378700 AGGAGGCAGAGAAGGGGGCAAGG - Intergenic
925948934 2:8893101-8893123 AGGAGGCAGGGGAGGTGGGCAGG + Intronic
925953407 2:8937243-8937265 ATGAGGCAGGGGCCATGGCTGGG + Intronic
925957166 2:8978150-8978172 ATGAGGCTGGAGAGGTGGAAGGG - Intronic
925969258 2:9095686-9095708 TGGTGGCAGGGGTGGTGGCAGGG - Intergenic
925969263 2:9095698-9095720 TGGTGGCAGGGGTGGTGGCAGGG - Intergenic
926037610 2:9647422-9647444 ATGGGGCAGAGGAGGTGGGTGGG + Intergenic
926125557 2:10269839-10269861 ATGAAGCAGCGGAGGTGGGGAGG - Intergenic
926146664 2:10400573-10400595 ATGAGGCAGGGCAGCGGGGAAGG + Intronic
926230035 2:10995486-10995508 ATGAGGCTGTGCATGTGGCATGG + Intergenic
926544136 2:14217955-14217977 AGGAGGTAGAGGAGGTGGAAGGG + Intergenic
926624030 2:15075307-15075329 AAGATGCAGGGCAGGGGGCAGGG - Intergenic
926856404 2:17260919-17260941 ATGAGACACTGTAGGTGGCAGGG + Intergenic
926856615 2:17263422-17263444 ATGAGACACTGTAGGTGGCAGGG - Intergenic
927517378 2:23680249-23680271 ATGAGGGAGGGGAGGAGTCTGGG + Intronic
927641734 2:24849801-24849823 CTGAGGCTTGGGGGGTGGCAGGG - Intronic
927689905 2:25201220-25201242 ATTAGCCAGGTGTGGTGGCAAGG - Intergenic
927821482 2:26269340-26269362 ATTAGCCAGGCGTGGTGGCATGG - Intronic
928021175 2:27706270-27706292 CTGAGGGTGGGGAGGTGGGAGGG + Exonic
928241707 2:29592268-29592290 ATGAGTCAGGTGATGTGGCTGGG - Intronic
928385675 2:30865867-30865889 GTGAGGCAGGGGATGGAGCAAGG + Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928781934 2:34833792-34833814 AGGAGGAAGGGGAGGTGGAGGGG + Intergenic
929095853 2:38262723-38262745 ATGTGGAGGGGGAGGGGGCAGGG - Intergenic
929152320 2:38758389-38758411 ATTAGCCAGGCGTGGTGGCATGG - Intronic
929480856 2:42306639-42306661 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
929730478 2:44486110-44486132 ATTAGCCAGGCGTGGTGGCACGG - Intronic
929983106 2:46699218-46699240 GTGAAGAAGGGGAGGCGGCAGGG + Intronic
931172486 2:59818490-59818512 GTGAGGTAGGTGAGGTGCCAAGG - Intergenic
931352116 2:61500649-61500671 ATTAGCCAGGGGTGGTGGCGCGG + Intronic
931515592 2:63049148-63049170 AAGAGGCAGGGGAGGAGGGGTGG - Intergenic
931524221 2:63134973-63134995 ATTAGCCAGGTGTGGTGGCACGG + Intronic
931693794 2:64857702-64857724 GTGAGGAAGGGGAGTTTGCAGGG - Intergenic
931776368 2:65544489-65544511 ATGAGGCTGGTGAGGTTACATGG + Intergenic
931782694 2:65592373-65592395 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
932207353 2:69894827-69894849 ATTAGCCAGGCGTGGTGGCACGG - Intronic
932956599 2:76357896-76357918 ATGAGACATGGGAGGGGCCAGGG + Intergenic
933608233 2:84406802-84406824 ATGGGATAGGGAAGGTGGCATGG - Intergenic
933733940 2:85480056-85480078 AGGAGCCAGGTGTGGTGGCATGG + Intergenic
933920051 2:87036450-87036472 ATGAGGCAGGTGAGGCAGAACGG + Intergenic
933928445 2:87123182-87123204 ATGAGGCAGGTGAGGCAGAACGG + Intergenic
933931573 2:87157336-87157358 ATGAGGCAGGTGAGGCAGAACGG - Intergenic
933973161 2:87486553-87486575 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
934002944 2:87733448-87733470 ATGAGGCAGGTGAGGCAGAACGG - Intergenic
934567681 2:95349606-95349628 CTGAGCCCGGGGTGGTGGCATGG + Intronic
935231203 2:101098242-101098264 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
935619642 2:105117580-105117602 ATGAGGAAGGGGAGGGGTCTAGG - Intergenic
935622982 2:105144615-105144637 GTGAGGCAGGGGAGCTGGGATGG - Intergenic
935831463 2:107005011-107005033 ATGAGGGAGGGGATGAGGAATGG + Intergenic
935949078 2:108312556-108312578 ATGAGATATGGGAGGGGGCAGGG + Intergenic
936320560 2:111463660-111463682 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
936361547 2:111808098-111808120 ATGAGGCAGGTGAGGCAGAACGG + Intronic
936526337 2:113244238-113244260 ATGGGGCAAGGGAGGAGGCAGGG + Intronic
936528010 2:113255210-113255232 AGGAGGGAGGGGAGGAGGGAGGG + Intronic
936528016 2:113255222-113255244 AGGAGGGAGGGGAGGAGGGAGGG + Intronic
936528022 2:113255234-113255256 AGGAGGGAGGGGAGGAGGGAGGG + Intronic
936528033 2:113255257-113255279 AGGAGGGAGGGGAGGAGGGAGGG + Intronic
936528039 2:113255269-113255291 AGGAGGGAGGGGAGGAGGGAGGG + Intronic
936528050 2:113255292-113255314 AGGAGGGAGGGGAGGAGGGAGGG + Intronic
936779212 2:116011892-116011914 TTGGGGAAGGGCAGGTGGCAAGG + Intergenic
937312429 2:120910342-120910364 ATGGGGGAGGGATGGTGGCAGGG + Intronic
937486099 2:122316341-122316363 AAGAGGCAGGGGATGTGGGTGGG + Intergenic
937492647 2:122386166-122386188 ATTAGCCAGGTAAGGTGGCATGG - Intergenic
937595304 2:123664985-123665007 TAGAGGCAGGGGAGTTGGCATGG + Intergenic
937703228 2:124887813-124887835 GTCAGGCAGTGGAGGTGGAATGG + Intronic
937762900 2:125627386-125627408 CTGTTGCAGGGGAGGGGGCAAGG + Intergenic
938199778 2:129363203-129363225 AGGAAGCACGGGAAGTGGCACGG - Intergenic
938206654 2:129430026-129430048 ATGGGGCAGGGGAGGAGCCTGGG - Intergenic
938297203 2:130185682-130185704 AGGAGGCAGGTGGGGGGGCACGG + Intronic
939962856 2:148581111-148581133 ATGAAGCAGGGGAGGGTCCAAGG + Intergenic
940145866 2:150543042-150543064 CTGAGGCCGAGGAGGTGCCAAGG + Intergenic
940621842 2:156122413-156122435 ATGAGACTGGGGAGGGGTCAGGG + Intergenic
940886030 2:158990061-158990083 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
940894624 2:159068885-159068907 ATTAGCCAGGCGTGGTGGCACGG - Intronic
941642027 2:167999084-167999106 ATAAGGATGGGGAGGGGGCAGGG - Intronic
941705259 2:168651604-168651626 ATGGTGCAGGAGAGGTGTCAGGG + Intronic
942115288 2:172722668-172722690 GTGAGGTAGGGGTGATGGCATGG + Intergenic
942238764 2:173939615-173939637 ATTAGCCAGGTGTGGTGGCATGG + Intronic
942422175 2:175819726-175819748 CTGTCGCAGGTGAGGTGGCAGGG - Intergenic
942661113 2:178266143-178266165 ATGAGGCAAGGAAGGAAGCAGGG + Intronic
942964360 2:181873131-181873153 ATGAAGCGGGGGTGGGGGCAGGG + Intergenic
943362904 2:186943534-186943556 TGGAGGCAGGGCAGGGGGCAGGG + Intergenic
943774325 2:191748971-191748993 GTCAGGTATGGGAGGTGGCAAGG + Intergenic
944047554 2:195430203-195430225 ATAAGGCAAGGGAGGTCACATGG + Intergenic
944163476 2:196691791-196691813 ATTAGCCAGGCGTGGTGGCATGG + Intronic
944626135 2:201570681-201570703 ATGAGCTAGAGGAGTTGGCAGGG - Intronic
945047870 2:205797854-205797876 GTGGGGCAGGGGAGTTGACAGGG + Exonic
945493491 2:210482448-210482470 ATTAGCCAGGCGTGGTGGCACGG - Intronic
945683263 2:212938570-212938592 ATGTGGCAGGTAAGGTGCCAAGG + Intergenic
946072496 2:217046614-217046636 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
946232739 2:218302598-218302620 AGGAGACTGGGGAGGTGGCAGGG + Intronic
946250051 2:218406283-218406305 ATGCGGCGGGGGAGGGGGCGTGG + Intergenic
946379178 2:219332813-219332835 ATGAGGGTGGGGAGGCGGTAGGG - Intronic
946832647 2:223741826-223741848 AGGAGGAAGGGGAGGAGGGAGGG - Intergenic
946877893 2:224148212-224148234 ATTAGCCAGGCGCGGTGGCATGG + Intergenic
947757750 2:232580404-232580426 ATGGGGCAGTGGAGGTGGAAGGG - Intronic
947970456 2:234318959-234318981 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
948187939 2:236035908-236035930 ATGTGGCAGGTGGGGTCGCAGGG + Intronic
948293433 2:236844177-236844199 ATGGGGAAAGGGAGGAGGCAAGG + Intergenic
948295131 2:236855144-236855166 ATGAGGCAGGGGAGGTATGCAGG - Intergenic
948437261 2:237962076-237962098 ATGTGGAAGGGGAGATGGCCTGG - Intergenic
948616511 2:239202648-239202670 ACGCGGGAGGGGCGGTGGCAGGG + Intronic
948994374 2:241571085-241571107 GTGAGGCAGGGGGTGGGGCAAGG + Intronic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1168949889 20:1790062-1790084 ATGAGGCTGGAGAGATGGAACGG + Intergenic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169123243 20:3109861-3109883 CTCAGGCAGGGGGGGTGGCAGGG + Exonic
1169178622 20:3542554-3542576 AAGGGGAAGGGGAGGTGGAAGGG - Intronic
1169216324 20:3796607-3796629 AGGAGGCCCGGGAGGTGGCCCGG - Exonic
1169327694 20:4688273-4688295 AAGTGTCTGGGGAGGTGGCAGGG + Intronic
1169516862 20:6326224-6326246 TGGAGGGAGGGAAGGTGGCATGG + Intergenic
1169769769 20:9188195-9188217 ATTAGGCAGGGGAGGAAGGATGG + Intronic
1170009960 20:11712159-11712181 ATGGGGCAGGGGAGGAAGCCTGG - Intergenic
1170270770 20:14524851-14524873 ATGAGGCAAGTGAGGAAGCAGGG - Intronic
1170876800 20:20257465-20257487 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
1171378999 20:24718948-24718970 ATGAGGCAGGGGTGGCAGCAGGG - Intergenic
1171851068 20:30308304-30308326 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1172011944 20:31850739-31850761 AGGAGGCCAGGGAGGAGGCAGGG + Intronic
1172029947 20:31974919-31974941 ATGGGCAAGGGGAGGAGGCAGGG - Intronic
1172092306 20:32442027-32442049 AAGCGGCAAGGGAGGTGTCAAGG + Intergenic
1172126489 20:32627764-32627786 CTGAGGCTGAGGAGGTGGCGGGG - Intergenic
1172213571 20:33217696-33217718 ACGGGGCTGGGGAGGTGGGAAGG + Intronic
1172466892 20:35161934-35161956 ATGAGCCAGGCGTGGTGGCAGGG + Intergenic
1172479746 20:35264017-35264039 ATGGGGCAGGGGACGAGGGAGGG + Intronic
1172502874 20:35439373-35439395 ATCAGCCAGGTGTGGTGGCAGGG - Intronic
1172616262 20:36287091-36287113 ATGAGCCAGGTGACATGGCATGG + Intergenic
1172683979 20:36739297-36739319 ATGAGCCAGGTGTGGTGGCATGG + Intronic
1172701680 20:36857052-36857074 AAGAGGCAGGGGAGGTACCCGGG + Intronic
1172841048 20:37903030-37903052 AGGAGGGAGGGGAGGAGGGAGGG + Intergenic
1172843583 20:37916299-37916321 ATAGGGCAGGGGCGGGGGCAGGG - Intronic
1173002044 20:39111641-39111663 AGGAGGAAGGGGAGGAGGAAGGG + Intergenic
1173407989 20:42783853-42783875 AGGAGGCAGGGGAGTAGGGATGG + Intronic
1173583864 20:44166946-44166968 ATGAGGCAGGGGAGGTGGCAGGG - Intronic
1173627405 20:44483327-44483349 ATGAGGCAAGAGAGCTGGCCTGG - Intronic
1173840334 20:46152885-46152907 ATTAGGCAGGCTTGGTGGCATGG - Intergenic
1173851846 20:46223314-46223336 CTGAGTCTTGGGAGGTGGCAGGG - Intronic
1173853997 20:46238039-46238061 CTGAGGATGGGGAGGTGCCAGGG - Intronic
1174081536 20:47973638-47973660 ATGAGGCGGGGGAGGGGCCGGGG + Intergenic
1174145044 20:48447531-48447553 AGGAGGCAGGGGAGGGAGGAGGG + Intergenic
1174325614 20:49776433-49776455 ATGAGGGTGGGGAGGTGGGCGGG - Intergenic
1174341024 20:49895483-49895505 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1174395475 20:50244307-50244329 ATGAGGAAGGCGAGGCAGCATGG + Intergenic
1174401913 20:50280517-50280539 ATGGGTCAGGGGTGCTGGCAAGG + Intergenic
1174414802 20:50359680-50359702 ATGAGACAGGAGAGCTGGCCAGG + Intergenic
1174448622 20:50606875-50606897 ATTAGCCAGGCGTGGTGGCACGG - Intronic
1174507797 20:51027983-51028005 ATTAGCCAGGTGAGGTGGCAGGG - Intergenic
1174557797 20:51408114-51408136 ATGTGGCAGGGTCGGTGGCTGGG + Intronic
1174735692 20:52963792-52963814 ATGAGGCAGGAGAGATGGACTGG - Intergenic
1175052195 20:56166151-56166173 ATAAGGAAGGGGAGGAGGCCAGG + Intergenic
1175227384 20:57452509-57452531 TTGAGGCAGGGGCGGCAGCAGGG + Intergenic
1175311057 20:58011810-58011832 ACAGGGCAGGGGAGGTGACAAGG + Intergenic
1175383139 20:58577362-58577384 ATAAGGCAGGGGTGGAGCCATGG + Intergenic
1175420208 20:58827269-58827291 ATGAGTCAGGAGAGAGGGCATGG - Intergenic
1175681774 20:60994643-60994665 CTGAGGTAGAGGAGGTGGGAGGG - Intergenic
1175996120 20:62813055-62813077 ATGGGGCAGGGGACCCGGCAAGG - Exonic
1176159563 20:63641481-63641503 ATGAGGCCGGGCGGGTGCCAGGG - Intronic
1176298422 21:5086630-5086652 ATGGGGCAGGGGAAGTGGGGTGG + Intergenic
1176523843 21:7849957-7849979 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1176589838 21:8636456-8636478 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1178266367 21:31146284-31146306 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
1178389391 21:32185798-32185820 CAGAGGGAGGGGAGGTGGCAGGG - Intergenic
1178463295 21:32822920-32822942 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1178488498 21:33033386-33033408 ACGGGGCAGGGGATGTGGCCCGG - Intergenic
1178657863 21:34479969-34479991 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1178931113 21:36820126-36820148 ATGAGGCAAAGGAAGGGGCAGGG + Intronic
1179534916 21:42045223-42045245 ATGAGCCCAGGGAGGTGGCTGGG + Intergenic
1179672048 21:42956227-42956249 ATTAGCCAGGTGTGGTGGCAAGG + Intergenic
1179858604 21:44175319-44175341 ATGGGGCAGGGGAAGTGGGGTGG - Intergenic
1179881887 21:44296477-44296499 CTGAGGCAGGGGAGGGGGAGTGG - Intronic
1179891639 21:44338689-44338711 GTGAGGGAGGGGAGGAGGCCGGG - Intronic
1180058854 21:45374557-45374579 GAGGGGCAGGGGAGGAGGCAGGG - Intergenic
1180104253 21:45607571-45607593 AGGAGGGAGGGGAGGAGGGAGGG + Intergenic
1180130087 21:45821561-45821583 ATGAGTTAGGGGAGGGGGCGGGG - Intronic
1180272671 22:10613471-10613493 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1180938580 22:19641960-19641982 AAGAGGTGGGGGAGGGGGCAGGG + Intergenic
1181112927 22:20612413-20612435 ATGGGTCAGGGGAACTGGCAAGG - Intergenic
1181278499 22:21702443-21702465 AAGAGGCAGAGCAGGTGGCCTGG + Intronic
1181280975 22:21720350-21720372 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1181521115 22:23449302-23449324 ATGAGTTAGAGGAGGTGGCGGGG - Intergenic
1181682546 22:24505858-24505880 ATCAGGCAGGCATGGTGGCACGG - Intronic
1182415084 22:30216352-30216374 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
1182490174 22:30666472-30666494 ATTAGCCAGGCGTGGTGGCATGG + Intronic
1182539542 22:31030802-31030824 ACGAGGTAGAGGAGGTGGAAGGG - Intergenic
1182548506 22:31089134-31089156 TTGAAGCAGGGGAGGTGCCAGGG - Intronic
1182984342 22:34702247-34702269 ATGAAGCAGGCCAGGTAGCAAGG + Intergenic
1183218557 22:36497030-36497052 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1183231744 22:36586639-36586661 GTTGGGAAGGGGAGGTGGCAGGG + Intronic
1183362444 22:37389745-37389767 TCCAGGCAGGGGAGGGGGCATGG - Intronic
1183410905 22:37654602-37654624 GTGAAGGAGAGGAGGTGGCAGGG + Intronic
1183463500 22:37967332-37967354 AGGAGGCAGGGAAAGTGGGAGGG + Intronic
1183520232 22:38292673-38292695 TTGGGGAAGGGGAGGCGGCAGGG - Intronic
1183530129 22:38348840-38348862 AGGAGGCAGAGGAGGGAGCAGGG + Intronic
1183733273 22:39629984-39630006 ATGAGGCTGGGGAGGAGACAGGG - Intronic
1184245599 22:43234453-43234475 ATGGGGCAGGGGATGGGGCTGGG - Intronic
1184342855 22:43895649-43895671 AGGAGGCAGGGGAGGGGGCTTGG - Intergenic
1184533304 22:45070577-45070599 ATGGGGCAGGGGCAGTGACAGGG - Intergenic
1184649664 22:45913743-45913765 GCGAGGCAGGGGATGAGGCAGGG - Intergenic
1184743081 22:46440323-46440345 TGGAGGCAGGGGAGGCAGCATGG - Intronic
1184921359 22:47608027-47608049 ATTAGCCAGGGGTGGTGGCATGG - Intergenic
1185180407 22:49357153-49357175 ATCAGGCAGGGCAGGTGCAACGG + Intergenic
1185193167 22:49451702-49451724 TTCAGGCAGGGCAGGTGGTAGGG - Intronic
949137450 3:585250-585272 ATCAGCCAGGCGTGGTGGCAGGG - Intergenic
949281795 3:2354791-2354813 ATAAGGAAGAGTAGGTGGCAGGG - Intronic
949538489 3:5013764-5013786 ATGAGGCAGAGGAGGAGGAGGGG - Intergenic
949937465 3:9127187-9127209 ATTAGCCAGGTGTGGTGGCATGG + Intronic
950200068 3:11036419-11036441 CTGAGGACTGGGAGGTGGCAGGG + Intronic
950461027 3:13122319-13122341 AAGTGGCAGGGCAGGTGGCCAGG + Intergenic
950808822 3:15632206-15632228 ATGAGGCAGTGAAGGTGGTAAGG - Intronic
950983269 3:17331904-17331926 ATGAGGTTGGAGAGGTGGCCAGG + Intronic
951568890 3:24041312-24041334 ATGAGGCAGGTAAGGTGTCTAGG + Intergenic
952288872 3:31995906-31995928 ATCAGGAAGGGGAGATGTCATGG - Intronic
952414290 3:33076330-33076352 CTGAGGCAGAGGAGGAGGCCAGG + Intronic
952512440 3:34070838-34070860 AGAAGGCAGGGGAGGTAGCCAGG + Intergenic
952618691 3:35308318-35308340 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
952902741 3:38120781-38120803 ATGAGGCAGGTGAGGTTGGATGG - Intronic
952974446 3:38682025-38682047 ATGAGGCAAGGGATGTGGCACGG + Intergenic
953469310 3:43153720-43153742 ATGGGGTGGGGGAGGTGTCAAGG + Intergenic
953916680 3:46925001-46925023 CTGAGGCAGGGGAGAGGGCCTGG - Intronic
954092918 3:48299918-48299940 GTGAGGGAGGGGAGGTGTCATGG - Intronic
954150890 3:48656507-48656529 ATGAGACTGGGGAGGGGGCGGGG - Intronic
954345832 3:49998441-49998463 CTGAGGCAGTGGAGGAAGCATGG + Intronic
954432406 3:50477894-50477916 AGGAGGCAGGGCAGGAGGCCAGG - Intronic
954454876 3:50592427-50592449 ATCAGGGAGGGAGGGTGGCAGGG - Intergenic
954585828 3:51735580-51735602 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
954793141 3:53147532-53147554 AGGCTGCAGGGGAGATGGCATGG + Intergenic
954808978 3:53236387-53236409 ATGAGGCAGGAGAGGCTGCAGGG - Intronic
954895307 3:53970182-53970204 ATGAGGAAAGGGGGATGGCATGG - Intergenic
954901310 3:54022320-54022342 ATGAGGCTGGCGAGGTGGGAAGG + Intergenic
954959779 3:54554004-54554026 ATGAGGCTGGAGAGGTGGGGAGG - Intronic
955220623 3:57020291-57020313 AAGTGAGAGGGGAGGTGGCAGGG - Intronic
955327953 3:58024145-58024167 AGGAGGCAGAGGAGATGGAATGG + Intronic
956279939 3:67545690-67545712 ATGAGGCAGGGAAGGAGAGAAGG - Intronic
956852365 3:73241410-73241432 ATTAGCCAGGTGTGGTGGCACGG - Intergenic
957380501 3:79422327-79422349 ATGATGCCAGGCAGGTGGCAAGG - Intronic
958018644 3:87971009-87971031 CTGTGGAAGGGGAGGAGGCAGGG - Intergenic
958487926 3:94735116-94735138 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
958603939 3:96333665-96333687 ATGGCTCAGTGGAGGTGGCAAGG - Intergenic
959225598 3:103579809-103579831 ATGTGGCAGGGTGGGTGGCTGGG + Intergenic
959303368 3:104630424-104630446 ATGAGGTATGGGAGGGGTCAGGG - Intergenic
959530596 3:107430996-107431018 AGGAGGGAGGGGAGGAGGTACGG + Intergenic
960562835 3:119104271-119104293 ATGAGGCAGGAGAGGTAGATAGG - Intronic
960957574 3:123044848-123044870 AAGATGAAGGGGAGGAGGCAGGG - Intergenic
961140712 3:124553603-124553625 AAGAGGGAGGAGAGGTGGCTGGG - Intronic
961171597 3:124801416-124801438 AAGAAGCAGGAGAGGTGGCAGGG - Intronic
961750640 3:129092372-129092394 CCGAGGGAGGGGAGGTGACATGG + Intronic
961940852 3:130636737-130636759 AGGAGGAAGGGGAGGGGGAAGGG - Intronic
961952666 3:130766322-130766344 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
962150841 3:132891789-132891811 ATGAGGCCAGAGAGATGGCAGGG + Intergenic
962203388 3:133417133-133417155 ATGAGAGAGGGGAGAGGGCAGGG - Intronic
962240884 3:133749871-133749893 ATGAGGGAGGGGAGAACGCAGGG + Intronic
962326186 3:134434521-134434543 CTGAGGCTGGGGTGGTGGGAGGG - Intergenic
962551330 3:136495531-136495553 ATCAGCCAGGTGTGGTGGCATGG + Intronic
962580191 3:136791138-136791160 ATGAGGCTGGAGAGGGAGCAGGG - Intergenic
962978846 3:140469806-140469828 GTGAGGCAGGGGAAGAGGGAGGG + Intronic
963123383 3:141794492-141794514 ATGAAGATGGAGAGGTGGCAGGG + Intronic
963938873 3:151081445-151081467 AAAAGGCAGGGGAAGTGGGAGGG - Intergenic
965373891 3:167897614-167897636 AGGAGGGAGGGGAGGGGGGAGGG + Intergenic
965373905 3:167897638-167897660 AGGAGGGAGGGGAGGGGGGAGGG + Intergenic
965609391 3:170528757-170528779 AGGAGGAAGGGGACGTGGAAGGG - Intronic
965625590 3:170681608-170681630 AAAAAGGAGGGGAGGTGGCATGG - Intronic
966060677 3:175750406-175750428 AGGAGGGAGGGGTGGAGGCAGGG - Intronic
966226904 3:177607607-177607629 AAGAGGGAGAGGAGGTGGCAGGG + Intergenic
966364818 3:179173872-179173894 ATTAGCCAGGTGTGGTGGCAGGG - Intronic
966523910 3:180900589-180900611 ATCAGCCAGGCGTGGTGGCACGG + Intronic
966734890 3:183180470-183180492 AAGAGACAGGGGAGGAGGAAGGG - Intronic
966762703 3:183431362-183431384 AACAGGCAGGGAAGGTGGGAGGG - Intergenic
966819897 3:183916045-183916067 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
966861596 3:184233663-184233685 ATGGGGCAGGGCAGCGGGCAGGG - Exonic
966918485 3:184597631-184597653 ATGAGGGAGGGGGTGGGGCAGGG + Intronic
966974807 3:185074333-185074355 ATGAGGCAGGGGTGGTGTGGGGG - Intergenic
967063787 3:185896061-185896083 ATTAGCCAGGAGTGGTGGCATGG - Intergenic
967198609 3:187051160-187051182 GAGAGGCGGGGGAGGGGGCAAGG - Intronic
967315466 3:188148607-188148629 ATGAGGAAGGGGAAGCTGCAGGG + Intergenic
967848398 3:194062945-194062967 TTGAGGCTGGGGGGGTGGGAGGG + Intergenic
967978074 3:195046464-195046486 ATGAGCCAGGAGAGGGGGCCCGG + Intergenic
968002837 3:195219503-195219525 ATGAGGAAGGGAAGGAGGGAGGG + Intronic
968620606 4:1601922-1601944 GTGGGCCAGGGGAGGTGGGACGG + Intergenic
969021006 4:4140361-4140383 ATCAGCCAGGAGGGGTGGCAGGG - Intergenic
969173723 4:5383958-5383980 ATGAAGGAGGGGAGGTGATAGGG + Intronic
969732850 4:8967063-8967085 ATCAGCCAGGAGTGGTGGCAGGG + Intergenic
969858772 4:10019924-10019946 ATGAGCCAGGGCAGGAGGGATGG + Intronic
970260842 4:14222832-14222854 GTGACGCTGGGGAGTTGGCAGGG + Intergenic
970444511 4:16112682-16112704 AGGAGGGAGGGGAGGAGGGAGGG + Intergenic
971436603 4:26632585-26632607 AAGAGGTAGAGGAGGTGGAAGGG + Intronic
971679723 4:29681576-29681598 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
972034008 4:34497498-34497520 ATGAAGCAGGGGTAGTGGCAAGG - Intergenic
972547584 4:40095226-40095248 ATTAGCCAGGCGTGGTGGCATGG - Intronic
972779134 4:42270704-42270726 ATTAGCCAGGTGTGGTGGCACGG + Intergenic
973231348 4:47842463-47842485 ATGAGGCTGGGGAGCTTCCAGGG - Intergenic
973649131 4:52980075-52980097 ATGAAGGAAGGCAGGTGGCAAGG - Intronic
973782985 4:54307028-54307050 AGGAGGCATGGGAGGGGGCGAGG + Intergenic
973796962 4:54437217-54437239 ATGAGGCTGAGCAGTTGGCAAGG + Intergenic
973924748 4:55726117-55726139 ATGAGCCAGGAGAGGTTTCATGG + Intergenic
974282723 4:59820238-59820260 ATGAGCCAGGCGTGGTGGCGGGG - Intergenic
974742144 4:66021163-66021185 ATGAGATTTGGGAGGTGGCAGGG - Intergenic
975618011 4:76266763-76266785 ATGAGGCTTGAGAGGTGACAGGG - Intronic
975657220 4:76653711-76653733 ATTAGCCAGGTGTGGTGGCATGG - Intronic
976086598 4:81413166-81413188 ATGAGGCTGGAGAGGCAGCAGGG + Intergenic
976369149 4:84267059-84267081 CTGTGGCAGGGGAGATTGCATGG + Intergenic
977195458 4:94053528-94053550 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
977600540 4:98929679-98929701 CTGAGCCAGGGGACGTGGGAGGG - Intronic
977637920 4:99322015-99322037 ATGGGGCAGCGGTGATGGCATGG + Intergenic
977805988 4:101298455-101298477 AGTAGGTAGAGGAGGTGGCAGGG - Intronic
978435731 4:108682260-108682282 GTGAGGCAGGGGTGGTGGGAGGG + Intergenic
978660527 4:111120802-111120824 AGGAGACAGGGGTGATGGCAAGG + Intergenic
979492851 4:121348947-121348969 ATTAGCCAGGAGTGGTGGCAGGG + Intronic
980080813 4:128341944-128341966 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
980107703 4:128603591-128603613 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
980165701 4:129224370-129224392 ATGTGACACTGGAGGTGGCATGG - Intergenic
980579721 4:134733303-134733325 ATGAGACAGGGGAGAGGCCAGGG + Intergenic
980998539 4:139805029-139805051 ATTAGCCAGGTTAGGTGGCAGGG + Intronic
981307195 4:143259320-143259342 AGGAAGCAGGGGTGGTGGCTAGG + Intergenic
981365860 4:143902503-143902525 AGGAGGAAGGGGAGGAGGAAAGG - Intronic
981386487 4:144137675-144137697 AGGAGGAAGGGGAGGAGGAAAGG - Intronic
981457568 4:144971756-144971778 GTGTGGCAGTGGAAGTGGCAAGG - Intronic
981530428 4:145747801-145747823 AGGAGGGAGGGAGGGTGGCAAGG - Intronic
981547623 4:145910427-145910449 AAGAGTCAAGGGAGGTGGCATGG - Intronic
982111550 4:152061034-152061056 AAGAGGTAGAGGAGGTGGAAGGG + Intergenic
982249160 4:153386942-153386964 ATGGTGCAGAGGAGGTGGAAAGG + Intronic
982643909 4:157998160-157998182 GGGAGGGAGGGAAGGTGGCAAGG - Intergenic
983018632 4:162646822-162646844 TTGAGGGAGGTGAGGAGGCACGG - Intergenic
983741895 4:171145306-171145328 AAGAGGTAGAGGAGGTGGAAGGG - Intergenic
984114362 4:175661284-175661306 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
984613497 4:181868255-181868277 GTGAGGGAAGGGAGGTGGGAGGG - Intergenic
984617189 4:181912180-181912202 ATGAGGAAGGGGAAAAGGCAAGG + Intergenic
984867805 4:184297510-184297532 ATTAGTCAGGTGTGGTGGCAGGG + Intergenic
985275596 4:188234454-188234476 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
985539408 5:481035-481057 ATTAGCCAGGGGTGGTGGCGTGG - Intronic
985629703 5:1008278-1008300 AGGAGGCAGCGCAGGTGGCCAGG + Intergenic
985665895 5:1181368-1181390 AAAAGCCCGGGGAGGTGGCAGGG - Intergenic
985892033 5:2723650-2723672 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
985913248 5:2898879-2898901 CTGAGGAAGGGGAGCTGACAGGG - Intergenic
986307553 5:6526817-6526839 AAGTGGCAGTAGAGGTGGCAAGG - Intergenic
986357794 5:6945607-6945629 ATGAGGGAGGGCAGGAGGCATGG - Intergenic
986719522 5:10551170-10551192 ATTAGCCAGGTGTGGTGGCAAGG - Intergenic
987003180 5:13681867-13681889 ATCATGCCAGGGAGGTGGCAGGG - Intergenic
987301004 5:16598028-16598050 GTGAGGCAGGGCAGGAGGTAGGG - Intronic
987529962 5:19105029-19105051 ATGTGTCAGGGGAGGTGTGACGG + Intergenic
988201422 5:28074709-28074731 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
989032019 5:37128709-37128731 ATTAGCCAGGTGTGGTGGCATGG + Intronic
989057244 5:37377556-37377578 ATTAGCCAGGGGTGGTGGCAGGG + Intergenic
989264256 5:39454934-39454956 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
990089900 5:52030118-52030140 ATTAGCCAGGCGTGGTGGCATGG + Intronic
990605382 5:57404071-57404093 ATGGGGCAGGGGAGGTGGGGAGG + Intergenic
990619060 5:57540366-57540388 AAGAGGGAGGGTAGGTGGGAGGG - Intergenic
990744462 5:58944750-58944772 AAAAGGCAGGGGAGGTGGTGGGG + Intergenic
990886667 5:60602141-60602163 AGGAAGCAGGGAAGGTGGGAAGG + Intronic
991417593 5:66408149-66408171 GGGAGGCAGGGAGGGTGGCATGG - Intergenic
991501202 5:67279220-67279242 CTTAGGAATGGGAGGTGGCATGG - Intergenic
993419551 5:87683904-87683926 ATGAGGCTGGAGAGATGGCTGGG - Intergenic
993970736 5:94416979-94417001 AAGATGCAAGGGAGGTGGAAGGG - Intronic
994607582 5:101988869-101988891 AAAAGGCAGAGGAGGTGGAAGGG + Intergenic
994657395 5:102610461-102610483 ATGAGGCTGGAGAAGAGGCAGGG - Intergenic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
995573301 5:113503709-113503731 ATGAGGGAGGGGTGGTGTAAGGG + Intergenic
995600533 5:113790736-113790758 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
995752611 5:115470115-115470137 AAGAGGCAGGGGGAGGGGCATGG - Intergenic
996646878 5:125827521-125827543 ATGAGCCAGGGAAAGTGGGATGG - Intergenic
996726659 5:126678601-126678623 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
996747443 5:126857451-126857473 ACGAGGCAGGGGGAGTGACAAGG + Intergenic
997314354 5:132919899-132919921 AGGAAGCAGAGGAGGTGGGATGG + Intronic
998163128 5:139824824-139824846 ACGTGGGAGGGGAGGAGGCAAGG - Intronic
998336710 5:141378373-141378395 ATTAGCCAGGTGGGGTGGCATGG + Intronic
998672287 5:144367322-144367344 GTGAAGCAGGAGTGGTGGCATGG + Intronic
998836087 5:146203884-146203906 GTGGGGGAGGGGAGGTGGCGTGG + Intronic
999366591 5:151027601-151027623 CAGGAGCAGGGGAGGTGGCATGG - Intronic
1000210174 5:159100856-159100878 TTGAGGCGGGGGCGGTGGGATGG + Intergenic
1001061251 5:168490987-168491009 ATTAGCCAGGGATGGTGGCATGG + Intronic
1001260615 5:170225419-170225441 ATGAGGCTGGAGAGGGAGCAGGG - Intergenic
1001339891 5:170833674-170833696 TGGAGGCAGGGTTGGTGGCAGGG - Intergenic
1001545363 5:172567711-172567733 GGAAGGGAGGGGAGGTGGCAGGG - Intergenic
1001802899 5:174558941-174558963 AGGAGGGAGGGAAGGAGGCAAGG - Intergenic
1001814995 5:174661045-174661067 GGGAGGCAGGGGAAGTGCCACGG + Intergenic
1002103950 5:176870710-176870732 AGGAGGCATGGGAGGTGGTGGGG - Intronic
1002141704 5:177145424-177145446 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1002157000 5:177290553-177290575 ATTAGCCAGGTGTGGTGGCAGGG - Intronic
1002213701 5:177613052-177613074 ATGAGGCAGGTGAGTGGGCGTGG + Intergenic
1002314690 5:178335545-178335567 CTGAGCCAGGGCAGGTGGCCTGG + Intronic
1002445173 5:179286316-179286338 AGGAGGCAGGGAGGCTGGCAGGG - Intronic
1002504557 5:179670204-179670226 AGGAGGCAGGAGAGGTGTCCAGG - Intergenic
1002534760 5:179870052-179870074 ATGAGGGAGGGGAGCGGGCAAGG + Intronic
1002583173 5:180222838-180222860 GGAAGGCAGGGAAGGTGGCATGG - Intergenic
1002587620 5:180261172-180261194 GTGATGCAGGGAAGCTGGCACGG + Intronic
1002633897 5:180597798-180597820 CTGAGGAAGGGGTGCTGGCAGGG + Intergenic
1003335556 6:5168645-5168667 ATGGGGCAGGGGCAGGGGCAGGG + Intronic
1003405017 6:5820992-5821014 ATCAAGCAGGGGATGTCGCATGG - Intergenic
1003907582 6:10716438-10716460 TGGCGGCAGGGGAGGGGGCAAGG + Intergenic
1003961195 6:11210933-11210955 ATTTGGCAGGGAAGGTGCCAGGG + Intronic
1004039328 6:11960402-11960424 ATGAGGCTGGAGAGGAGGCAGGG - Intergenic
1004058006 6:12160631-12160653 AGGAGGCAGGGGAGGGGGGCCGG + Intronic
1004222291 6:13757151-13757173 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1004258236 6:14084707-14084729 ATGAGACAAAGGAGGTGGGAAGG + Intergenic
1004370907 6:15051422-15051444 ATGGGGCTGGGCAGGTGGCGAGG - Intergenic
1004603524 6:17173441-17173463 AAGGGGCAGGGGAGGGGGCCAGG + Intergenic
1004618986 6:17316769-17316791 ATGAGCTCAGGGAGGTGGCAGGG - Intergenic
1004629320 6:17406539-17406561 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1004672450 6:17810394-17810416 ATTAGGCAGGGGTTGTGGGAGGG - Intronic
1004899111 6:20177905-20177927 AAGAGGGAAGTGAGGTGGCAGGG - Intronic
1005434574 6:25794760-25794782 GTGAGGCTGGGTAGGAGGCAGGG + Intronic
1005444566 6:25908496-25908518 ATGAGGCAAGTGAGGTGCCCAGG - Intergenic
1006078043 6:31546874-31546896 ATGAGGCAGGGGCGGAGACGGGG + Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006401498 6:33820586-33820608 ATGAGGCACAGCAGGTGGAATGG - Intergenic
1006403287 6:33830044-33830066 GTGAGGGAGGGGAGGAGACAAGG - Intergenic
1006516857 6:34550146-34550168 ATGGGGCAGGGCAGGGGTCAGGG - Intronic
1006580101 6:35072221-35072243 AGGAGGCAGGAGAAGCGGCAGGG - Intronic
1006604964 6:35249596-35249618 ATGGGGCTGAGGAGGTGGCTGGG - Exonic
1006740005 6:36301382-36301404 AGGAGGCTGAGGAGGCGGCAGGG - Intronic
1006825368 6:36930811-36930833 ATGAGGCTGGAGTGGTGGCCAGG - Intergenic
1006914447 6:37585356-37585378 AGGAGGCAGGGCTGGGGGCAGGG - Intergenic
1006990964 6:38214403-38214425 ATGAGACAGGACAGGTGACAAGG + Intronic
1007256427 6:40532570-40532592 CAGAGGCAGCGGAGGTGGGATGG - Intronic
1007273877 6:40659302-40659324 ATGAGGCAGGGAAGGTTCCCAGG - Intergenic
1007402133 6:41608833-41608855 AGGAGGCAAGGGAGGTGGCAGGG + Intergenic
1007785673 6:44277921-44277943 TTTAGCCAGGGGAGTTGGCAGGG - Exonic
1007786060 6:44280010-44280032 ATGAGGCAGGGAAGGGAGCCTGG - Exonic
1007921302 6:45612023-45612045 ATGGGGCATGAGAGGTGGGAAGG + Intronic
1008528034 6:52427291-52427313 ATGAGGCTGGGGAGAGAGCAGGG - Intronic
1008610963 6:53184173-53184195 ATCAGACAAGGGAGGAGGCAGGG - Intergenic
1008656377 6:53618296-53618318 ATGAGGAAATGGAGGTGGAAAGG - Intergenic
1009699845 6:67161661-67161683 ATGAGATATGGGAGGTGGCAGGG + Intergenic
1010319925 6:74495279-74495301 ATGAGGTGGGGGAGGGGGGAGGG - Intergenic
1010996084 6:82534741-82534763 ATGAGGCAGGGCAGGTCTGAAGG - Intergenic
1011002321 6:82604718-82604740 TTGAGGGAGGGAAAGTGGCAGGG + Intergenic
1011208032 6:84922571-84922593 AGGAGGCAGGGCAGGAGGCAGGG + Intergenic
1011211323 6:84959289-84959311 ATGAGACATGGGAGGGGCCAGGG + Intergenic
1011551339 6:88533682-88533704 ATGAGGCTAGGGAGGGGGCTGGG - Intergenic
1011916512 6:92512304-92512326 ATGAGACATGGGAGGGGCCATGG + Intergenic
1012106022 6:95159350-95159372 AAGAGGTAGAGGAGGTGGAAGGG + Intergenic
1012683489 6:102212418-102212440 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
1012857390 6:104518455-104518477 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
1012883209 6:104815923-104815945 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1013950866 6:115780380-115780402 AGGAGGCAGAAGAGTTGGCATGG + Intergenic
1014146551 6:118004707-118004729 ATGAGCCAGGCTTGGTGGCATGG - Intronic
1014251109 6:119116355-119116377 ATGAGGGAGGGAGGGGGGCATGG + Intronic
1014796288 6:125728699-125728721 TTCAGGCAGGGGTGGTGGCAAGG - Intergenic
1015171093 6:130254340-130254362 ATTAGCCAGGTGTGGTGGCAGGG - Intronic
1015310517 6:131762175-131762197 ATAAGCCAGGTGTGGTGGCATGG - Intergenic
1015369003 6:132429462-132429484 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1015882355 6:137881727-137881749 CTGGGGGAGGGGAGGTGGAATGG - Exonic
1015965344 6:138692304-138692326 GGGAGGCTGGGCAGGTGGCAGGG - Intronic
1016132560 6:140494246-140494268 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1016902517 6:149116382-149116404 GGGAGACAGGGGAGTTGGCAAGG + Intergenic
1017096757 6:150811720-150811742 CTGAGGCAGGGGCTGGGGCAGGG + Intronic
1017195363 6:151694637-151694659 ATTAGCCAGGAGTGGTGGCATGG + Intronic
1017554145 6:155544855-155544877 ATGAGGCAGGGCTGGTGGGCAGG + Intergenic
1017795872 6:157844020-157844042 ATTAGGCAGGTGAGGAGGTATGG - Intronic
1017807450 6:157958040-157958062 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1017810733 6:157981804-157981826 AGGAGGAAGGGGAGGAGGCCGGG + Intergenic
1018089456 6:160333155-160333177 AAGAGGGAGGAGAGGTGGGAAGG + Intergenic
1018169087 6:161129881-161129903 ACCAGGCAAGGGAGGTAGCAGGG + Intergenic
1018423965 6:163663513-163663535 TGGAGGCAGGGGAGGTGGAGGGG + Intergenic
1018743513 6:166747614-166747636 ATGAGGCTGGGCAGGGGGAAGGG + Intronic
1018745942 6:166762206-166762228 CTGAGGGAGGGGAGGACGCAGGG - Intronic
1018825654 6:167406270-167406292 ATGGGGCAGGGGCAGCGGCAGGG + Intergenic
1018839536 6:167508116-167508138 GAGAGGGAGGAGAGGTGGCAGGG - Intergenic
1018839902 6:167509175-167509197 ATGGGGGAGGTGAGGTGACAGGG - Intergenic
1019164792 6:170091114-170091136 AGGGGGCAGGGCAGGGGGCAGGG - Intergenic
1019315070 7:380531-380553 GGGAGGGAGGGGAGGGGGCAGGG + Intergenic
1019315084 7:380561-380583 GGGAGGCAGGGGAGGGGGCAGGG + Intergenic
1019315099 7:380591-380613 GGGAGGGAGGGGAGGGGGCAGGG + Intergenic
1019315114 7:380621-380643 GGGAGGGAGGGGAGGGGGCAGGG + Intergenic
1019440174 7:1041952-1041974 ATGCGGCAGGGGAAGGGGAAGGG + Intronic
1019590224 7:1827176-1827198 ATGAGTTAGAGGAGGTGGCGGGG + Intronic
1019705495 7:2495451-2495473 TGGAGGCAGGGGTGGAGGCAGGG + Intergenic
1019772787 7:2894324-2894346 AGGAGGCAGGGAAGGAGGGAGGG - Intergenic
1019919979 7:4157311-4157333 AGGAGGGACGGGAGGTGGAAGGG + Intronic
1019920013 7:4157440-4157462 AGGAGGGAAGGGAGGTGGAAGGG + Intronic
1019999147 7:4745075-4745097 AGGAGAGTGGGGAGGTGGCAGGG - Intronic
1020054986 7:5111458-5111480 ATTAGCCAGGGGTGGTGGCGGGG + Intergenic
1020416262 7:7949482-7949504 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1020583168 7:10031382-10031404 ATGAGGGATGGGAGGGTGCATGG + Intergenic
1020879256 7:13738493-13738515 ATGGGGCAGGGTAGGTGACAGGG + Intergenic
1020887980 7:13843357-13843379 ATTAGCCAGGTGTGGTGGCACGG + Intergenic
1021188027 7:17588102-17588124 AAAAGGCAGGGAAGGTGGGAAGG + Intergenic
1021200791 7:17726845-17726867 ATGAGGCAGAGAAGGAGGGAGGG - Intergenic
1021579076 7:22133218-22133240 ATAAGGCAGGGAAGGTGTCAAGG + Intronic
1021970509 7:25961126-25961148 AGAAGGCAGGGGAGGGGGCTGGG - Intergenic
1022221653 7:28319816-28319838 AGGAGGCTGGGAAGGTGGCTAGG + Intronic
1022492653 7:30832655-30832677 ATTAGCCAGGTGTGGTGGCACGG - Intronic
1022806153 7:33824495-33824517 AGGCTGCAGGGTAGGTGGCAGGG - Intergenic
1022820615 7:33956560-33956582 AGGAGGTAGAGGAGGTGGAAGGG - Intronic
1022829737 7:34053759-34053781 AAGAGGCAGAGGAAGTGGAAGGG + Intronic
1023496227 7:40800243-40800265 CTGAGGCAGGAGTGGGGGCAGGG + Intronic
1024605770 7:51021476-51021498 ATGAGCCAGGTGTGGTGGCACGG - Intronic
1024616936 7:51123820-51123842 ATGTGGGTGAGGAGGTGGCATGG - Intronic
1025117196 7:56268439-56268461 AGGAAGGAGGGGAGGTGGGAAGG - Intergenic
1025135641 7:56409540-56409562 ATTAGGCAGGCGTGGTGGCAGGG + Intergenic
1025255683 7:57382513-57382535 ATGAGACAGGAGAGCTGGCCAGG - Intergenic
1026002968 7:66577067-66577089 ATGAGGAAGGGAAGGAGGGAGGG + Intergenic
1026841129 7:73670456-73670478 ATGAGGCAGGAGCAGAGGCAGGG - Intronic
1026867497 7:73832523-73832545 ATGAGCCTGGGAGGGTGGCAGGG + Exonic
1026954156 7:74366252-74366274 AGGAGGCTGGGGAGTTGGAATGG - Intronic
1026971315 7:74469850-74469872 ATTAGTCAGGGGTGGTGGCTTGG - Intronic
1027214428 7:76174668-76174690 ATGAGGCTGGGCAGGGGGTAGGG - Intergenic
1027254464 7:76422274-76422296 AGGAGGCCGGGGAGGTGGGCGGG - Intronic
1027596147 7:80176788-80176810 ATTAGCCAGGGGTGGTGACAGGG + Intronic
1027649349 7:80846191-80846213 ATCAGGCTGAGGAGGTAGCAAGG - Intronic
1027795428 7:82687334-82687356 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1028164768 7:87525756-87525778 AAGAGGCAGAGGAAGTGGAAGGG + Intronic
1028470047 7:91196118-91196140 ATTGGGAAGGGGAGGTGGCTAGG - Intronic
1028635983 7:92989776-92989798 ATCCGGGAGGGGAGGTTGCAGGG + Intergenic
1028703918 7:93815750-93815772 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1029136509 7:98376357-98376379 ATTAGCCAGGTGGGGTGGCATGG + Intronic
1029165510 7:98586879-98586901 AAGAGGTAGAGGAGGTGGAAAGG + Intergenic
1029207338 7:98877874-98877896 TGGAGCCAGGGGAGGTGGCATGG - Intergenic
1030091292 7:105861391-105861413 ATGAGGCAGGCTAGCTGGGATGG + Intronic
1030311212 7:108071239-108071261 ATGAGGCAGGGGTGATGACAAGG - Intronic
1030345754 7:108431279-108431301 CTGTGGCAGTGGAAGTGGCACGG - Intronic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1031334481 7:120510861-120510883 ATGGGGCAGGGGAGGTGGCCAGG - Intronic
1031693226 7:124816826-124816848 ATAAGGCAGGGGTGGGGGCATGG + Intergenic
1032157675 7:129482523-129482545 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1032429032 7:131846025-131846047 CAGAGGCAGTGGCGGTGGCAGGG + Intergenic
1032742490 7:134752852-134752874 ATTAGCCAGGCGTGGTGGCATGG + Intronic
1033204494 7:139406197-139406219 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1033208879 7:139445568-139445590 ATGAGGCCTGACAGGTGGCAGGG + Intergenic
1033304822 7:140217338-140217360 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1034235039 7:149560048-149560070 ATGAGGGAGAGGAGGCTGCAAGG - Intergenic
1034376142 7:150646003-150646025 ATGAGGCAGAAGAGGTAGCTGGG - Intergenic
1034555610 7:151848670-151848692 ATTAGCCAGGGGTGGTGGCGGGG - Intronic
1034870341 7:154677837-154677859 CTGAGGCTGAGGAGGTGGCCTGG - Intronic
1035158940 7:156936874-156936896 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1035159462 7:156940615-156940637 ATGCGGCTGGCGAGGTGGCCAGG - Intergenic
1035299143 7:157885840-157885862 CTGAGGCAGGAGAAGTGACATGG - Intronic
1035307605 7:157943324-157943346 CTGGGGCATGGGAGGGGGCATGG - Intronic
1035534316 8:379578-379600 AGGAGGAGAGGGAGGTGGCAAGG + Intergenic
1035559579 8:594393-594415 AGGAGGCAGGGGAGGTGAACAGG - Intergenic
1036964103 8:13276798-13276820 AGCACGCAGGGGAGGTGGGAGGG + Intronic
1037085765 8:14847701-14847723 AGGAGGGAGGGGAGGAGGAAAGG + Intronic
1037129558 8:15391015-15391037 AAGAGGGAGGGAAGGGGGCAAGG + Intergenic
1037377334 8:18245066-18245088 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
1037402232 8:18504707-18504729 AAGAGGCTGGGGAGTGGGCAGGG + Intergenic
1037732715 8:21541730-21541752 ATGGGGCAGGAGAGGAAGCAAGG + Intergenic
1037908520 8:22729432-22729454 GTGAGGCAAGGGAGCAGGCAAGG + Intronic
1038375074 8:27032184-27032206 ATGAAGCCTGGGAGGTGGAAAGG + Intergenic
1038898290 8:31812567-31812589 AGGAGGAAGGGGAGGAGGAAGGG - Intronic
1040309672 8:46230281-46230303 ATGAGGCTGCAGAGGGGGCATGG + Intergenic
1040402583 8:47066896-47066918 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1040639800 8:49320197-49320219 AAGAGGTGGAGGAGGTGGCAAGG + Intergenic
1040899264 8:52402105-52402127 TTGTGGCAGTGGTGGTGGCATGG + Intronic
1042177832 8:66054877-66054899 CTGGGGTAGGGGAGGTGGGAGGG + Intronic
1042190282 8:66178831-66178853 AGGAGGAAGGGGAAGTGGGAAGG + Intergenic
1042370701 8:67987693-67987715 AGCAGGCAGGCGAGGTTGCAGGG - Intronic
1042655598 8:71092024-71092046 ATGTGGCAGGGGAGGGTACAGGG - Intergenic
1042692858 8:71522755-71522777 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1042975587 8:74465437-74465459 GTGGGGCAGTGGAGGTGGAAGGG - Intronic
1043583300 8:81738047-81738069 ATGAGGCAGGTGAGATGCCTAGG + Intronic
1043699147 8:83262188-83262210 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1044222788 8:89688923-89688945 ATGAGCCAGGTGCAGTGGCATGG + Intergenic
1044319427 8:90785844-90785866 TTGAGGCTGGGAAGGAGGCAGGG + Intronic
1044942168 8:97354379-97354401 ATGAGGAAGAGGAGGGCGCATGG - Intergenic
1045181643 8:99790687-99790709 ATGAGGATGGGAAGCTGGCAAGG + Intronic
1045347231 8:101304304-101304326 ATGAGGTCTAGGAGGTGGCAGGG - Intergenic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1045464937 8:102461161-102461183 ATGAGGCAAGTGAGATGGCTAGG - Intergenic
1046867839 8:119170796-119170818 ATGAGGCAGGGATGCTGTCAGGG + Intronic
1047234818 8:123031395-123031417 ATTAGCCAGGTGAGGTGGCGGGG + Intronic
1047435836 8:124834906-124834928 AGGGGGCTGGGGAGGTGTCAGGG - Intergenic
1047653291 8:126947866-126947888 AGGAGGCAAGAGAGGAGGCAGGG + Intergenic
1048148203 8:131866233-131866255 ATTAGCCAGGTGTGGTGGCACGG - Intergenic
1048204780 8:132406721-132406743 ATAAGTCAGGGGATGTGGTATGG + Intronic
1048482107 8:134807578-134807600 ATAAGGCAGGGCAGCTGGGAAGG + Intergenic
1048816471 8:138339109-138339131 ATGGGGTGGGGGAGGGGGCAGGG + Intronic
1048988728 8:139749121-139749143 ATGGAGCAGGGGAAGTCGCAGGG - Intronic
1049290192 8:141797663-141797685 ACGAGGCGGGGCAGGTGGGAGGG + Intergenic
1049362559 8:142219322-142219344 AGGAGGGAGGGGAGGAGGAAGGG + Intronic
1049698298 8:143994344-143994366 GTGAGGCAGGGGAGGTTGGGAGG - Intronic
1049783020 8:144437367-144437389 ATGAGGCAGGCGGGGCGGGAAGG + Intronic
1049852533 8:144840742-144840764 GAGAAGCAGGGGAGGTGGCCAGG + Intronic
1050324195 9:4484563-4484585 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1050529579 9:6576612-6576634 ATTAGCCAGGTGTGGTGGCAGGG - Intronic
1050815826 9:9810041-9810063 AGGAGGAAGGGGAGGTGGAAGGG - Intronic
1051119567 9:13737285-13737307 ATAAGGAAGGGGAGTTGGCAGGG - Intergenic
1051423603 9:16913315-16913337 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
1051765961 9:20524018-20524040 AGGGGTCAGGGGAAGTGGCAGGG + Intronic
1052299648 9:26939238-26939260 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
1052305685 9:27006676-27006698 AGGAGGAAGGGAAGGAGGCAGGG + Intronic
1052332341 9:27282519-27282541 CTGAGCCAGTGGAGGTGGCCTGG - Intergenic
1052431896 9:28377190-28377212 AAGAGGTGGGGGAGGTGGAAGGG - Intronic
1052475722 9:28956706-28956728 AGGAGGCAGGGGAGGGAGGAGGG - Intergenic
1052693725 9:31849601-31849623 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1052730501 9:32279666-32279688 AGAAGTTAGGGGAGGTGGCAGGG - Intergenic
1052899052 9:33774511-33774533 ATGAGGCAGGGCAGGGAGGAGGG + Intronic
1052918120 9:33939768-33939790 AGGAGGAAGGGGAGGAGGAAGGG + Intronic
1052918125 9:33939780-33939802 AGGAGGAAGGGGAGGAGGAAGGG + Intronic
1052918130 9:33939792-33939814 AGGAGGAAGGGGAGGAGGAAGGG + Intronic
1052918135 9:33939804-33939826 AGGAGGAAGGGGAGGAGGAAGGG + Intronic
1054529311 9:66163118-66163140 ATCAGCCAGGTGTGGTGGCAGGG + Intergenic
1054675032 9:67849150-67849172 ATCAGCCAGGCGTGGTGGCAGGG - Intergenic
1054766214 9:69044680-69044702 GAGATGCAGGGGAGGTGACAGGG - Intronic
1055183659 9:73422768-73422790 TAGAGGGAGGGGAGGAGGCAGGG + Intergenic
1055915606 9:81397099-81397121 AGGAAGCCGTGGAGGTGGCAGGG - Intergenic
1056409053 9:86307123-86307145 ATTAGCCAGGCGTGGTGGCACGG + Intronic
1056574336 9:87843385-87843407 AAGAGGCAGGGGACCTGGCCTGG + Intergenic
1056687997 9:88782634-88782656 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1057157132 9:92852682-92852704 ATTAGCCAGGCGAGGTGGCAGGG - Intronic
1057185478 9:93055273-93055295 AGGAGGCAGGGGAGGAGGCTAGG - Intergenic
1057187008 9:93062624-93062646 TTGAAGCAGGGGAGGGGACAGGG + Intronic
1057311081 9:93943697-93943719 CTGAGGCAGGGGCAGGGGCAGGG - Intergenic
1057444490 9:95104146-95104168 GAGAGGCAGGGGTGGTGGGAGGG + Intronic
1057548956 9:96038221-96038243 ATCAGGCAGGGGAGGCAGGAAGG + Intergenic
1057579332 9:96272219-96272241 ATGAGCCAGGTGTGGTGGTACGG + Intronic
1057946288 9:99331995-99332017 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1057955505 9:99403965-99403987 ATGAAGCATAGGAGATGGCAAGG - Intergenic
1058454302 9:105125041-105125063 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1058740701 9:107939511-107939533 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1058849192 9:108994082-108994104 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
1058983234 9:110189360-110189382 ATGGGGGAAAGGAGGTGGCAGGG - Intergenic
1059237144 9:112770605-112770627 GTGAGGCAAGGGAGTGGGCAGGG - Intronic
1059331100 9:113536378-113536400 GTGAGCCAGGGGAGGTGGGGAGG + Intronic
1059336123 9:113569399-113569421 CTGTGGAATGGGAGGTGGCATGG + Intronic
1059353695 9:113683927-113683949 AGGAGGAAGGGGAAGTGCCAAGG + Intergenic
1059432800 9:114260115-114260137 CTGAGGCAGGGCAGGGGGCCTGG - Intronic
1059449420 9:114361048-114361070 CTGAGGCTGGGGAGGTGGCAGGG - Intronic
1059923954 9:119187387-119187409 TTGTGGCAGTGGTGGTGGCAAGG - Intronic
1059946223 9:119411072-119411094 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1059999373 9:119944340-119944362 AAGAGGCAAGGGAGGTGCCAGGG - Intergenic
1060190843 9:121591488-121591510 ATGAGGCTGGGGAGATGGGTAGG + Intronic
1060277777 9:122194870-122194892 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1060972518 9:127746788-127746810 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1060999433 9:127894751-127894773 ACCAGGCATGGTAGGTGGCAAGG - Intronic
1061010345 9:127950896-127950918 AGCAGGCAGGGGAGGAGGGAAGG + Intronic
1061061322 9:128251674-128251696 ATGTGGTAGGGGTGGCGGCAGGG + Intronic
1061093668 9:128441673-128441695 ATTAGCCAGGGGTGGTAGCACGG - Intergenic
1061246074 9:129401820-129401842 ATGAGGGAGGGAAGGTGGGAGGG - Intergenic
1061281615 9:129600932-129600954 CTGAGGCACGGTATGTGGCAGGG + Intergenic
1061382110 9:130264936-130264958 ATGGGGCTGGGGAGGTGGATGGG + Intergenic
1061402931 9:130378316-130378338 AGGAGGCTGGGGAGGAGGCTGGG + Intronic
1061572605 9:131487085-131487107 GAGGGGCAGGGGAGGTGGGAGGG + Intronic
1061590047 9:131592271-131592293 GAGAGGCAGGGGAGATGGCACGG + Intronic
1061947108 9:133914645-133914667 AGGAAGCAGGGGAGGGGGGAGGG + Intronic
1061977891 9:134081184-134081206 TTGAGGCAGGGGAAGTGCTAAGG + Intergenic
1062012613 9:134275137-134275159 AAGATGCAGGGAAGGTGGCCTGG + Intergenic
1062043017 9:134412694-134412716 CTGAAGCCGGGGAGGGGGCAGGG + Intronic
1062050110 9:134442810-134442832 GAGAGGCAAGGGAGGGGGCAGGG + Intergenic
1062180508 9:135188851-135188873 ATGTGGCATGGGGTGTGGCAGGG - Intergenic
1062361451 9:136190214-136190236 ATGAGGCAGGGGGAGGGGGAGGG - Intergenic
1062444839 9:136589250-136589272 AAGAGGCAGGGGTGGTGGGGAGG + Intergenic
1062721314 9:138045736-138045758 GAAAGGCAGGGGAAGTGGCAAGG + Intronic
1203619854 Un_KI270749v1:115103-115125 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1185483470 X:465357-465379 ATTAGGCAGGTGTGGTGGCGGGG - Intergenic
1185552210 X:992240-992262 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1185629849 X:1507987-1508009 AAGAGGTGGGGGAGGCGGCAGGG - Intronic
1186064941 X:5753081-5753103 AGGAGGCAGGGAGGGAGGCAGGG + Intergenic
1186124708 X:6400905-6400927 AGGAGGAAGGGGAGGGGGCAGGG - Intergenic
1186486380 X:9937244-9937266 GTGGGGCAGGGCAGGTGGCTCGG - Exonic
1186730143 X:12401347-12401369 ATGAGAGAGGGGAGGAGACAGGG - Intronic
1186906006 X:14111211-14111233 ATGAGGCTGAGGAGGTGACAAGG - Intergenic
1187296283 X:18004130-18004152 AAGAGGCAGGGGAGGGGAGACGG - Intergenic
1187665973 X:21609576-21609598 AGGAGGAAGGGGAGGCAGCAGGG + Exonic
1188281488 X:28275237-28275259 ATGAAGCTGGGAAGGTGGAAGGG + Intergenic
1188448302 X:30281181-30281203 ATGAGGTTGGGGAGGGGGGAGGG - Intergenic
1188537946 X:31218362-31218384 ATGGGGCAGGGGCAGGGGCAGGG + Intronic
1188761890 X:34042567-34042589 ATGAGCCAGGTGTGGTGGCGGGG - Intergenic
1189110539 X:38285918-38285940 AAGTGGAAGGGGAGGTGGAAGGG - Exonic
1189110544 X:38285930-38285952 AAGAGGAAGGGGAAGTGGAAGGG - Exonic
1189793730 X:44627515-44627537 ATGATGTAGGGGAGATGTCATGG - Intergenic
1189853640 X:45200991-45201013 ATGAGGCTGGGGAGGAGGTGAGG + Intergenic
1189913969 X:45838763-45838785 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1190009185 X:46768691-46768713 GAGACGGAGGGGAGGTGGCAGGG - Intergenic
1190089152 X:47422307-47422329 ATTAGACAGGCGTGGTGGCATGG + Intergenic
1190286670 X:48966122-48966144 CTGAGGCAGTGGAGTTGGCAAGG + Exonic
1190309605 X:49107504-49107526 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1190591211 X:52003659-52003681 GTGAGCCAGGGGAGATGGCATGG + Intergenic
1190870394 X:54420178-54420200 ATGAGGCTAGAGAGGTGGCAAGG + Intergenic
1190889437 X:54555812-54555834 TTTAAGCAGGGGAGGTGACATGG - Intronic
1191227051 X:58054637-58054659 ATGAGGGTGGGAAGGTTGCATGG - Intergenic
1192232778 X:69277590-69277612 ATGGGGCAGGAGAGATGGCAAGG + Intergenic
1192306569 X:69966430-69966452 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1192312816 X:70030562-70030584 TGGAGGCTGGGGAGGAGGCAGGG - Intronic
1192776206 X:74248213-74248235 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1192805764 X:74507092-74507114 ATTAGCCAGGTGTGGTGGCACGG - Intronic
1193143423 X:78053712-78053734 ATGAGACTTGGGAGGGGGCAAGG - Intergenic
1194042009 X:88952558-88952580 ATGAGGTTGGGGAGGGGGGAGGG + Intergenic
1194481638 X:94433668-94433690 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1195292628 X:103443932-103443954 ATGAAGCAGGGTGGGCGGCAGGG - Intergenic
1195495496 X:105527814-105527836 AAGAGGAAGGAAAGGTGGCAGGG - Intronic
1195700016 X:107697928-107697950 ATTAGCCAGGTGTGGTGGCACGG - Intergenic
1195970396 X:110466906-110466928 AGGAGGCTGGGGAGGTGGTGGGG - Intergenic
1196145433 X:112311566-112311588 AGCAGGCAGGGGAGGAGGGAGGG - Intergenic
1197336032 X:125210474-125210496 ATGAGGCAGGAGAGGCAGAAAGG + Intergenic
1197899374 X:131353711-131353733 TTGAAGAAGGGGAGGTGGAACGG + Intronic
1198128162 X:133668048-133668070 ATTAGCCAGGTGTGGTGGCAGGG - Intronic
1199572062 X:149276186-149276208 ATGAGAAAGGGAAGGAGGCAGGG - Intergenic
1200089736 X:153628825-153628847 AAGAGCCGGGGGAGGGGGCAAGG + Intergenic
1201225311 Y:11812861-11812883 ATTAGCCAGGAGTGGTGGCAGGG + Intergenic
1201278707 Y:12322020-12322042 AGCAGGCAGGGAAGGTGGCTGGG - Intergenic
1201312568 Y:12610139-12610161 ATTAGCCAGGGATGGTGGCATGG + Intergenic
1201550186 Y:15210795-15210817 ATCAGGCAGGGAGGGAGGCAGGG + Intergenic